cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
suranto
Contact Email
editors@smujo.id
Phone
-
Journal Mail Official
editors@smujo.id
Editorial Address
unsjournals@gmail.com
Location
Kota surakarta,
Jawa tengah
INDONESIA
Biodiversitas Journal of Biological Diversity
Published by Universitas Sebelas Maret
ISSN : 1412033X     EISSN : 20854722     DOI : https://doi.org/10.13057/biodiv/d230231
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
The Biodiversitas Journal was first published in 2000 by the Department of Biology, FMNS, Universitas Sebelas Maret, Surakarta, Indonesia, then in 2006 it was co-published by the Society for Indonesian Biodiversity and that department; since 2017 it was also hosted by Smujo. From 2003-2012 it was accredited by DGHE, Ministry of Education, R.I., since 2014 was indexed by Scopus, where DOAJ and Google Scholar was indexed first.
Arjuna Subject : Biokimia, Genetika dan Biologi Molekuler - Biokimia, Genetika dan Biologi Molekuler (Lain-Lain)
Articles 6,315 Documents
 345   346   347   348   349 
Agroforestry management systems through landscape-life scape integration: A case study in Gowa, Indonesia DIAN AYU LESTARI HASANNUDIN; DODIK RIDHO NURROCHMAT; METI EKAYANI
Biodiversitas Journal of Biological Diversity Vol. 23 No. 4 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230420

Abstract

Abstract. Hasannudin DAL, Nurrochmat DR, Ekayani M. 2022. Agroforestry management systems through landscape-life scape integration: A case study in Gowa, Indonesia. Biodiversitas 23: 1864-1874. Agroforestry has a potentially important role in increasing farmers' income and sustainable landscape management. The need to increase income from a community with limited land area, resulting in indiscriminate deforestation and shifting cultivation, has accelerated soil erosion. This study addresses the problem by evaluating land use and land cover change structure and prediction, providing plant types' preferences for agroforestry systems based on social, business feasibility, and ecological suitability. This study was conducted in Bontolerung Village, part of the KPH Jeneberang 1's working area, Tinggimoncong Sub-district, Gowa District, South Sulawesi Province, Indonesia. The data was collected from January to March 2021 using a snowball-purposive sampling method. The analysis data used land use and land cover change, land management patterns, cost and revenue, household expenditure and income, financial feasibility -Net present value (NPV), Benefit-cost ratio (BCR), and Internal rate of return (IRR), and ecological suitability (invasive series). The study finds that forest cover losses are 17% from 2010-2020 and converted into agricultural land. The agroforestry patterns of coffee, coffee-cloves, and coffee-cloves-iles-iles are feasible to cultivate following the NPV, BCR, and IRR criteria. Agroforestry systems contributed 26% to farmer household income. The value shows a low percentage compared to the non-agroforestry income (74%). The coffee-cloves agroforests show the highest gains with an average annual income of IDR 43,017,192 (US$ 3,024.9). This study promotes using agroforestry to reforest the existing degraded lands. Agroforestry systems offer great potential for environmental conservation and contribution to human well-being.
Leaf architectural analysis of taxonomically ambiguous Hoya lacunosa Blume and Hoya krohniana Kloppenb. & Siar HAZEL C. SCOTT; INOCENCIO E. BUOT JR
Biodiversitas Journal of Biological Diversity Vol. 23 No. 4 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230441

