cover
Contact Name
Muhammad Syahrir
Contact Email
m.syahrir7406@unm.ac.id
Phone
-
Journal Mail Official
nurkhasanah@pharm.uad.ac.id
Editorial Address
Jl. Prof. Dr. Soepomo, S.H., Janturan, Warungboto, Umbulharjo, Yogyakarta, Indonesia Kode pos 55164
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Pharmaciana: Jurnal Kefarmasian
ISSN : 20884559     EISSN : 24770256     DOI : 10.12928
Core Subject : Health,
Pharmaciana is a scientific journal published by the University of Ahmad Dahlan worked closely with Ikatan Apoteker Indonesia (IAI). Pharmaciana published three times a year, namely March, July and November. with ISSN 2088-4559 and e-ISSN 2477-0256. The article published in the Journal Pharmaciana selected by editors and reviewed by the reviewer. Articles published in Pharmaciana must not be published in other journals or have been previously published. Pharmaciana is indexed in google scholar, ACI (Asean Citation Index), Dimension (Crossreff), Garuda, Sinta, Sherpa Romeo, Index Copernicus International, DOAJ, and BASE. Pharmaciana is accredited by DIKTI (DGHE) of Indonesia No. 105/E/KPT/2022 April 07, 2022
Articles 837 Documents
The ethanol extract of the bastard cedar (Guazuma ulmifolia L.) as antioxidants Sijani Prahastuti; Meilinah Hidayat; Stella Tinia Hasiana; Wahyu Widowati; Wahyu Setia Widodo; Rr. Anisa Siwianti Handayani; Rizal Rizal; Hanna Sari Widya Kusuma
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (29.278 KB) | DOI: 10.12928/pharmaciana.v10i1.13636

Abstract

Guazuma ulmifolia, or commonly known as the bastard cedar, has many pharmaceutical activities and is, therefore, claimed as a source of various plant-based medicines. This reserach was purposed to identify the antioxidant activities of the ethanolic extract of G. ulmifolia (EEGU) by phytochemical screening assay, total flavonoid and total phenolic testing, and comparative analysis between the antioxidant activities of EEGU and epicatechin. The qualitative phytochemical screening assay of EEGU detected the availability of phenols, flavonoids, alkaloids, tannins, and terpenoids, but not saponins and triterpenoids. Meanwhile, the total phenolic content was 32.24 µg GAE/mg extract, and the total flavonoid content decided using aluminum chloride reagent with quercetin standard, was 6.48 µg QE/mg extract. The role of antioxidants examined by FRAP, DPPH, H2O2, and ABTS assays. These assay are proved that the IC50 values of EEGU are higher than those of epicatechin. For DPPH scavenging, H2O2 scavenging, and ABTS reduction activities, EEGU resulted IC50 45.70 μg/mL, 162.93 μg/mL, and 35.96 μg/mL, while epicatechin only yielded IC50 0.56 μg/mL, 57.91 μg/mL, and 16.74 μg/mL respectively. Otherwise, the highest reduction in FRAP activities were shown at  50 μg/mL concentration  of epicatechin and EEGU were 236.33 and 202.71 µM Fe (II)/µg respectively. Based on these results, EEGU is concluded as an active natural product because it exhibit antioxidant activities.
Active antimicrobial substances of cherry leaf extracts (Muntingia calabura L.) against Methicillin-Resistant Staphylococcus aureus (MRSA) based on GC-MS analysis Nanik Sulistyani; Mika Triza Misba; Nurkhasanah Nurkhasanah
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (325.77 KB) | DOI: 10.12928/pharmaciana.v10i1.14042

