Claim Missing Document
Check
Articles

Found 29 Documents
Search

Scientific writing: A way to improve students' information literacy and reasoning ability Tutut Indria Permana; Diani Fatmawati; Moh. Mirza Nuryady; Ikmal Reza Fahlevy; Ivan Ardiansyah
Journal of Community Service and Empowerment Vol. 4 No. 2 (2023): August
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jcse.v4i2.25167

Abstract

The abilities students need to fulfill the SDGs are current information literacy and reasoning skills. Apart from going through the learning process, this ability can be developed by the participation of students in extracurricular activities related to scientific writing. This service activity aims to provide scientific writing assistance for students at Batu Islam High School to improve information literacy and reasoning skills. The form of training carried out is to provide material related to various research that can be carried out by students both inside and outside the classroom and provide assistance to take part in scientific writing competitions at the national level. The instruments for community service activities used are information literacy questions and observation sheets. Data analysis was carried out descriptively. The results of community service activities show that there is an increase in students' information literacy and reasoning abilities. The results of the participation of students in the national competition won the third prize
Desain Primer Spesifik Vektor Dengue Aedes aegypti Berdasarkan DNA Pengkode ITS-1, 5.8S Ribosomal RNA, dan ITS-2 Kurnia Ayu Miranti; Sri Wahyuni; Tutut Indria Permana; Diani Fatmawati; Moh Mirza Nuryady
Jurnal Veteriner Vol 24 No 1 (2023)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19087/jveteriner.2023.24.1.76

Abstract

Identification of dengue hemorrhagic fever (DHF) vector species is important for vector control programs. Internal Transcribed Spacer (ITS) of DNA markers is one of the DNA markers that is generally used to identify a species. This study was aimed to obtain potential primers with specific results for Aedes aegypti mosquito species based on DNA sequences ITS-1, 5.8S Ribosomal RNA and ITS-2. This research was an in silico descriptive study using Primer3 and Primer-BLAST, as well as an in vitro confirmation stage was used the Polymerase Chain Reaction (PCR) method. The sequence of DNA data was obtained from NCBI with accession numbers GU980956.1 and ON652374.1. The results of in silico primer design obtained two pairs of potential primers, namely primer 1) Left 5’-CATTTGCTAGTCCCTCGGG-3’ Right 5’-CACCACACCACGTCTGAC-3’, and primer 2) Left 5’-CATTTGCTAGTCCCTCGGG-3’ Right 5’-CATCAACCGCGG TGTGTC- 3’. Visualization of PCR results was detected using a 1.5% agarose gel with a product size of aroind 800 bp. The conclusion of this study was that two pairs of ITS primers were obtained which had the potential to identify A. aegypti mosquitoes.
Ethnobotanical Study of Herbal Plants “Jamu” for Postpartum Mothers in Payudan Dundang Sumenep Regency Findo Bayu Adji; Lise Chamisijatin; H. Husamah; Elly Purwanti; Moh. Mirza Nuryady
Prisma Sains : Jurnal Pengkajian Ilmu dan Pembelajaran Matematika dan IPA IKIP Mataram Vol 12, No 3: July 2024
Publisher : IKIP Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33394/j-ps.v12i3.11990

Abstract

The society in the village of Payudan Dundang, Guluk-guluk sub-district, Sumenep still relied on plants as medicine to treat various types of diseases, particularly as herbal ingredients for postpartum mothers in order to expedite the healing process. This study aimed to identify the species of plants used for this purpose, determine the specific parts utilized, as well as explore the management and utilization of these traditional medicinal plants for postpartum mothers. This study employed a qualitative research design, utilizing interviews as the primary method of data collection. The collected data was then analyzed descriptively and grouped in tabular form. The findings of the study revealed a total of 13 plant species that were used and utilized as herbal remedies for postpartum mothers. These plants included Temulawak, Belungas, Mengkudu, Legundi, Senggugu, Kesembuen, Kunyit, Kencur, Jahe, Meniran, Mimba, Kumis Kucing, and Ceppeuh. The plant parts that were commonly used included leaves, rhizomes, and fruit. In the village of Payudan Dundang, it was reported that individuals consumed these herbal concoctions three times a day, typically in the form of tea. The benefits of these herbal remedies included restoring energy levels after childbirth, facilitating postpartum blood flow, alleviating post-delivery pain, enhancing breast milk production, and increasing the mother's appetite.
Desain dan Optimasi Primer Gen Pengkode MRPA Trypanosoma evansi dan Penerapan pada Pembelajaran Biologi Molekuler Nuryady, Moh. Mirza; Husamah, H.; Miharja, Fuad Jaya; Hindun, Iin; Patmawati, P.
Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Vol. 4 No. 2: July 2020
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/e-saintika.v4i2.217