Abstract

Abstract. Scott HC, Buot JR IE. 2022. Leaf architectural analysis of taxonomically ambiguous Hoya lacunosa Blume and Hoya krohniana Kloppenb. & Siar. Biodiversitas 23: 2055-2065. The horticulturally important Hoya R.Br. species Hoya lacunosa Blume and Hoya krohniana Kloppenb. & Siar are often mistaken for each other because of their generally similar inflorescence morphology. Based on the hypothesis that leaf venation patterns are genetically fixed, leaf architectural analysis was done to determine the difference between these two taxonomically confusing species. Thirty fully expanded leaves were obtained per species from mature plants of H. lacunosa, H. krohniana and an outgroup, H. pubicorolla. Laminar and venation characters were analyzed using standard leaf architecture protocols. Results show that the main distinction lies in their laminar characters, particularly the base angle and base shape. H. lacunosa samples showed acute to obtuse base angles with cuneate and convex leaf bases, while H. krohniana were found to have obtuse reflex base angles with convex, cordate and rounded leaf bases. Analysis of venation characters shows no considerable difference between the patterns seen in H. lacunosa and the patterns observed in H. krohniana. Further investigation of higher vein orders is recommended. Initial comparison of H. lacunosa pollinaria with the photos of H. krohniana pollinaria from its type description show strikingly similar morphology; for this reason, we also recommend floral morphology comparisons, particularly pollinaria morphology to further establish the similarity and delineation of H. lacunosa and H. krohniana.
The composition of fatty acids in several vegetable oils from Indonesia HAMIDAH RAHMAN; JOHNNER P. SITOMPUL; SURYATI TJOKRODININGRAT
Biodiversitas Journal of Biological Diversity Vol. 23 No. 4 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230452

Abstract

Abstract. Rahman H, Sitompul JP, Tjokrodiningrat S. 2022. The composition of fatty acids in several vegetable oils from Indonesia. Biodiversitas 23: 2167-2176. Fatty acids are generally incorporated into a triglyceride structure in vegetable oils and this indicates vegetable oils are a source of fatty acids. Fatty acids and triglycerides are fatty groups commonly known to have a detrimental effect on health but have an important role in terms of nutrition, health, and are also a source of industrial raw materials. Therefore, this study was conducted to identify the composition of fatty acids in several edible vegetable oils which are quite widely available in Indonesia such as coconut oil, palm kernel oil, palm oil, nutmeg oil, cinnamon oil, and canarium oil. The fatty acids profile of these vegetable oils was determined using high-performance liquid chromatography while the composition was determined by comparing the peaks in each vegetable oil with the standard fatty acids. It was discovered that all the six vegetable oils contain fatty acids with different compositions, and this signifies the availability of a complete variety of fatty acids in Indonesia. Moreover, the highest fatty acid content in coconut oil and palm kernel oil was found to be lauric acid with a concentration of 49.00% and 49.25% respectively while the contents in palm oil include palmitic acid with 44.00% and oleic acid with 41.00%. The nutmeg oil was dominated by myristic acid with 78.00%, cinnamon oil by stearic acid with 50.16%, and canarium oil by oleic acid with 51.71%. Furthermore, the concentration range for all the vegetable oils includes 14.66-91.20% saturated, 6.30-52.31% monounsaturated, and 1.35-33.03% polyunsaturated fatty acids. These results can be used as a source of information in the process of utilizing fatty acids and triglycerides in vegetable oils, and also provide the data required to estimate the nutritional value of the plant biodiversity originating from Indonesia.
Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene SUKMA DWIFAJRI; RICARDO F. TAPILATU; BAYU PRANATA; ARADEA BUJANA KUSUMA
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230332

Abstract

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper of Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).
Short Communication: Bacterial diversity of mangrove ecosystem in Klawalu Sorong, West Papua, Indonesia SUKMAWATI SUKMAWATI; FEBRIANTI ROSALINA; SIPRIYADI SIPRIYADI; NURUL KUSUMA DEWI; MELDA YUNITA; ABDUL RIDHA TAHA SARHAN; YENI RAHAYU; EKO KUSUMAWATI
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230329