Abstract

Methicillin-resistant Staphylococcus aureus (MRSA) is one of the bacteria that triggers nosocomial diseases. Bacterial resistance requires continuous exploration of active antimicrobial substances from various sources, including medicinal plants. Leaves of cherry (Muntingia calabura L.) reportedly contain three classes of compounds, namely, tannins, flavonoids, and saponins. This research was designed to identify active antimicrobial substances in cherry leaves that could inhibit the growth of MRSA. It employed the Kirby-Bauer test to examine the antimicrobial activities of the leaf extracts of Muntingia calabura L. (EMC) against MRSA. Through GC-MS, active substances were detected from the presence of active spots on TLC plates, as determined by direct-contact bioautography. The TLC used silica gel F254 as the stationary phase and chloroform:ethyl acetate (9:1) as the mobile phase. The antimicrobial activity test results showed that the zone of inhibition of 10% w/v EMC was 10.91±0.75 mm in diameter. At 5% w/v and 2.5% w/v, EMC created zones of inhibition with diameters of 8.5±0.25 mm and 7.25±0.25 mm, respectively. Meanwhile, at 1.25% w/v, it showed no inhibitory activities. Based on the TLC-Bioautography profile, the active spot that produced zones of inhibition was located at Rf 0.04 mm. The GC-MS analysis of this spot detected the presence of two compounds: the first compound had a similarity index of 35% with 3,11,13-triacetycynaratriol, and the second one had a similarity index of 80% with hexaborane-12. Cynaratriol is known to posses antimicrobial activity, whereas hexaborane is the opposite. In conclusion, the minimum inhibitory concentration of EMC for MRSA is 2.5% w/v. Also, the active compounds of EMC bear 35% similarities to 3,11,13-triacetycynaratriol.
Validation methods for evaluation of ceiba honey’s growth inhibitory activity against Bacillus subtilis ATCC 6633 Nuzul Wahyuning Diyah; Laili Irfanah; Isnaeni Isnaeni
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (556.229 KB) | DOI: 10.12928/pharmaciana.v10i1.14348

Abstract

Agar diffusion and turbidimetry were commonly used to evaluation of   antibacterial activity of honey. However, there is no report about which one of these two methods is better. This study attempts to validate the agar diffusion method and turbidimetry used for growth inhibitory assay of ceiba honey against Bacillus subtilis ATCC 6633 based on validation parameters including Limit of Detection (LOD), linearity, precision, and selectivity. The samples were ceiba honey aqueous solutions in concentration 20%-100%. It was found that the minimum inhibitory concentration (MIC) of agar diffusion and turbidimetric methods were 35% and 30% respectively, considered as LOD. In agar diffusion method, plot of inhibitory zone diameter against log of honey concentration yields linear regression equation with r = 0.9804 and Vx0=1.06%, while r and Vx0of linear plot from % transmittance against log concentration in the turbidimetric method were 0.9748 and 1.24% respectively. The coefficient of variation (CV) in agar diffusion method were 1.78% for repeatability and 3.13% for intermediate precision) whereas CV in turbidimetric were 3.64% and 4.05% respectively. Agar diffusion and turbidimetric methods were selective because different source of ceiba honey could give different response in term of MIC. It can be concluded that the agar diffusion and turbidimetric method were valid and suitable for growth inhibitory assay of ceiba honey against Bacillus subtilis ATCC 6633 and there was no significant differences between these methods. The turbidimetry was more sensitive than the agar diffusion method because of its lower LOD and it has more simple experimental technique.
Cost-Effectiveness analisys on the implementation of clinical pathway of pediatric treatment for dengue hemorrhagic fever in PKU Muhammadiyah Hospital Yogyakarta Riana Prastiwi Handayani; Dyah Ariyani Perwitasari; Didik Setiawan; Auliya Abdurrohim Suwantika
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (253.629 KB) | DOI: 10.12928/pharmaciana.v10i1.12332