Abstract

Penelitian molekuler untuk menemukan gen pengkode resistensi Multidrug Resistance Prtotein A (MRPA) T. evansi dan perbanyakan gen secara Polimeration Chain Reaction (PCR)  masih sedikit dilakukan  dan sangat penting untuk dipahami oleh mahasiswa calon guru biologi.  Kajian ini bertujuan untuk menganalisis proses desain dan optimasi primer untuk gen target MRPA T. evansi yang dapat digunakan sebagai sumber belajar mahasiswa pendidikan biologi. Penelitian ini merupakan penelitian deskriptif mengenai tahapan mendesain primer secara online, optimasi primer secara laboratorium serta kajian mengenai pentingnya penerapan hasil studi ini dalam pembelajaran. Hasil penelitian menunjukkan terdapat tiga desain primer yang memenuhi syarat, selanjutnya dari tiga primer tersebut hasil optimasi di laboratorium menunjukkan hanya terdapat dua primer yang menunjukkan hasil yang baik dan dapat digunakan untuk penelitian amplifikasi gen MRPA T. evansi, yaitu primer pertama (F1’, R1’) dan primer kedua (F2’, R2’). Hasil kajian desain dan optimasi primer ini menunjukkan bahwa mahasiswa pendidikan biologi sangatlah penting untuk memahami konsep terkait dengan pekerjaan molekuler seperti mendesain dan optimasi primer, dikarenakan mereka memiliki tuntutan untuk menjadi seorang calon pendidik atau sebagai calon peneliti dimasa depan.Design and Optimization of Trypanosoma evansi MRPA Primer Coding Genes and Application to Molecular Biology LearningAbstractMolecular research to find Multidrug Resistance Prtotein A (MRPA) resistance coding genes and gene propagation by Polimeration Chain Reaction (PCR) is still little done and is very important to be understood by prospective biology teacher students. This study aims to analyze the design and primary optimization process for the T. evansi MRPA target gene that can be used as a learning resource for biology education students. This research was a descriptive study to described the step of primer design and optimization due to the importance of this steps to be applied as learning source. The results showed that there were 3 primer designs that qualified, then after the optimizing step there were only two primers that showed a good result, the first primer (F1, R1) and second primer (F2', R2). The results of this study showed the importance of biology education students to understand the concepts related to molecular work because in the future they are not only become prospective educators, they also have demands as prospective researchers.
Knowledge of the Madurese Community-Indonesia Regarding Bioprospection of the Traditional Herb Kamandin Saebo (Glossocardia leschenaultii [Cass.] Veldkamp) Purwanti, Elly; Nuryady, Moh. Mirza; Permana, Tutut Indria; Rachmawati, Hidajah; Anggraeni, Amaliyah Dina
Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Vol. 7 No. 3: November 2023
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/esaintika.v7i3.1403

Abstract

The purpose of this study was to describe the knowledge of the Sumenep Madura community (village elders and gatherers) about the Kamandin Saebo (Glossocardia leschenaultii) plant and its utilization. This study uses observational research that aims to observe a fact at a certain time using a descriptional approach model. The research was conducted in the Sumenep-Madura area, East Java Province. The research was conducted in July 2023-August 2023 by observational method. We discussed the results of information regarding the knowledge of the Sumenep people about the existence and growing areas of Kamandin saebo, a literature search regarding the morphological characterization, benefits, or uses of Kamandin saebo in medicine as conveyed by the gatherers. We also found that Kamandin Saebo is of great value. There are 14 healing functions associated with Kamandin Saebo. The Madurese people believe this plant to have many benefits or even cure all diseases.
Toxicity profile of jamu sari rapet albumin and creatinine levels in female rats (Rattus norvegicus) Ulfa, Darlah Immaria; Nuryady, Moh. Mirza; Wahyuni, Sri; Susetyarini, Rr Eko; Purwanti, Elly; Ariesaka, Kiky Martha; Fatmawati, Diani
Jurnal Biolokus : Jurnal Penelitian Pendidikan Biologi dan Biologi Vol 6, No 2 (2023): December
Publisher : Universitas Islam Negeri Sumatera Utara

