Article Per Year (5 Year)
p-Index From 2021 - 2026
1.503
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences ACTA VETERINARIA INDONESIANA Hemera Zoa Jurnal Sain Veteriner EKSAKTA: Journal of Sciences and Data Analysis Jurnal Veteriner Indonesian Journal of Biotechnology JURNAL KAJIAN VETERINER The International Journal of Tropical Veterinary and Biomedical Research
Heru Susetya
Universitas Gadjah Mada
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Earth & Planetary Sciences Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Public Health Veterinary

Published : 23 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 4 Documents
Search
Journal : Indonesian Journal of Biotechnology

 1 
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Susetya, Heru; Naoto, Ito; Sugiyama, Makoto; Minamoto, Nobuyuki
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB)

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesiawas determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of theRC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomainbetween this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effectivefor rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the Ggenes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus fromChina than to viruses from Thailand and Malaysia. This genetic data and historical background suggest thatrabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from Chinato Indonesia.Keywords : Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Heru Susetya; Ito Naoto; Makoto Sugiyama; Nobuyuki Minamoto
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB) | DOI: 10.22146/ijbiotech.7413

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesia was determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of the RC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomain between this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effective for rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the G genes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus from China than to viruses from Thailand and Malaysia. This genetic data and historical background suggest that rabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from China to Indonesia.
Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
Co-Authors Anak Agung Gde Putra Arselia Kartika Sari Astri Dwyanti Tagueha Bambang Sumiarto Bambang Sumiarto Bambang Sumiarto Bambang Sumiarto Bawono, Gigih Charles Rangga Tabbu Charles Rangga Tabbu Daniel Happy Putra Dewi Anggreini Doddi Yudhabuntara Doddy Yudhabuntara Dyah Ayu Widiasih Dyah Ayu Widiasih F. Lintang R. Daru Maya Gallantiswara, Putu Cri Devischa Hani Muhamad Mardani Haryadi M. Wibowo Haryadi M. Wibowo, Haryadi M. Helen Scott-Orr I Gusti Ngurah Kade Mahardika I Nyoman Dibia Indri Permatasari Ito Naoto Ito Naoto, Ito Khrisdiana Putri Khrisdiana Putri Khrisdiana Putri, Khrisdiana M.Th. Khrisdiana Putri Makoto Sugiyama Makoto Sugiyama, Makoto Michael Haryadi Wibowo Muchammad Taufik Kurniawan Niken Respati Maharani Nobuyuki Minamoto Nobuyuki Minamoto, Nobuyuki Prisha Lini Sivalingham Rahmi, Siwi Meylina Roza Azizah Primatika Roza Azizah Primatika Roza Azizah Primatika, Roza Azizah Salim, Devi Andreani Setyawan Budiharta Silalahi, Gustaf Eifel Toha, Larry Richard Wellem Tri Untari Tri Untari Widagdo S. Nugroho Widagdo Sri Nugroho Widagdo Sri Nugroho Widya Asmara Yatri Drastini Yudhanto, Setyo Yuli Miswati