Abstract

Dengue Hemorrhagic Fever (DHF) remains a concerning world problem especially in Indonesia. This problem particularly deals with therapeutic management of hospitalized children requiring DHF treatment. The current practice of therapeutic management is not in accordance with the standard therapeutic management, which increases the treatment cost. On this account, the application of a clinical pathway is expected to minimize the treatment cost and reduce the length of stay (LoS). However, prior to its the application, it is necessary to analyze the cost effectiveness of the implementation of clinical pathway on pediatric DHF treatment in PKU Muhammadiyah Hospital, Yogyakarta. A retrospective cohort study and cost-effectiveness analysis were applied in this study by considering hospital’s (provider) perspective. Two groups (conform to clinical pathway and not conform to clinical pathway group) were involved in this study. Data of direct medical costs of pediatric DHF treatment, which were suitable with clinical pathways and LoS during 2016-2017 period, were collected in this study. The Incremental Cost Effectiveness Ratio (ICER) between both groups and the Risk Ratio (RR) were calculated as the outcome.  The result confirmed that from 200 patients involved, the treatments of 138 patients (69 %) and 62 patients (31%) were included in the conformed to clinical pathway and not conformed to clinical pathway groups, respectively, with p value of 0,000 and RR of 1,58. The average costs were calculated to be Rp 1.144.024 + Rp 556.372 and Rp 1.989.723 + Rp 1.296.899 for conformity to clinical pathway and non-conformity to clinical pathway groups, respectively. The ICER was calculated to be Rp 826.917. In conclusion, the implementation of clinical pathway on pediatric DHF treatment in PKU Muhammadiyah Hospital, Yogyakarta could reduce LoS and the possibility of having a shorter LoS of up to 1.58 times, it can save cost of Rp 919.238 per one-day reduction in LoS.
UV protection test of the ethanol fraction of papaya cream (Carica papaya L.) added with titanium dioxide Definingsih Yuliastuti; Wahyunita Yulia Sari; Mustikawati Mustikawati
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (13316.006 KB) | DOI: 10.12928/pharmaciana.v10i1.14051

Abstract

Cream containing papaya fruit (10% of the 70% ethanol fraction) has been reported to effectively protect skins from ultraviolet (UV) light, though with a minimum protection ability. This study was aimed to determine the effects of adding titanium dioxide to sunscreen composed of 70% ethanol fraction of papaya flesh on the cream effectiveness, as measured by SPF values and physical properties. The ethanol fraction was obtained by fractionating the 70% ethanol extract of papaya fruit using n-hexane and ethyl acetate. Then, it was added with three different concentrations of titanium dioxide, namely, 1% (FI), 3% (FII), and 5% (FIII), to form cream preparations. These sunscreens were tested for their effectiveness in UV protection by in vitro spectrophotometry and based on the resultant SPFs. Based on the results of the study, the cream prepared with no titanium dioxide had SPF= 1.1283, while the SPFs of cream preparations added with 1%, 3%, and 5% titanium dioxide were 2.0572, 2.5708, and 2.8832, respectively. At these three concentrations, titanium dioxide increased the SPFs by 45%, 56%, and 61%, respectively. The cream preparations were found to have excellent physical properties. Based on the results of the statistical Kruskal-Wallis test, there are significant differences (p<0.05) between FI, FII, and FIII.
Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR) Nurull Hikmah; Rumiyati Rumiyati; Sismindari Sismindari; Abdul Rohman
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (339.33 KB) | DOI: 10.12928/pharmaciana.v10i1.14771

Abstract

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica. The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1oC. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.
Combination of cisplatin, Hedyotis corymbosa L. and Tinospora crispa extracts as a new therapy for breast cancer cells 4T1 through in vitro induction and cell cycle modulation Rollando Rollando; Muhammad Hilmi Afthoni
Pharmaciana Vol 10, No 1 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (123.796 KB) | DOI: 10.12928/pharmaciana.v10i1.14060

Abstract

Cisplatin is a chemotherapeutic agent with varying side effects. Berberine compounds in Tinospora crispa and ursolic acids in Hedyotis corymbosa L are known to have high cytotoxic activities. This study was aimed to examine the effects of the combination of cisplatin, the ethanolic extract of Hedyotis corymbosa L.(EEHC), and the ethanolic extract of Tinospora crispa roots (EETC) on enhanced breast cancer cell sensitivity by apoptotic induction and cell cycle modulation. Cytotoxic effects were tested using the MTT assay in breast cancer cells, 4T1. The combination test of cisplatin and the extracts yielded combination index (CI) and cell viability, and its effects on the induction of apoptosis and cell cycle modulation were observed by the flow cytometry method. The results of the cytotoxic test showed CI of less than one for 1 mg/mL EEHC, 6 mg/mL EETC, and 1.68 mg/mL cisplatin. The EEHC-EETC-cisplatin combination accumulated cells in the S phase (29.98%) and induced apoptosis in 4T1 cells. It proves that EEHC and EETC can be developed as co-agents with cisplatin to improve the effectiveness of breast cancer chemotherapeutic treatment.
Comparative effectiveness of the ethanol extract and infusion of green tea leaves (Camellia Sinensis L.) as a diuretic in male swiss mice Agustina Susilowati; Sista Nanda Indratika
Pharmaciana Vol 10, No 2 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (498.044 KB) | DOI: 10.12928/pharmaciana.v10i2.16839