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30821/biolokus.v6i2.3119

Abstract

Married Madurese women routinely consume jamu sari rapet to please their husbands. There is no information on the toxicity test of jamu sari rapet.  The kidney is one of the organs that is targeted by toxic substances that enter the body. One of the parameters controlled is albumin and creatinine. The purpose of this study was to determine the effect on albumin and creatinine levels in white rats (Rattus norvegicus) given jamu sari rapet. This type of research is true experimental with a quantitative approach. This study was conducted for 28 days (subchronic). Data were analyzed using the Kruskal Wallis test. There were 4 groups, namely dose group 1 (1,56 g/gBB), dose group 2 (1,60 g/gBB), dose group 3 (1,66 g/gBB) and the control group. The results of this study showed no significant difference between albumin and creatinine levels compared to the control group. The conclusion shows that jamu sari rapet given to female rats (Rattus norvegicus) for 28 days has no significant effect on albumin and creatinine levels.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Hilirisasi Prototype Diversifikasi Pangan Fungsional Berbasis Koro Lokal dalam Upaya Pengembangan Produk Pangan Sehat Dan Ekonomi Hijau di Sumenep Purwanti, Elly; Warkoyo, W.; Hidayati, Asmah; Nuryady, Moh. Mirza; Permana, Tutut Indria; Lestari, Novi Puji
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 4 (2024): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i4.2305

Abstract

Kegiatan ini bertujuan untuk melakukan hilirisasi prototipe diversifikasi pangan fungsional berbasis kacang koro lokal dalam rangka pengembangan produk pangan sehat dan ekonomi hijau di Sumenep. Program ini dilaksanakan dengan menggunakan pendekatan Triple Helix yang melibatkan tiga komponen utama: Universitas Muhammadiyah Malang (UMM) sebagai pemegang inovasi, Kemendikbudristek sebagai pemberi dana, dan mitra industri rumah tangga (IRT) di Sumenep, yaitu CV Bunga Anggrek dan CV Akancatani, sebagai penerima manfaat utama. Sinergi antara akademisi, pemerintah, dan industri ini bertujuan untuk mendorong inovasi yang mampu meningkatkan kesejahteraan masyarakat melalui pengembangan ekonomi hijau. Kegiatan hilirisasi ini dilakukan melalui Focus Group Discussion (FGD), sosialisasi, dan pendampingan intensif oleh tim UMM kepada mitra IRT, dengan fokus pada peningkatan kualitas dan kuantitas produk berbasis koro. Selain itu, pelaksanaan Kuliah Kerja Nyata (KKN) di Desa Grujugan, Sumenep, turut memperkuat upaya ini dengan program kerja yang mengembangkan potensi desa dan memperluas akses pasar produk koro. Secara keseluruhan, kegiatan ini tidak hanya mendukung keberlanjutan usaha IRT berbasis koro, tetapi juga memperkuat daya saing produk di pasar yang lebih luas, mendukung ekonomi lokal dengan adanya peningkatan pendapatan, dan membangun keterampilan masyarakat dalam pengelolaan bisnis yang berkelanjutan. Kegiatan ini juga dapat menjadi inspirasi bagi pengembangan ekonomi hijau di wilayah lain di Madura dan Indonesia. Downstreaming of Functional Food Diversification Prototype Based on Local Koro in an Effort to Develop Healthy Food Products and a Green Economy in Sumenep Abstract This activity aims to downstream a prototype of functional food diversification based on local koro beans in order to develop healthy food products and a green economy in Sumenep. This program is implemented using the Triple Helix approach involving three main components: the UniversitAS Muhammadiyah Malang (UMM) as the innovation holder, the Ministry of Education, Culture, Research and Technology as the funder, and home industry partners (IRT) in Sumenep, namely CV Bunga Anggrek and CV Akancatani, as the main beneficiaries. The synergy between academics, government, and industry aims to encourage innovation that can improve community welfare through the development of a green economy. This downstream activity is carried out through Focus Group Discussions (FGD), socialization, and intensive mentoring by the UMM team to IRT partners, with a focus on improving the quality and quantity of koro-based products. In addition, the implementation of the Real Work Lecture (KKN) in Grujugan Village, Sumenep, also strengthens this effort with a work program that develops village potential and expands market access for koro products. Overall, this activity not only supports the sustainability of koro-based IRT businesses, but also strengthens product competitiveness in the wider market, supports the local economy with the increase in income, and builds community skills in sustainable business management. This activity can also be an inspiration for the development of a green economy in other regions in Madura and Indonesia.
Sistematik Literatur Review Biolarvasida Dalam Mengontrol Populasi Larva Nyamuk Naadiya, Nurun; Wahyuni, Sri; Nuryady, Moh. Mirza
ENVIRONMENTAL OCCUPATIONAL HEALTH AND SAFETY JOURNAL Vol 5, No 1 (2024): EOHSJ
Publisher : Fakultas Kesehatan Masyarakat Universitas Muhammadiyah Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24853/eohjs.5.1.41-52

