cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Brigitta Laksmi Paramita
Contact Email
brigitta.laksmi@uajy.ac.id
Phone
+6282329549978
Journal Mail Official
journal.biota@gmail.com
Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
Published by Universitas Atma Jaya Yogyakarta
ISSN : 25273221     EISSN : 2527323X     DOI : doi.org/10.24002/biota
Core Subject : Science, Agriculture,
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).
Arjuna Subject : Ilmu Pertanian dan Biologi (Semua) - Ilmu Pertanian dan Biologi (Lain-Lain)
Articles 1,193 Documents
 44   45   46   47   48 
APLIKASI MEDIA TERKONDISI SEL PUNCA MESENSIMAL DALAM TERAPI PENYAKIT DEGENERATIF DAN PENYEMBUHAN LUKA Widhiastuti, Stefani Santi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 5, No 1 (2020): February 2020
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (549.666 KB) | DOI: 10.24002/biota.v5i1.2963

Abstract

Penyakit degeneratif seperti stroke, jantung, hipertensi, dan diabetes merupakan penyakit yang banyak dialami seseorang seiring dengan bertambahnya usia. Terapi dengan obat-obatan maupun dengan operasi telah banyak digunakan Namun pada beberapa kasus, hasilnya belum maksimal. Dengan meningkatnya ilmu pengetahuan dan teknologi, sel punca juga dikembangkan sebagai terapi regeneratif, tidak hanya untuk pengobatan penyakit degeneratif namun juga untuk penyembuhan luka akibat trauma fisik maupun penyakit yang lain. Salah satu macam sel punca yang banyak digunakan adalah sel punca mesensimal (SPM). Meskipun sel punca memiliki potensi untuk dikembangkan sebagai terapi penyakit degeneratif dan penyembuhan luka, namun proses diferensiasinya dalam tubuh belum terkontrol dengan maksimal, sehingga banyak peneliti mengembangkan penggunaan media terkondisi sel punca mesensimal (MT-SPM) sebagai terapi alternatif. MT-SPM yang merupakan medium cair tempat tumbuh SPM terbukti memiliki efek serupa dengan SPM, sehingga dapat digunakan dalam terapi penyakit stroke, jantung, diabetes, dan penyembuhan luka.
Pembuatan Arang Aktif dari Tempurung Siwalan (Borassus flabellifer L.) yang Diaktivasi dengan Kalium Hidroksida (KOH) Nitsae, Merpiseldin; Lano, Lans Asideo; Ledo, Mellissa E.
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 5, No 1 (2020): February 2020
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (516.858 KB) | DOI: 10.24002/biota.v5i1.2948

Abstract

Penelitian ini bertujuan untuk menghasilkan arang aktif teraktivasi KOH dari limbah tempurung Siwalan yang ada di Nusa Tenggara Timur terutama di daerah pesisir pantai.  Pembuatan arang aktif dilakukan melalui dua tahap, yaitu tahap karbonisasi dan aktivasi. Pada proses karbonisasi tempurung Siwalan dibakar dalam alat pirolisis sederhana dengan oksigen terbatas. Selanjutnya, dilakukan aktivasi arang dengan cara direndam KOH dengan variasi 0,1 M; 0,5M; dan 1M selama 24 jam.  Hasil Penelitian menunjukkan bahwa ada pengaruh positif KOH terhadap aktivitas arang tempurung Siwalan . Karakteristik arang yang dihasilkan memenuhi SNI 06-3730 dengan kriteria terbaik 6,56% kadar air; 8,55% kadar abu; bilangan iodin sebanyak 2163,36 mg g-1; dan daya serapmetilen biru sebanyak 438,52 mg g-1. Daya adsorbsi arang aktif tempurung Siwalan terhadap iodin dan metilen biru yang tinggi (lebih besar dari SNI) menunjukkan bahwa arang aktif tempurung Siwalan dapat digunakan sebagai adsorben.
Pemeliharaan Planaria Dalam Perkembangbiakan Secara Vegetatif Surtikanti, Hertien Koosbandiah
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 1 (2010): February 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i1.2651