Abstract

Abstract. Sukmawati S, Rosalina F, Sipriyadi, Dewi NK, Yunita M, Sarhan ART, Rahayu Y, Kusumawati E. 2022. Short Communication: Bacterial diversity of mangrove ecosystem in Klawalu Sorong, West Papua, Indonesia. Biodiversitas 23: 1427-1432. The mangrove ecosystem is a producer of detritus and a source of nutrients and organic matter. Some of the ecological functions of mangrove forests are coastline protector, preventing seawater intrusion, as a habitat for various living creatures, a microclimate regulator, a nursery ground, spawning ground, as well as a feeding ground for various aquatic biota. The mangrove forest ecosystem cannot be separated from the role of microbes in helping the process of soil biochemical cycles. In the biochemical cycle, microbes are able to maintain the availability of macronutrients in the soil. The objective of this study was to identify the diversity of bacteria in the mangrove ecosystem in Klawalu, Sorong City. The research method descriptively described the diversity of bacterial species found in the mangrove ecosystem in Klawalu, Sorong City, West Papua Province. The results indicated that the DNA fragments of the four isolates obtained from this study were around 1300 bp. Meanwhile, the bacterial species obtained were isolated SA3, identified as Bacillus safensis strain C251, isolate SA8 identified as Bacillus amyloliquefaciens strain NO10, isolate SL8 was identified as Clostridium sp. JC336, and isolate SL1 was identified as Bacillus australimaris strain IIHR GAPB01.
Demographic and health status of captive elephants around Chitwan National Park, Nepal SANDEEPA GAUTUM; NARAYAN PRASAD KOJU
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230353

Abstract

Abstract. Gautum S, Koju NP. 2022. Demographic and health status of captive elephants around Chitwan National Park, Nepal. Biodiversitas 23: 1621-1627. Elephants have been captive from ancient times. As a keystone species, it requires proper care and management to sustain its viable population in the wild as well as a captive. However, there is a lack of study on captive elephants in Nepal. This study aimed to explore the status of captive elephants in Sauraha, Chitwan National Park, the top tourist destination of Nepal. Field survey, Key-Informant Interview (KII), and questionnaire survey were carried out for the primary source of data collection. During which, 78 mahouts were interviewed. The study revealed 97 (16 males and 81 females) captive elephants in Sauraha during the study period. Among them, 17 were born by captive mothers. The distance traveled by an elephant has recorded 16 km for minimum and 84 km in maximum per day and carries the average weight of 450 kg. Captive elephants belonging to the private company (N=60) were used only in tourism, while captive elephants from National Trust for Nature Conservation (NTNC) and Governments were used in patrolling and transportation. The most common disease in captive elephants is tuberculosis (27%). Similarly, parasitic infections, diseases like foot problems, and colic were also recorded. An effective policy and plan are urgently required to conserve this endangered umbrella species in captivity.
Evaluation of Argulus indicus on striped snakehead (Channa striata) in Towuti Lake, South Sulawesi, Indonesia Amriana Amriana; Dwi Kesuma Sari; Sriwulan Sriwulan; Hilal Anshary
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230320

Abstract

Abstract. Amriana, Sari KD, Sriwulan, Anshary H. 2022. Evaluation of Argulus indicus on striped snakehead (Channa striata) in Towuti Lake, South Sulawesi, Indonesia. Biodiversitas 23: 1355-1362. Fish parasites are frequently present in wild freshwater fish populations, but data are limited on their distribution and impacts. This research aimed to investigate the severity of parasitic Argulus infestation on striped snakeheads (Channa striata) caught in Towuti Lake based on prevalence, intensity, and the bacteria associated with Argulus parasitizing C. striata. The research was conducted from March 2018 to February 2019 at Towuti Lake, South Sulawesi Province, Indonesia. Striped snakehead samples were captured using fish traps and gillnets. Samples of bacteria associated with Argulus were collected from four striped snakeheads (three infested and one non-infested control). Bacteria from Argulus attachment sites were identified through Vitek-2 Compact biochemical tests. Argulus prevalence on striped snakeheads was in the range 73.3-96.7%, with a mean intensity range of 2.18-14.43 and mean abundance 1.67-13.47. Water quality parameters measured in Towuti Lake remained within the Indonesian standards for freshwater fish habitat. The bacteria in striped snakehead mucus comprised two species in control (Staphylococcus xylosus, Pantoea sp.) and seven species in the parasitized fish (Micrococcus luteus, Bacillus mycoides, Acinetobacter baumannii, Sphingomonas paucimobilis, Pantoea sp., Aerococcus viridans, Staphylococcus arlettae). This study found a very high prevalence of striped snakehead infestation with parasitic A. indicus at low to medium intensity levels. The study also showed that A. indicus infestation was accompanied by and likely stimulated pathogenic bacteria, which can cause skin infections in fish. Therefore, A. indicus could be considered a threat to striped snakehead populations in Towuti Lake.
Molecular identification of cellulase-producing thermophilic fungi isolated from Sungai Pinang hot spring, Riau Province, Indonesia SARYONO SARYONO; RIRYN NOVIANTY; NABELLA SURAYA; FINNA PISKA; SILVERA DEVI; NOVA WAHYU PRATIWI; AULIA ARDHI
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230333