Abstract

Green tea (Camellia sinensis L.) contains flavonoid compounds and methylxanthine and has proven efficacy as a diuretic. The dosage form is among the factors determining the biological effects of a drug. This experimental study set out to determine the effectiveness of the ethanol extract and infusion of green tea leaves as a diuretic in male Swiss mice. A total of 20 male Swiss mice were divided into four groups receiving different daily treatments: group I (given 1% Na-CMC), group II (furosemide at a dose of 5.2 mg/kg BW), group III (ethanol extract of green tea leaves at a dose 70 mg/kg BW), and group IV (green tea leaf infusion at a dose of 70mg/kg BW). Before the treatment, all groups were given warm water orally (0.4 ml/20g BW), then the effects of diuretics were measured from urine volume for six hours. The data were analyzed statistically by one-way analysis of variance (ANOVA), followed by LSD comparison tests, with p<0.05 indicating any significantly different means. Based on the phytochemical screening results, the ethanol extract and infusion of green tea leaves contained alkaloids, flavonoids, and tannins. The mean cumulative urine volume in group I was 0.260±0.185 ml, group II 0.869±0.162 ml, group III 0.866±0.197 ml, and group IV 0.642±0.187ml. Compared to furosemide, the diuretic activity of the ethanol extract of green tea leaves (0.997±0.182) was not significantly different (p>0.05) from that of the green tea leaf infusion (0.739±0.182). In conclusion, green tea leaves can be used as diuretics in two dosage forms, namely extract and infusion.
Decreased total cholesterol levels in rats administered with chitosan from Green mussel (Perna viridis L.) shells Keni Idacahyati; Yunia Amalia; Tresna Lestari
Pharmaciana Vol 10, No 2 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (427.518 KB) | DOI: 10.12928/pharmaciana.v10i2.13976

Abstract

Chitosan has been known to have anti-cholesterol activity. This linear polysaccharide can be derived from the chitin of green mussel shells by deacetylation. The purpose of this research was to find out the effects of administering chitosan from green mussel (Perna viridis L.) shells on total cholesterol levels. Chitosan was prepared in three steps, namely deproteinization, demineralization, and deacetylation. FTIR was used for characterization, and the absorbance values were calculated to obtain the degree of deacetylation. A total of 24 male Wistar rats were fed with high-fat ingredients (yolk, quail, used cooking oil) and 1% PTU for 30 days p.o and divided into six (6) groups, namely the normal control group, negative control (PGA 1%), positive control (Simvastatin at 0.9 mg/Kg BW), Dose 1 (chitosan at 250 mg/Kg b.w), Dose 2 (chitosan at 500 mg/Kg BW), and Dose 3 (chitosan at 750mg/Kg BW). The chitosan of green mussel shells had a deacetylation degree of 43.05%. The results showed that the three doses of chitosan exhibited reduced total cholesterol levels in the test rats. At a dose of 750 mg/Kg BW, chitosan led to the most significant reduction of total cholesterol levels in rats from averagely 127.1 to 74.2 mg/dL.
The effect of particle size on dissolution rate of fast dissolving oral film containing diclofenac sodium Fitrianti Darusman; Nyayu Ista Yulita; Gita Cahya Eka Darma
Pharmaciana Vol 10, No 2 (2020): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.456 KB) | DOI: 10.12928/pharmaciana.v10i2.15988