Abstract

Nyamuk merupakan vektor yang menyebabkan beberapa penyakit seperti malaria, demam berdarah dengue, cikungunya, Filariasis limfatik, serta Japanese encephalitis. Penggunaan larvasida sintetis secara berulang akan dapat menyebabkan masalah kesehatan dan lingkungan. Penelusuran artikel bertujuan untuk menganalisis hasil-hasil penelitian terkait biolarvasida dalam mengontrol populasi larva nyamuk. Kandungan seperti tanin, saponin, dan alkaloid pada sebagian besar biolarvasida dipercaya dapat sebagai racun perut bagi larva sehingga larva akan kehilangan berat badan dan ketidakmampuan dalam melakukan pertumbuhan menuju fase berikutnya. Metode yang digunakan dalam penelitian ini yaitu menggunakan jenis penelitian Systematic Literature Review (SLR). SLR merupakan jenis penelitian yang dilakukan dengan cara mengidentifikasi dan menganalisis artikel berdasarkan suatu topik tertentu. Berdasarkan hasil pencarian diperoleh 13 dari 26 artikel yang sesuai mengenai biolarvasida. 13 diantaranya mengenai cara lain menggunakan bantuan hewan predator atau organisme lain, larvasida sintetis, serta dengan cara menjaga sanitasi kesehatan. Berdasarkan hasil analisis, diperoleh bahwa biolarvasida yang banyak digunakan berasal dari minyak atsiri beberapa jenis tanaman, seperti biji kulit kacang mete, minyak atsiri dari tanaman Carlina acaulis dan Carlina oxide. Berdasarkan hasil analisis, penelitian ini dapat dimanfaatkan sebagai sumber belajar biologi pada Paket C Fase E kelas X mengenai keanekaragaman hayati beserta peranannya.--Mosquitoes are vectors that cause several diseases such as malaria, dengue hemorrhagic fever, chikungunya, lymphatic filariasis, and Japanese encephalitis. Repeated use of synthetic larvicides can cause health and environmental problems. The article search aims to analyze research results related to biolarvicides in controlling mosquito larvae populations. Ingredients such as tannins, saponins, and alkaloids in most biolarvicides are believed to act as stomach poisons for larvae, resulting in weight loss and inability to grow into the next phase. The method used in this research is using the Systematic Literature Review (SLR) research type. SLR is a type of research conducted by identifying and analyzing articles based on a particular topic. Based on the search results, 13 out of 26 suitable articles were obtained regarding biolarvicides. 13 of them are about other methods using the help of predatory animals or other organisms, synthetic larvicides, and by maintaining health sanitation. Based on the results of the analysis, it was found that the widely used biolarvicides are derived from the essential oils of several types of plants, such as cashew nut shell seeds, essential oils from Carlina acaulis and Carlina oxide plants. Based on the results of the analysis, this research can be utilized as a source of learning biology in Package C Phase E class X regarding diversity.
Pemanfaatan Agen Biologis dalam Pengelolaan Sampah Organik Rumah Tangga di Dusun Bejen Kabupaten Bantul Nuryady, Moh. Mirza; Fauzi, Ahmad; Setyawan, Dwi; Nurwidodo, Nurwidodo; Pratiwi, Ambar; Utami, Inggita; Putra, Ichsan Luqmana Indra; Munir, Misbahul
Aksiologiya: Jurnal Pengabdian Kepada Masyarakat Vol 8 No 4 (2024): November
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/aks.v8i4.11104