Abstract

Abstract. Saryono, Novianty R, Suraya N, Piska F, Devi S, Pratiwi NW, Ardhi A. 2022. Molecular identification of cellulase-producing thermophilic fungi isolated from Sungai Pinang hot spring, Riau Province, Indonesia. Biodiversitas 23: 1457-1465. Thermostable cellulolytic enzymes have become a subject of interest in industrial processes due to their ability to degrade cellulosic polysaccharides at elevated temperatures produced by microorganisms such as fungi and bacteria. In the present study, cellulase-producing thermophilic fungi were isolated and identified from Sungai Pinang hot spring, Riau Province, Indonesia. Morphological identification was carried out by macroscopic and microscopic observations. The ability of the thermophilic fungi to produce cellulase was determined using the clear zone test on carboxymethyl cellulose medium with a congo red staining. Isolate with the highest activity was identified molecularly using universal primers ITS1F and ITS4R. The results showed 19 isolates were morphologically identified as Aspergillus sp. and Penicillium sp. Based on qualitative testing, 3 of the19 isolates showed cellulase activity. The isolate performing the most considerable cellulase was LBKURCC293, which was identified as Aspergillus fumigatus with a cellulase activity of 2.6 x 10-2 IU/mL and a specific cellulase activity 8.0 x 10-3 IU/mg protein after 96 days of incubation.
Production and characterization of Imperata cylindrica paper using potassium hydroxide as pulping agent zuliana madung; sabrina soloi; mohd hafiz abdul majid; MOHD SANI SARJADI
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230337

Abstract

Abstract. Madung Z, Soloi S, Majid MHA, Sarjadi MS. 2022. Production and characterization of Imperata cylindrica paper using potassium hydroxide as pulping agent. Biodiversitas 23: 1490-1494. Non-woody plants have become an alternative fiber in paper production as woods, the primary sources of papers have become limited due to increasing demand of paper year by year. Imperata cylindrica or cogon grass as the source of fiber for the pulp and paper industry in replacing the wood fiber because it has high cellulose and low lignin content.  In this study, cogon grasses were treated with various concentrations of potassium hydroxide, KOH (5%, 8%, 10% and 12%). The effects of alkali treatment on the properties of the papers were investigated in the present study. Scanning Electron Microscope (SEM) image of the paper sheet indicates that the amount of cellulose fiber and other materials were lessening toward a higher concentration of KOH treatment. This explained that most of the lignin was entirely removed and some cellulose probably degraded at higher KOH concentrations. Fourier Transform Infa-Red (FTIR) analysis showed that the peaks at range 1650 cm-1-1630 cm-1 attributed to the presence of v(C=C) aromatic ring of lignin disappeared at 10% and 12% of KOH. The mechanical strength of the papers decreased with an increasing concentration of KOH, while 5% of KOH produced the highest value of tensile strength.
Chemical and hedonic characteristics of smoked Katsuwonus pelamis (fufu fish) from Sorong, West Papua, Indonesia MOHAMMAD SAYUTI; RANDI BOKHY SYULIANA SALAMPESSY; ASRIANI ASRIANI; SITI ZACHRO NURBANI; SAIDIN SAIDIN
Biodiversitas Journal of Biological Diversity Vol. 23 No. 3 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230363