Abstract

Diclofenac sodium is a Non-Steroidal Anti Inflammatory Drugs that if being taken orally have the side effects of peptic ulcers and undergone the first pass metabolism, and also included in the Biopharmaceutics Classification System class 2 which resulted in the low rate of dissolution. This study aims to determine the influence of particle size reduction on the dissolution rate of diclofenac sodium in the form of an FDOF dosage. The formation of diclofenac sodium nanoparticles is carried out by ionic gelation method using chitosan and sodium tripolyphosphate as a crosslinker in various ratios characterized by Particle Size Analyzer and Scanning Electron Microscopy, then it is incorporated into the form of an FDOF that were prepared by solvent casting method at a dose of 12.5 mg using variations concentration of SSG as superdisintegrant and PEG 400 as plasticizer. From the research results, diclofenac sodium nanoparticles are formed in the ratio of chitosan-sodium tripolyphosphate 6:1, have a size of 804 nm and spherical-shaped. The best FDOF dosage formula is F8 containing HPMC E5 LV 35% as the film forming agent, SSG 8% as superdisintegrant and PEG 400 10% as plasticizer.  FDOF formula containing diclofenac sodium nanoparticles has a slightly bitter taste, disintegration time less than one minute, surface pH around 7 (neutral), drug content that meets the requirements of the range of determination which is 93.24 ± 0.96, the cumulative amount of drug dissolved in the 28th minute is higher by 88.45% compared to FDOF containing diclofenac sodium raw material, which is only 70.0%.

Filter by Year

2011 2026


Filter By Issues
All Issue Vol. 16 No. 2 (2026): Pharmaciana Vol. 16 No. 1 (2026): Pharmaciana Vol. 15 No. 3 (2025): Pharmaciana Vol. 15 No. 2 (2025): Pharmaciana Vol. 15 No. 1 (2025): Pharmaciana Vol. 14 No. 3 (2024): Pharmaciana Vol. 14 No. 2 (2024): Pharmaciana Vol. 14 No. 1 (2024): Pharmaciana Vol 14, No 1 (2024): Pharmaciana Vol 13, No 3 (2023): Pharmaciana Vol. 13 No. 3 (2023): Pharmaciana Vol 13, No 2 (2023): Pharmaciana Vol 13, No 1 (2023): Pharmaciana Vol 12, No 3 (2022): Pharmaciana Vol 12, No 2 (2022): Pharmaciana Vol 12, No 1 (2022): Pharmaciana Vol 11, No 3 (2021): Pharmaciana Vol 11, No 2 (2021): Pharmaciana Vol 11, No 1 (2021): Pharmaciana Vol 10, No 3 (2020): Pharmaciana Vol 10, No 2 (2020): Pharmaciana Vol 10, No 1 (2020): Pharmaciana Vol 9, No 2 (2019): Pharmaciana Vol 9, No 1 (2019): Pharmaciana Vol 8, No 2 (2018): Pharmaciana Vol. 8 No. 2 (2018): Pharmaciana Vol 8, No 2 (2018): Pharmaciana Vol 8, No 1 (2018): Pharmaciana Vol 8, No 1 (2018): Pharmaciana Vol 7, No 2 (2017): Pharmaciana Vol 7, No 2 (2017): Pharmaciana Vol 7, No 1 (2017): Pharmaciana Vol 7, No 1 (2017): Pharmaciana Vol 6, No 2 (2016): Pharmaciana Vol 6, No 2 (2016): Pharmaciana Vol 6, No 1 (2016): Pharmaciana Vol 6, No 1 (2016): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 5 No 1, 2015 Vol 5, No 2 (2015): Pharmaciana Vol 5, No 2 (2015): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 5, No 1 (2015): Pharmaciana Vol 4, No 2 (2014): Pharmaciana Vol 4, No 2 (2014): Pharmaciana Vol. 4 No. 2 (2014): Pharmaciana Vol 4, No 1 (2014): Pharmaciana Vol 4, No 1 (2014): Pharmaciana Vol 3, No 2 (2013): Pharmaciana Vol 3, No 2 (2013): Pharmaciana Vol 3, No 1: Mei 2013 Vol 3, No 1 (2013): Pharmaciana Vol 3, No 1 (2013): Pharmaciana Vol 2, No 2 (2012): Pharmaciana Vol 2, No 2: November 2012 Vol 2, No 2 (2012): Pharmaciana Vol 2, No 1 (2012): Pharmaciana Vol 2, No 1: Mei 2012 Vol 2, No 1 (2012): Pharmaciana Vol 1, No 2: November 2011 Vol 1, No 2 (2011): Pharmaciana Vol 1, No 2 (2011): Pharmaciana Vol 1, No 1 (2011): Pharmaciana Vol 1, No 1 (2011): Pharmaciana Vol 1, No 1: Mei 2011 More Issue