cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Syamsurizal
Contact Email
syam_unp@fmipa.unp.ac.id
Phone
-
Journal Mail Official
syam_unp@fmipa.unp.ac.id
Editorial Address
-
Location
Kota padang,
Sumatera barat
INDONESIA
Bioscience
Published by Universitas Negeri Padang
ISSN : 2614669X     EISSN : 2579308X     DOI : -
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Immunology & microbiology
Bioscience ISSN 2579-308X (Electronic) ISSN: 2614-669X (Print) is peer-reviewed journal and scientific journal publish by Universitas Negeri Padang. The aim of this journal is to publish articles dedicated to all aspects of the latest outstanding developments in the field of biology. Scope of this journal is ;Environmental Biology; Genetics and Biotechnology; Biology of Function; Systematics, Structure and Development.
Arjuna Subject : -
Articles 146 Documents
 11   12   13   14   15 
Antioxidant Activity, Total Phenolic and Flavonoid Content of Honey Bee Narti Fitriana; Risya Raisyah; Siti Nurbayti; Festy Auliaur Rahmah
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.125200

Abstract

Honey is a natural product that has many benefits,for living organism. The composition of honey is very diverse and depends on the type of honey and the region of origin. Bioactive compounds in honey including phenolics and flavonoids cause honey to having antioxidant activity. This study aims to identify honey bees, determine the chemical properties of honey based on the parameters of water content, acidity, and reducing sugar, and analyze the antioxidant activity and phenolic and flavonoid content of honey from Bukit Tiga Puluh National Park Riau and Prabumulih South Sumatra. The research using descriptive method were morphological identification of bees, testing parameters of honey bee chemical properties, DPPH antioxidant test to obtain IC50 (Inhibition consenteration) values, total phenolic and flavonoid levels. The identified bees are Apis mellifera (from Riau) and A. dorsata (from Prabumulih). This essay showed that the determination of water content, acidity, reducing sugar, both honeys fulfill SNI 8664:2018 except the reducing sugar of A. dorsata honey bee. A. dorsata honey bee has antioxidant activity higher IC50 value (590 mg/L) than A. mellifera honey (678 mg/L). Total phenolic (TPC) and flavonoid (TFC) of A. mellifera honey were 7.51 mg GAE/g and 0.06 mg QE/g, respectively higher than A. dorsata honey bee (3.35 mg GAE/g and 0.42 mg QE/g).
Design and Specificity Test of Specific Primers for Neuroglobin Gene Expression Modulation in Brain Tissue of Rattus norvegicus using qRT-PCR Bintang Fadhil Ramadhan; Muhammad Farikh; Muhammad Naufal Arrafi; Nagra Aulia Valofi; Walidatul Awaliyah; Jessi Rizkanauli Simangungsong; Dini Herisanti; Siska Alicia Farma
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.125246

Abstract

Neuroglobin (Ngb) is a newly discovered globin that is found in large numbers in neurons. Brain cells are very sensitive to lack of oxygen and can begin to die within five minutes after the oxygen supply is cut off. hypoxic conditions of brain tissue are ischemic in the area of the bleeding center. This study aims to design and analyze the expression of the Neuroglobin Rattus norvegicus mRNA gene in silico as a nucleotide that is able to read neuroglobin gene expression due to hypoxic states. The neuroglobin gene sequence was obtained using a "nucleotide" search menu provided by NCBI GenBank and designed using Geneious Prime bioinformatics software. The neuroglobin gene sequence used in this study was Rattus norvegicus mRNA with accession number NM_033359.3|:1-1,773. Synthesized primary pairs are optimized using PCR gradients. PCR products were analyzed by electrophoresis using 1.5% agarose gel, 100 V for 27 minutesThe results obtained one forward primer for Rattus norvegicus neuroglobin (Ngb) which has a length of 20 bases with the order of 5' AGTCTTAGCCTCTCCCCCAG -3' and reverse primer has a length of 20 bases with the order of 5' GTCTACAGAACCACGGCACAcx-3' product size 803 bp. The difference Tm in this pair of primers is 0.9 0C. The gradient PCR results showed the thickest and clearest DNA bands were at 57.7°C.  Primers with the best primary criteria for neuroglobin genes were obtained with an amplicon size of 803 bp and an aneealing temperature of 57.7 °C.  The design results meet the requirements of good criteria so that the primary candidate design results can be used for the PCR process.
The Potential of Hot Water Sapan Sungai Aro Thermophilic Bacteria Consortium in Producing Bioethanol Inayatul Fatia; Irdawati Irdawati; Linda Advinda; Azwir Anhar
Bioscience Vol 7, No 2 (2023): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v7i2.123265