Abstract

Abstract. Sayuti M, Salampessy RBS, Asriani, Nurbani SZ, Saidin. 2022. Chemical and hedonic characteristics of smoked Katsuwonus pelamis (fufu fish) from Sorong, West Papua, Indonesia. Biodiversitas 23: 1707-1713. Fufu fish is one of the smoked fish products from eastern Indonesia, especially the North Sulawesi and Papua region, with raw materials derived from skipjack tuna or yellow-fin tuna. Samples were obtained from fish-smoking entrepreneurs in Sorong City. Proximate analysis was carried out using the association of official analytical chemist (AOAC) standard, amino acid analysis was carried out using liquid chromatography-mass spectrometry (LC-MS), fatty acid analysis was carried out using gas chromatography-mass spectrometry (GC-MS), and hedonic analysis was carried out using the SNI 2346:2015 standard with 120 panelists. The results showed that fufu fish had a water content of 64.52%, ash content of 0.82%, total fat of 1.97%, protein of 27.75%, carbohydrates of 4.37%, and crude fiber of 2.69%. The main essential amino acids of fufu fish were L-Lycine by 5.59%, L-Histidine by 3.25%, and L-Leucine by 2.61%. On the other hand, the main non-essential amino acids were L-Glutamic acid by 3.83%, L-Aspartic acid by 2.60%, and L-Arginine by 2.43%. The main fatty acids of fufu fish were C15:1 (cis-10) by 47.43%, C14:0 by 16.75%, C16:0 by 12.20%, and C18:0 by 10.97%. On the fufu fish hedonic test results, the panelists generally gave a like score. Based on these findings, it can be concluded that fufu fish had good nutritional content for the community.

