Article Per Year (5 Year)
p-Index From 2020 - 2025
3.701
P-Index
This Author published in this journals
All Journal Jurnal Keperawatan BALI MEDICAL JOURNAL (BMJ) INDONESIAN JOURNAL OF LEGAL AND FORENSIC SCIENCES Jurnal Kedokteran Syiah Kuala Journal of the Indonesian Tropical Animal Agriculture Indonesian Journal of Tropical and Infectious Disease Jurnal Penelitian Kesehatan Suara Forikes Qanun Medika - Medical Journal Faculty of Medicine Muhammadiyah Surabaya Journal of Epidemiology and Public Health Jurnal Respirologi Indonesia Bioscientia Medicina : Journal of Biomedicine and Translational Research Jurnal Respirasi (JR) Indonesian Journal of Clinical Pathology and Medical Laboratory (IJCPML) APTEK Jurnal Layanan Masyarakat (Journal of Public Service) Jurnal Kesmas Asclepius Indian Journal of Forensic Medicine & Toxicology Jurnal Cahaya Mandalika Bioscientia Medicina : Journal of Biomedicine and Translational Research Journal of Scientech Research and Development Hang Tuah Medical Journal Journal of Clinical Microbiology and Infectious Diseases
S. Soedarsono
Department Of Pulmonology, Faculty Of Medicine, Hang Tuah University
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Dentistry Earth & Planetary Sciences Education Engineering Environmental Science Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Medicine & Pharmacology Neuroscience Nursing Public Health Social Sciences Other

Published : 41 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 1 Documents
Search
Journal : Journal of Clinical Microbiology and Infectious Diseases

 1 
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
Co-Authors Abdul Rahman Bahmid Agnes Dwi Sis Perwitasari, Agnes Dwi Sis Agung Dewi Sekar Agustinus Rizki Wirawan Riadi Akirasena, Mayoori Alvin Hartanto Kurniawan, Alvin Hartanto Amelia Lorensia ANAK AGUNG ISTRI AGUNG, SRILA NATASWARI Andri Dwi Wahyudi Andy Sulaiman Siregar Anindya Zalfaa Kusuma Dewi Anita Dewi Anggraini Anita Widyoningroem Bendrong Moediarso Budi Suprapti Budiono Budiono D. Sunarti Deby Kusumaningrum Diana, Adawiyah Putri Dody Taruna Eko Budi Koendhori, Eko Budi Elisabeth Tri Wahyuni Widoretno Farah Nurul Rakhima H. Haryono Indri Ngesti Rahayu Irmawati M. Dikman Isa Ansori Jusak Nugraha Jusak Nugraha Kartono Wibowo Kuntaman Kuntaman Kusmiati, Tutik Laily Hidayati Lestari Dewi Lulus Handayani M. Faiqun Ni'am M. Yamin S. S Makhfudli Makhfudli ManikRetno Wahyunitisari Mohammad Yamin Sunaryo Suwandi Monica Dyah Puspitasari Muhammad Bagus Fidiandra Ni Made Mertaniasih Ni Putu Anggita Medyantari Nurul Wiqoyah, Nurul Nuswantoro, Djohar Pepy Dwi Endraswari, Pepy Dwi Permatasari, Ariani Pramanindyah Bekti Anjani Prasetya, Hanung Purwoko, Agus Putra, Oki Nugraha Putranto, J. Nugroho Eko Rachmat Mudiyono Retno Budiarti Ricky Septafianty Rivan Virlando Suryadinata Ronald Pratama A. Ronald Pratama Adiwinoto Rosantia Sarassari Rudi Hariyono Safira Nur Ainiyah Setiawati, Rosy Sheila Gerhana Darmayanti Shelly Puspita Ayu Wardhani Siti Ermawati Sondang Kuncoro Stephanie Christina Sulaiman Tejowati, Rr Putri Tejowati Titiek sulistyowati Tri Puji Astuti Umiastuti, Pirlina Wahyu Agung Purnomo Wahyu Setiani Wibowo Wahyu Setiani Wibowo Wayan Tunas Artama Yelvi Levani