Abstract

Biofuel is a potentially renewable alternative fuel in Indonesia. Bioethanol is one example of the most commonly used biofuel. Microorganisms of thermophilic bacteria are known to contribute to the production of bioethanol. Thermophilic bacteria are efficient against high temperature conditions so as to minimize contamination. Production of bioethanol can also use joint culture (consortium). Bioethanol production using a microbial biculture consortium is known to significantly increase the level of bioethanol production. The purpose of this study was to determine the compatibility and to determine the optimum potential of the thermophilic bacterial biculture consortium of Sapan Sungai Aro hot water for bioethanol production. This research is a type of descriptive research. To test the cooperation between consortium isolates of thermophilic bacteria producing bioethanol, a compatibility test was carried out using the disk diffusion method. Then the consortium isolates were fermented in liquid TMM (Thermophilic Minimum Media) medium, the bioethanol content was measured after distillation using a pycnometer. The results of the bacterial compatibility test showed that there was one pair of isolates that were not compatible, namely SSA 8 & SSA 14 due to the presence of a clear zone. On research results. The production of bioethanol by a consortium of thermophilic bacteria gives more optimal results compared to a single isolate. The best thermophilic bacterial biculture consortium from the Sapan Sungai Aro hot spring in producing biofuels is SSA 14 & SSA 16 which is 3.009%. 
A PRELIMINARY STUDI ON TREES AND ROAD INFRASTRUCTURE CONFLICTS IN PADANG CITY WEST SUMATERA INDONESIA marsia pela; Afrizal Afrizal; Reki Kardiman; Jabang Nurdin
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.127749

Abstract

Trees always appear as green building in a city, it growth side by side with various types of soild infrastructures and often ended with a conflict. Many cities in Indonesia experience the conflicts, especially between road and trees, which resulting risks to public and high restoration cost, but this urban green dynamic has not scientifically explored yet. We initiates a study on the dynamics of tree conflicts with road infrastructure in Padang City, a representative city in Indonesia with numerous conflict events. Species of tree, diameter, and distance to infrastructure were measured along 1.5 km of secondary and 1.5 km of primary road. There were 524 trees belong to nine species were found along 3 km road, and 35% of the trees were conflicted with the infrastructure. Primary road was dominated by small trees and was only causing 11% conflicts, while secondary road was dominated by large trees and 71% were conflicted. Number of conflict led by Pterocarpus indicus on both road types, while Swietenia mahogani was only conflicted with secondary road infrastructure and Dialium indum was only conflicted at primary road. Conflict of P. indicus at primary road was found at all diameter levels but at the secondary road the conflict was mostly associated to large trees. We also found many trees without conflict at all levels of diameter on both road types. Conflict of trees occurred at various distance to infrastructure and this found on both small and large trees. This study highlight that conflict between trees and infrastructure differed among species, size of tree diameter and conflict will always occurred when trees planted less than 2 m to infrastructure.
PRODUCTION OF SPESIFIC XYLANASE ENZYME BY MUDIAK SAPAN HOT WATER THERMOPHILIC BACTERY Irdawati Irdawati; Muhammad Deedat Ayasy; Azwir Anhar; Linda Advinda; Yusrizal Yusrizal
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.122728