Abstract

Sampah organik merupakan hasil dari sisa makan, kayu, ranting, daun, dan kertas, sampah organik mendominasi di Indonesia. Salah satu penghasil sampah organik adalah rumah tangga. Dusun Bejen kabupaten Bantul merupakan penghasil sampah organik tersebut. Dengan adanya Pengabdian Kepada Masyarakat (PKM) menambah pengetahuan dan keterampilan serta kesadaran Warga Dusun Bejen Bantul meningkat dan permasalahan sampah yang belum tertangani di lokasi tersebut dapat terselesaikan. Kegiatan ini dilaksanakan di halaman Musholla Al-Manar, Dusun Bejen pada tanggal 19 Oktober 2021. Pelatihan yang dilakukan berupa pengolahan sampah organik dengan teknik keranjang takakura, eco-enzyme dan ember tumpuk dengan Black Soldier Fly (BSF). Dari hasil pengabdian kepada masyarakat Dusun Bejen terbukti meningkatkan pengetahuan dan keterampilan dalam mengolah sampah organik skala rumah tangga.
Co-Authors AA Sudharmawan, AA Agustin, Jihan Ully Agustina, Jihan Aurelia Ainur Rofieq Aisha, Aisha Aldina, Siti Nur Alimatul, Zada Amaliyah Dina Anggraeni Anggitania Dyan Anggraini Anka Mohammad Dinindra Arsya Lingga Datu Asmah Hidayati Aulia, Diva Ayu, Putri Dhiga Agung Sasongkojati Diani Fatmawati Diani Fatmawati Diani Fatmawati Diani Fatmawati Dinindra, Anka Muhammad Dwi Setyawan Elly Purwanti Elly Purwanti Erni Yohani Mahtuti Fatmawati, Diani Fauzi Ahmad Muda Findo Bayu Adji Fitrine Ekawasti, Fitrine Fuad Jaya Miharja Hidajah Rachmawati Husamah Husamah Ichsan Luqmana Indra Putra, Ichsan Luqmana Indra Iin Hindun Iin Hindun Ika Wahyuni Ikmal Reza Fahlevy Ilma Nurul Khoiriyah Inggita Utami Ivan Ardiansyah Jihan Ully Agustin Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Kiky Martha Ariesaka Kurnia Ayu Miranti Kurnia Ayu Miranti Kwon, Ohseok Lestari, Novi Puji Lise Chamisijatin Lisma Dahlia Lud Waluyo Lutfi, Muhammad Ahman Maliza, Rita Martha Ariesaka, Kiky Miftachur Rohma Misbahul Munir Muhammad Ahman Luthfi Setiawan Naadiya, Nurun Ndzani Latifatur Rofi’ah Nur Ilmi Dwi Sasmitasari Nur Islakhun Nisa’ Nurwidodo, Nurwidodo P. Patmawati Patmawati, P. Phandini, Intan Poncojari Wahyono Pratiwi, Ambar Purwanti, Elly Putri Ayu Irrodah Putri, Aura Febiola Afi Rr. Eko Susetyarini Sasmitasari, Nur Ilmi Dwi Savitri, Aulia Shifa Alkautsar Siti Mariyatul Qibtiyah Siti Nur Aldina Sri Wahyuni Sri Wahyuni Susetyarini, Rr Eko Tamala, Shofi Tutut Indria Permana Ulfa, Darlah Immaria Utami, Inggita Wahyuni, Sri Warkoyo, W. Zada Alimatul Mu’azah Zakiyatul Khoiriyah