Page 347 of 632 | Total Record : 6315

 345   346   347   348   349 

Filter by Year

2000 2026


Reset
Filter By Issues
All Issue Vol. 27 No. 8 (2026) Vol. 27 No. 7 (2026) Vol. 27 No. 6 (2026) Vol. 27 No. 5 (2026) Vol. 27 No. 4 (2026) Vol. 27 No. 3 (2026) Vol. 27 No. 2 (2026) Vol. 27 No. 1 (2026) Vol. 26 No. 12 (2025) Vol. 26 No. 11 (2025) Vol. 26 No. 10 (2025) Vol. 26 No. 9 (2025) Vol. 26 No. 8 (2025) Vol. 26 No. 7 (2025) Vol. 26 No. 6 (2025) Vol. 26 No. 5 (2025) Vol. 26 No. 4 (2025) Vol. 26 No. 3 (2025) Vol. 26 No. 2 (2025) Vol. 26 No. 1 (2025) Vol. 25 No. 12 (2024) Vol. 25 No. 11 (2024) Vol. 25 No. 10 (2024) Vol. 25 No. 9 (2024) Vol. 25 No. 8 (2024) Vol. 25 No. 7 (2024) Vol. 25 No. 6 (2024) Vol. 25 No. 5 (2024) Vol. 25 No. 4 (2024) Vol. 25 No. 3 (2024) Vol. 25 No. 2 (2024) Vol. 25 No. 1 (2024) Vol. 24 No. 12 (2023) Vol. 24 No. 11 (2023) Vol. 24 No. 10 (2023) Vol. 24 No. 9 (2023) Vol. 24 No. 8 (2023) Vol. 24 No. 7 (2023) Vol. 24 No. 6 (2023) Vol. 24 No. 5 (2023) Vol. 24 No. 4 (2023) Vol. 24 No. 3 (2023) Vol. 24 No. 2 (2023) Vol. 24 No. 1 (2023) Vol. 23 No. 12 (2022) Vol. 23 No. 11 (2022) Vol. 23 No. 10 (2022) Vol. 23 No. 9 (2022) Vol. 23 No. 8 (2022) Vol. 23 No. 7 (2022) Vol. 23 No. 6 (2022) Vol. 23 No. 5 (2022) Vol. 23 No. 4 (2022) Vol. 23 No. 3 (2022) Vol. 23 No. 2 (2022) Vol. 23 No. 1 (2022) Vol. 22 No. 12 (2021) Vol. 22 No. 11 (2021) Vol. 22 No. 10 (2021) Vol. 22 No. 9 (2021) Vol. 22 No. 8 (2021) Vol. 22 No. 7 (2021) Vol. 22 No. 6 (2021) Vol. 22 No. 5 (2021) Vol. 22 No. 4 (2021) Vol. 22 No. 3 (2021) Vol. 22 No. 2 (2021) Vol. 22 No. 1 (2021) Vol. 21 No. 12 (2020) Vol. 21 No. 11 (2020) Vol. 21 No. 10 (2020) Vol. 21 No. 9 (2020) Vol. 21 No. 8 (2020) Vol. 21 No. 7 (2020) Vol. 21 No. 6 (2020) Vol. 21 No. 5 (2020) Vol. 21 No. 4 (2020) Vol. 21 No. 3 (2020) Vol. 21 No. 2 (2020) Vol. 21 No. 1 (2020) Vol. 20 No. 12 (2019) Vol. 20 No. 11 (2019) Vol. 20 No. 10 (2019) Vol. 20 No. 9 (2019) Vol. 20 No. 8 (2019) Vol. 20 No. 7 (2019) Vol. 20 No. 6 (2019) Vol. 20 No. 5 (2019) Vol. 20 No. 4 (2019) Vol. 20 No. 3 (2019) Vol. 20 No. 2 (2019) Vol. 20 No. 1 (2019) Vol. 19 No. 6 (2018) Vol. 19 No. 5 (2018) Vol. 19 No. 4 (2018) Vol. 19 No. 3 (2018) Vol. 19 No. 2 (2018) Vol. 19 No. 1 (2018) Vol. 18 No. 4 (2017) Vol. 18 No. 3 (2017) Vol. 18 No. 2 (2017) Vol. 18 No. 1 (2017) Vol. 17 No. 2 (2016) Vol. 17 No. 1 (2016) Vol. 16 No. 2 (2015) Vol. 16 No. 1 (2015) Vol. 15 No. 2 (2014) Vol. 15 No. 1 (2014) Vol. 14 No. 2 (2013) Vol. 14 No. 1 (2013) Vol. 13 No. 4 (2012) Vol. 13 No. 3 (2012) Vol. 13 No. 2 (2012) Vol. 13 No. 1 (2012) Vol. 12 No. 4 (2011) Vol. 12 No. 3 (2011) Vol. 12 No. 2 (2011) Vol. 12 No. 1 (2011) Vol. 11 No. 4 (2010) Vol. 11 No. 3 (2010) Vol. 11 No. 2 (2010) Vol. 11 No. 1 (2010) Vol. 10 No. 4 (2009) Vol. 10 No. 3 (2009) Vol. 10 No. 2 (2009) Vol. 10 No. 1 (2009) Vol. 9 No. 4 (2008) Vol. 9 No. 3 (2008) Vol. 9 No. 2 (2008) Vol. 9 No. 1 (2008) Vol. 8 No. 4 (2007) Vol. 8 No. 3 (2007) Vol. 8 No. 2 (2007) Vol. 8 No. 1 (2007) Vol. 7 No. 4 (2006) Vol. 7 No. 3 (2006) Vol. 7 No. 2 (2006) Vol. 7 No. 1 (2006) Vol. 6 No. 4 (2005) Vol. 6 No. 3 (2005) Vol. 6 No. 2 (2005) Vol. 6 No. 1 (2005) Vol. 5 No. 2 (2004) Vol. 5 No. 1 (2004) Vol. 4 No. 2 (2003) Vol. 4 No. 1 (2003) Vol. 3 No. 2 (2002) Vol. 3 No. 1 (2002) Vol. 2 No. 2 (2001) Vol. 2 No. 1 (2001) Vol. 1 No. 2 (2000) Vol. 1 No. 1 (2000) More Issue