Abstract

Xylanase is an extracellular enzyme capable of hydrolyzing hemicellulose so that it can convert xylan into xylose. Thermostable xylanase enzymes can be produced by thermophilic bacteria. Thermophilic bacteria are used because they have advantages such as the ability to increase enzyme production in adjustable catalytic specifications. Bacteria are not only in a single form but also exist in a mixed form called a consortium. Compared with a single isolate, the performance of the consortium is better. Consortium is a mixture of microbial populations in the form of communities that have cooperative, commensal, and mutualistic relationships. This study aims to look at the cooperation between the consortium isolates and the consortium's ability to produce xylanase enzymes. This research is a descriptive study. The bacterial consortium is fermented in beechwood xylan medium. The results of this study were that MSS 11, MS 18, MS 16 consortium produced the highest xylanase enzyme activity, namely 12,887.Xilanase merupakan enzim ekstraseuler yang mampu menghidrolisis hemiselulosa sehingga dapat merubah xilan menjadi xilosa. Enzim xilanase termostabil dapat diproduksi oleh bakteri termofilik. Bakteri termofilik digunakan karena dapat memiliki keunggulan seperti aktivitas dan peningkatan spesifikasi katalisis yang dapat diatur. bakteri tidak hanya dalam bentuk tunggal namun juga ada dalam bentuk campuran yang disebut konsorsium. Dibandingkan dengan isolat tunggal, kinerja konsorsium lebih baik. Konsorsium merupakan campuran populasi mikroba dalambentuk komunitas yang mempunyai hubungan kooperatif, komensal, dan mutualitsik. Penelitian ini bertujuan untuk melihat kerjasama antar isolat konsorsium dan kemampuan konsorsium dalam menghasilkan enzim xylanase. Penelitian ini bersifat deskriptif. Pada penelitian ini, konsorsium bakteri difermentasikan dalam medium beechwood xylan. Hasil penelitian ini adalah konsorsium MSS 11, MS 18, MS 16 menghasilkan aktivitas enzim xylanase spesifik tertinggi yaitu 12,887.
Morphological Response of Several Rice Varieties to Drought Stress Simulation using PEG Rezi Nabilah; Afifatul Achyar; Zulyusri Zulyusri; Yusni Atifah; Dwi Hilda Putri; Violita Violita
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.122676

Abstract

Rice has become food for most of the world's population. Indonesia is the third largest producer in the world. However, in fact rice production in Indonesia has decreased by 0.43% compared to 2020. One of the factors that can cause this decline is drought. Because rice is a semi-aquatic plant that grows normally in flooded conditions, it makes drought stress very threatening. Drought stress that occurs in plants causes plants to experience oxidative stress due to excessive accumulation of ROS. PEG is a compound that is widely used to provide drought conditions in plants. Previous research has classified several varieties of rice plants based on their level of resistance to drought. However, it is not yet known how the morphological response will be in different periods of drought stress and rewatering treatment. This research was conducted by giving treatment in the form of control (Yoshida nutrient culture solution) and drought stress (Yoshida + PEG-6000 20% solution) repeated 3 times. The observed parameters were RWC which were analyzed using standard errors and morphological images of roots and leaves. The results showed that the RWC obtained during the stress period from the third to the fifth day, Harum had the highest value according to its class as tolerant rice. After rewatering Rosna has a better recovery ability. In addition, root morphology shows differences in the form of root length, small root diameter, inhibition of adventive root growth. On the leaves include a decrease in leaf area, leaf curl up, and leaf yellowing.
Floristic composition and economic value of trees at agroforestry parak in Tanjung Raya District, Agam Regency, West Sumatra Indonesia Alfitrah Habibullah. M; Irma Leilani eka Putri; Azwir Anhar; Reki Kardiman
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.125863

Abstract

This study aimed to investigate the floristic composition and the economic values of trees at the agroforestry parak in Maninjau, Tanjung Raya District. Four different villages were selected purposively according to the tree structure of parak, and each village represented each compass point surrounding the Maninjau Lake. 20 x 100 m plot was established at each sites, where all tree species were identified, and five owner of the parak at each location were asked about the fruiting and harvesting season, management and potential income from each of tree species. 20 tree species belong to 13 families were found across the sites, but only five were occured at all sites, while the others were missed at least from one site. Most species produced fruits with fruiting and harvesting season ranged from one to three times a year, but only seven species knew the income from selling the commodity. From all seven species, which varied on the harvesting season, the owner of each parak gained up to four million IDR per month. This study showed that variation of species and the harvesting season beneficial the owner of the parak and may kept the parak as primary or alternative livelihood.
Microbiological Quality Analysis and Identification of Lactic Acid Bacteria from the Product of Fermentation of Mackerel Sukmawati Sukmawati
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.123909

Abstract

Mackerel is a type of fish that has high nutritional value, this fish is a source of protein and is in great demand by many people. Mackerel can be processed into various types of processed food, one of which is through the fermentation process. The purpose of this study was to determine the microbiological quality, to determine the characteristics and the number of lactic acid bacteria , and to identify the species of lactic acid bacteria found in the fermented mackerel product. The results showed that the microbiological test of mackerel fermented products had the highest total plate number (ALT) in the Fit.L sample, namely 4.2x105 cfu/g, followed by the Fit.C sample with a value of 2.4x104 cfu/g, and the lowest value was in the Fit. A sample  4.3x103 cfu/g. The total plate number (ALT) in each test sample stated that the number did not exceed the maximum limit of the Indonesian national standard. Microbiological test results through the E.coli estimator test of the three samples showed a value of <3 APM/g, then the reinforcement test results were declared not to contain E.coli bacteria.The number of lactic acid bacteria (LAB) present in the mackerel fermented product sample showed the highest value in the Fit.L sample, namely 1.8x104 cfu/g, then in the Fit.C sample with a value of 2.6x103 cfu/g, while the lowest was in the Fit. A sample whose value is 3.6x102 cfu/g. The morphological characteristics of the LAB colonies from the three samples showed the same characteristics, namely round shape, smooth edges and convex elevation. The results of the identification of the two isolates from the two samples stated that the Fit.A isolate was identified as Staphylococcus condimenti strain DSM 11674 and the Fit.C isolate was identified as Lactobacillus reuteri strain 1444
New Records of Proceratium deelemani Perrault, 1981 (Hymenoptera : Formicidae : Proceratiinae) in Sumatra Rini Wulandari; Dwi Hilda Putri; Dezi Handayani; Afifatul Achyar; Rijal Satria
Bioscience Vol 8, No 1 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i1.126193

Abstract

Proceratium Roger, 1863 is a genus of ants that has widely distributed throughout the world, Proceratium species rarely collected, their cryptobiotic lifestyle. This condition also occurs on the Sumatra Island, Indonesia. So far, only single species was recorded in this island, namely Proceratium papuanum Emery, 1897. We conducted a survey of leaf-litter ants in June 2021 by using Winkler’s extraction method in lowland disturbed forest near Tiga Tingkat Water fall Lubuk Hitam, Teluk Kabung Utara, Bungus Teluk Kabung, Padang, West Sumatra, Indonesia. The discovery of Proceratium deelemani Perrault, 1981 for the first time in Sumatera Island, Indonesia was increased the total ant fauna in this island. In the present study, we reports new distribution record of Proceratium deelemani Perrault, 1981 in Sumatra. Total two species of this genus was recorded in Sumatra: Proceratium deelemani Perrault, 1981 and Proceratium papuanum Emery, 1897.
Effecacy of Black Sugarcane Leaves (Saccharum officinarum L.) as Anti-Dysmenorrhea In Silico Based On Molecular Docking Fadilaturahmah, Fadilaturahmah; Dinata, Marta; Sari, Martala; Joni, Rahma; Kurniati, Rahmi; Ade, Filza Yulina
Bioscience Vol 8, No 2 (2024): Biology
Publisher : UNIVERSITAS NEGERI PADANG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/bsc.v8i2.131039

