Article Per Year (5 Year)
p-Index From 2021 - 2026
2.959
P-Index
This Author published in this journals
All Journal Jurnal Veteriner Jurnal Teknologi Laboratorium Journal of Health (JoH) Medical Laboratory Technology Journal THE JOURNAL OF MUHAMMADIYAH MEDICAL LABORATORY TECHNOLOGIST Meditory : The Journal of Medical Laboratory Journal of Health Sciences Medical Technology and Public Health Journal Medical Laboratory Analysis and Sciences Journal JURNAL ANALIS LABORATORIUM MEDIK Jurnal Riset Biologi dan Aplikasinya Sains dan Matematika Medicra (Journal of Medical Laboratory Science/Technology) Darmabakti : Junal Pengabdian dan Pemberdayaan Masyarakat Jurnal Pengabdian Masyarakat dalam Kesehatan Humanism : Jurnal Pengabdian Masyarakat Jurnal Abdimas Kartika Wijayakusuma Indonesian Journal of Innovation Studies Manajemen Pelayanan Kesehatan Indonesian Journal Health Science and Medicine
Miftahul Mushlih
Universitas Muhammadiyah Sidoarjo
Religion Agriculture, Biological Sciences & Forestry Humanities Astronomy Biochemistry, Genetics & Molecular Biology Chemistry Computer Science & IT Dentistry Education Engineering Environmental Science Health Professions Immunology & microbiology Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Veterinary Other

Published : 33 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search
Journal : Medicra (Journal of Medical Laboratory Science/Technology)

 1 
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Analysis Of The Inhibitory Ability Of Spike Attachment Of The Delta Variant Of Sars Cov-2 With Ace2 By The Active Compound In Turmeric (Curcuma longa L.) In Silico : Analisis Kemampuan Penghambatan Penempelan Spike Sars Cov-2 Varian Delta Dengan Ace2 Oleh Senyawa Aktif Pada Kunyit (Curcuma longa L.) Secara In Silico Liyaajul, Pratasyah; Mushlih, Miftahul; Rini, Chylen Setiyo; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 6 No. 1 (2023): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v6i1.1703

Abstract

Turmeric (Curcuma longa L.) is an herbal plant that has many benefits as a treatment, including during the COVID-19 pandemic, one of the mechanisms of inhibition of SARS CoV-2 is to inhibit the attachment of ACE2 with Spike. The binding of the spike protein to the ACE2 receptor will produce conformational changes in the S protein, this study was conducted using an in silico method (computational analysis) which aims to determine the potential efficacy of Turmeric and its effectiveness in inhibiting the Delta variant of SARS CoV-2. The active compound contained in Turmeric (Curcuma longa L. ) obtained from the KNApSAcK database To determine compounds that can have potential and have good effectiveness in inhibition of the Delta Variant of SARS CoV-2, an analysis was carried out by looking at the binding energy and conformation changes that occur at the sticky point in each compound. Three-dimensional structure of SARS CoV-2 Varian Delta downloaded from the Protein Data Bank with PDB code 7V8B. Based on the analysis carried out, it was found that the compound (E)-nuciferoll has the lowest binding energy value of -1212.59 kcal / mol and is located at the initial attachment but cannot change the conformation, but from the sticky point of the compound (E)-nuciferol lies in the initial attachment of RBD-ACE2.
Co-Authors Ahmad Shobrun Jamil Aini, Aqiliyanti Nur Alifia Nurfitriana Amin, Hindah Sabrina Andika Aliviameita Andika Aliviameyta Anggie Wedha Puspita Apriliana, Dinda ARDIANSYAH, SYAHRUL Arief Wisaksono Aulia, Faradila Nur Azhar, Risya Auliya' Putri Bayu Segara Budi Setiadi Daryono Chylen Setiyo Rini Dewanata, Pandu Aji Dian Delta Dina Trikumalasari Djauharoh Djauharoh Evi Rinata Firda, Aminatul Fitri Kumala Sari Fitrian Desi Prameswari Galuh Ratmana Hanum Hadie, Djauharoh A Hindah Sabrina Amin Huesein, Iknan, Siti Asriani Imamah, Siti Aliyatul Jamilatur Rohmah Jayanti, Liah Dwi Kartikasari, Erina Wahyu Kurnia Wahyu Ningsih Livia Nur Azzah Liyaajul, Pratasyah Meryn Linanda Agustin Nia Lukita Arian NUR EFENDI Nurul Azizah NURUL AZIZAH Paramitha Amelia Kusumawardani Puspitasari Puspitasari Puspitasari Puspitasari Puspitasari Qilmia Fanani Rohman Dijaya Sari, Azizah Krismonita Sari, Fitri Kumala Segara, Bayu Siska Aprilia Siti Asriani Iknan Siti Cholifah Tis’iyyah , Siti Nur Maghfiroh Wardana, Aji Cakra Yanik Purwanti Zakaria, Rizal