Abstract

Test organism which is used for bioassay must fulfill some criteria such as: high sensitifity, widely available, wide distribution, biology background, successfully maintained in laboratory, and known history of culture in laboratory. This research has been done to study regeneration (vegetative) process of Planaria under laboratory condition. This is studied because of limited number of planaria population in clean freshwater. In order to study regeneration process, combination of two treatments (water conductivity and division-cutting type) were done to obtain optimum culture of Planaria. Four water conductivity (100, 200, 300 and 400 μS/cm) and four division-cutting types (whole longitudinal, half longitudinal, transversal above pharynx and transversal mid-pharinx) were used. Each individual of Planaria was exposed with those treatments for 10 days (October, 2002). Initial and completed growth were observed. The result showed that, regeneration process of Planaria took 3-6 days to get full growth after transversal cutting (mid-pharynx). Whole summary revelead that Planaria is easy to maintain in laboratory. Therefore, Planaria may be used as an alternative bioindicator in evaluating water pollution.
Produksi Bioetanol Pati Umbi Talas (Colocasia esculenta (L.) Schott) dengan Variasi Konsentrasi Inokulum dan Waktu Fermentasi Zymomonas mobilis Febriani, Yunisha; Sidharta, Boy Rahardjo; Pranata, Fransiskus Sinung
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 5, No 2 (2020): June 2020
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v5i2.2506

Abstract

Bioetanol dapat diproduksi dari hasil fermentasi bahan baku yang mengandung karbohidrat. Umbi talas (Colocasia esculenta (L.) Schott) memiliki karbohidrat yang cukup tinggi yakni 23,7% sehingga dapat dimanfaatkan sebagai penghasil bioetanol. Zymomonas mobilis merupakan mikrobia yang dapat mengubah glukosa menjadi etanol. Penelitian ini bertujuan mengetahui konsentrasi inokulum dan waktu fermentasi yang paling optimal untuk menghasilkan bioetanol dari pati umbi talas. Umbi talas dipotong, dikeringkan dan dihancurkan lalu diayak sampai berbentuk tepung. Tepung talas dihidrolisis dengan larutan HCl (1, 3, dan 5 %) lalu diuji kadar gula reduksinya dengan metode Nelson-Somogyi. Tahap fermentasi dilakukan sesuai rancangan percobaan yakni 0, 2, 4, 6 dan 8 hari serta menggunakan konsentrasi inokulum 0, 5, 10, dan 15 %. Hasil fermentasi berupa etanol diukur konsentrasinya menggunakan kromatografi gas. Kadar gula reduksi menunjukkan kadar gula tertinggi ada pada konsentrasi HCl 5 %. Kadar bioetanol sebesar 0,07 % diperoleh pada waktu fermentasi optimal yaitu hari ke-8 dan konsentrasi inokulum paling optimal sebesar 10 %.
Aktivitas Trypsin Inhibitor Berbagai Varietas Biji Kedelai (Glycine max L.) dan Perubahannya Selama Perkecambahan Biji dari Varietas Terbaik Kanetro, Bayu; Noor, Zuheid; Indrati, Retno
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 1 (2007): February 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i1.2529

Abstract

This study investigated the activity of trypsin inhibitor (TI) of some soybean (Glycine max L.) varieties and the change in TI activity during seed germination of the best variety. The research was aimed to determine the best variety of soybean and germination time based on the highest TI activity. There were 5 varieties of soybeans, Paderman, Argomulyo, Kaba, Sinabung, and Ijen. The best variety of soybean was Sinabung as shown by the highest TI activity. The soybean of Sinabung variety was germinated for 6 various germination times at 12, 24, 36, 48, 60 and 72 hr. The result showed that the variation of germination time changed TI activity. TI activity decreased significantly after 36 hr of germination of soybeans. The best time of germination was 36 hr.
Understanding Food (Kajian Buku) Anugrahati, Nuri Arum
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 14, No 1 (2009): February 2009
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v14i1.2636

Abstract

Kata understanding menarik untuk dipahami, terutama bagi pembaca yang tertarik dan memilih untuk menekuni jalur ilmu di bidang ilmu aplikatif, seperti teknologi pangan. Buku berjudul Understanding Food: Principles and Preparation yang menyajikan informasi mengenai ilmu pangan, gizi, dan food service, baik yang berupa prinsip-prinsip dasar maupun tren terbaru di bidang teknologi pangan menjadi pilihan yang menarik untuk dibaca.
Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar Zein, M. Syamsul
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 12, No 3 (2007): October 2007
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v12i3.2799