Abstract

Dysmenorrhea is menstrual pain in women that interferes with daily activities. Dysmenorrhea causes decreased productivity, performance, sleep disturbances, and quality of life. The use of antidysmenorrhoea drugs such as non-steroidal anti-inflammatory drugs, oral contraceptive pills have many side effects in the form of nerve disorders, blood vessels, and even heart failure. Therefore, the exploration of natural medicines is essential. One of the traditional medicinal ingredients that is thought to have efficacy in relieving menstrual pain is black sugarcane leaves (Saccharum officinarum L.). Testing the efficacy of this medicinal ingredient can be done in silico using computational biology technology. This in silico study is effective in drug discovery efforts because it is cost and time-efficient. This study aims to analyze the ability of black sugarcane leaf phytochemical compounds to inhibit the dysmenorrhea pathway's activation based on molecular docking. This observational study is based on bioinformatics using the molecular docking method. Research data were obtained from analysis using software computing programs such as the National Center for Biotechnology Information, prediction of activity spectra of substances, Lipinski rule of five tests, pyrx, and discovery studio. The research data were analyzed based on the binding affinity value and visualization of the molecular docking results. Black sugarcane leaves contain 27 phytochemical compounds based on GCMS analysis with various bioactivities related to anti-dysmenorrhea (menstrual pain). 16 compounds have activity probability values (Pa) > 0.7, which indicates that their bioactivity is analogous to that of commercial drugs (natural effective drug candidates). The hexadecanoic acid compound is the best anti-dysmenorrhea drug candidate compared to other phytochemical compounds in black sugarcane leaves because it has the lowest binding affinity value of -6 kcal/mol.Dismenorea merupakan nyeri menstruasi pada wanita yang mengganggu aktivitas sehari-hari. Dismenorea menyebabkan penurunan produktivitas, penurunan prestasi, gangguan tidur, dan penurunan kualitas hidup. Penggunaan obat antidismenorea seperti antiinflamasi non steroid, pil kontrasepsi oral memiliki banyak efek samping berupa gangguan saraf, pembuluh darah, bahkan gagal jantung. Oleh karena itu, eksplorasi obat berbahan alami sangat diperlukan. Salah satu bahan obat tradisional yang diduga memiliki khasiat dalam meredakan nyeri menstruasi yaitu daun tebu ireng (Saccharum officinarum L.). Pengujian khasiat bahan obat ini dapat dilakukan secara in silico menggunakan teknologi biologi komputasi. Kajian secara in silico ini efektif digunakan dalam upaya penemuan obat karena efisien biaya dan waktu. Penelitian ini bertujuan untuk menganalisis kemampuan senyawa fitokimia daun tebu ireng dalam menghambat aktivasi jalur dismenorea berdasarkan molecular docking. Penelitian ini merupakan penelitian observasi berbasis bioinformatika dengan menggunakan metode molecular docking. Data penelitian diperoleh dari analisis menggunakan program komputasi software seperti National Center for Biotechnology Information, prediction of activity spectra of substances, lipinski rule of five test, pyrx, dan discovery studio. Data hasil penelitian dianalisis berdasarkan nilai binding affinity dan visualisasi hasil molecular docking. Daun tebu ireng mengandung 27 senyawa fitokimia berdasarkan analisis GCMS yang memiliki berbagai bioaktivitas terkait dengan anti-dismenorea (nyeri menstruasi). 16 senyawa memiliki nilai probabilitas activity (Pa) > 0,7 yang mengindikasikan bahwa bioaktivitasnya analog dengan obat komersil (kandidat obat efektif alami). Senyawa hexadecanoic acid merupakan kandidat obat anti-dismenorea terbaik dibandingkan senyawa fitokimia lainnya pada daun tebu ireng karena memiliki nilai binding affinity terendah yaitu -6 kkal/mol. 

Page 14 of 15 | Total Record : 146

 11   12   13   14   15 

Filter by Year

2017 2024


Reset
Filter By Issues
All Issue Vol 8, No 2 (2024): Biology Vol 8, No 1 (2024): Biology Vol 7, No 2 (2023): Biology Vol 7, No 1 (2023): Biology Vol 6, No 2 (2022): Biology Vol 6, No 1 (2022): Biology Vol 5, No 2 (2021): Biology Vol 5, No 1 (2021): Biology Vol 4, No 2 (2020): Biology Vol 4, No 1 (2020): Biology Vol 3, No 2 (2019): Biology Vol 3, No 1 (2019): Biology Vol 2, No 2 (2018): Biology Vol 2, No 1 (2018): Biology Vol 1, No 2 (2017): Biology Vol 1, No 1 (2017): Biology More Issue