Abstract

A study on mtDNA control region diversity of the timor deer was conducted in EastNusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragmentcontrol region of the mitochondrial DNA were amplified by Polymerase ChainReaction (PCR) using primers of forward primer5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrialcontrol region were aligned by using ClastalX and phylogenetic analyses by Neighbor-Joining methode. Kimura two-parameter model of nucleotide substitution usingpairwise distance calculation program was implemented with the Mega softwareversion 3. The purposes of this study, were to examine the control region (D-Loop) ofthe mitochondrial DNA and to discuss the phylogeography of the Cervus timorensistimorensis in East Nusa Tenggara Province. Results indicated that from 435 basenucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNAdistances values ranged from 0.014 to 0.021.
Kepekaan Cacing Laut Ophryotrocha diadema (Polychaeta: Dorvilleidae) terhadap Cemaran Metil Merkuri (MeHg) Lasut, Markus Talintukan; Pangkey, Henneke
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2594

Abstract

Susceptibility of the marine polychaete Ophryotrocha diadema (Polychaeta: Dorvilleidae) towards the neurotoxic methyl mercury (MeHg) contamination was studied in an experimental chamber, which was aimed to assess and compare the susceptibility level of the organism based on its generations (F0, F1, F2, and F3). Seven variables of growth and reproduction aspects were applied as indicators in this study; they were: 1) individual growth, 2) first time the egg laid, 3) number of eggs per individu, 4) number of eggs per egg mass, 5) number of eggs to larva per egg mass, 6) number of mortality per egg mass, and 7) reproductive potential. Observation was conducted on the treatment (MeHg in concentration of 0,00025 ppb) and the control (no MeHg) to each of the generations (F0, F1, F2, and F3). Data obtained were analysed for average and standard deviation. Comparison of susceptibility within the generations was calculated using the variable of reproductive potential. The results showed that there were differences between the treatments and the control for all of the variables. Comparison on the susceptibility of the polychaete within the generations to MeHg contamination was F0<F1=F3<F2. It was concluded that the F2 generation had the highest susceptibility among the others.
Potensi Mangrove Sebagai Tanaman Obat (Short Communication) Purnobasuki, Hery
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 9, No 2 (2004): June 2004
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v9i2.2901

Abstract

Tumbuhan mangrove di Indonesia merupakan yang terbanyak di dunia, baik dari segi kuantitas area (+ 42.550 km2) maupun jumlah species (+ 45 species) (Spalding et al. 2001). Mangrove mempunyai banyak sekali manfaat yang bersinggungan langsung dengan kehidupan manusia di daratan, mulai dari manfaat ekologi sampai dengan sebagai sumber pangan dan obat.
Pertumbuhan dan Variasi Jumlah Kromosom Akar Rambut Morus macroura Miq. Hasil Transformasi dengan Beberapa Galur Agrobacterium Ermayanti, Tri Muji; Hastuti, Dwi
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 14, No 2 (2009): June 2009
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v14i2.2687

Abstract

Morus macroura Miq. (Moraceae) which is native West Sumatra is now classified as endangered species and usually used as furniture. This plant produces phenolic compounds. Generally secondary metabolites produced by plants are found in low level, therefore, in vitro techniques such as callus culture, cell suspension and organ cultures are the alternative methods to increase their in vitro production. However, problems on genetic instability such as variation in chromosome numbers and abnormality of chromosome structure are found. These cases influence the productions of secondary metabolites. Genetic variation could be overcome using hairy root culture. The aim of the research was to analyze the growth and chromosome numbers of Morus macroura Miq. hairy root transformed with Agrobacterium strains TISTR-511, TISTR-512, ATCC-15834 and R-1000 in order to determine the genetic variation of the culture. Growth was determined by measuring the fresh and dry weights of roots after 4 weeks in culture. Chromosome numbers was prepared by squashing. The results showed that transformed roots had higher growth compared to the growth of untransformed roots. The growth of hairy roots was varied depending on the strains of Agrobacterium. Both transformed and untransformed roots had high variation in the chromosome numbers. Genetic stability of both transformed and untransformed roots were low but they had similar pattern of distribution on the chromosome number. The roots had the diploid number of chromosome 2n=2x=28 ranged from 35.83 to 46.13% and the tetraploid numbers 2n=4x=56 ranged from 23.23 to 42.21%. Total cells examined were more that 230 cells.

Page 46 of 120 | Total Record : 1193

 44   45   46   47   48 

Filter by Year

2003 2026


Reset
Filter By Issues
All Issue Vol 11, No 1 (2026): February 2026 Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue