Claim Missing Document
Check
Articles

Found 28 Documents
Search

Optimalisasi Keterampilan 4C Siswa Melalui Pendampingan Karya Ilmiah di SMAN 1 Tumpang Permana, Tutut Indria; Nuryady, Moh. Mirza
Jurnal SOLMA Vol. 14 No. 1 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i1.18089

Abstract

Background: Enhancing 4C skills (Critical Thinking, Creativity, Collaboration, and Communication) is one of the primary goals of 21st-century education. Schools play a crucial role as the main environment for developing these skills, fostered through a scientific writing mentorship program for students. This program was designed by a dedicated team to provide intensive guidance to 28 students of SMA Negeri 1 Tumpang in crafting and presenting high-quality scientific works. Through this process, students were trained to critically analyze problems, create innovative solutions, collaborate effectively within teams, and communicate their research findings. Methods: The approach employed consisted of interactive workshops, mentoring sessions, and continuous evaluation. Results: The evaluation included measuring 4C skills through tests, which revealed a high average score (93.21) with a low standard deviation (SD=5.808), indicating a homogeneous distribution of scores. The outcome of this community engagement activity was the establishment of a student extracurricular scientific writing group comprising 28 members with guidance from a teacher mentor. Conclusions: This program successfully enhanced students' academic skills while also preparing them to face future challenges with greater confidence and competence. Moreover, this learning approach serves as an inspirational model for developing 21st-century skills among the younger generation.
PENGARUH EKSTRAK DAUN SERAI (Cymbopogon citratus (DC.) Stapf) TERHADAP PERKEMBANGBIAKAN KUTU BERAS (Sitophilus oryzae L.) Miftachur Rohma; Moh Mirza Nuryady; Sri Wahyuni
Jurnal Ilmu-Ilmu Pertanian Indonesia Vol 23 No 2 (2021)
Publisher : BPFP Universitas Bengkulu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31186/jipi.23.2.136-145

Abstract

[THE EFFECT OF LEMONGRASS (Cymbopogon citratus (DC.) Stapf) LEAVES EXTRACT ON RICE WEEVIL (Sitophilus oryzae L.) REPRODUCTION]. Rice weevil (Sitophilus oryzae) is the most destructive pest of rice. S. oryzae can be controlled with lemongrass (Cymbopogon citratus). C. citratus leaves extract can be used as pests control because it contains potential active compounds. This study aims to determine the effect of the several concentrations of C. citratus extract from fresh and dry leaves on S. oryzae reproduction. This study was used factorial RAL with two factors. The first factor was concentrations which were divided into 5%, 10%, 20%, as well as the positive control group (alfamethrin 1%) and the negative control group (aqua dest). The second factor was the use of C. citratus leaves which were divided into fresh and dry leaves. Parameters observed were the repellent of S. oryzae, the number of new adults, the damaged rice percentage, and the rice organoleptic. The rice organoleptic was conducted to observe color, texture, smell, and taste. The data were analyzed using a two-way ANOVA test. The best result has been found in the concentration of 20% from fresh C. citratus treatment with an average repellency of 68.50±14.45%, the number of new adults of 29±4.99, and the damaged rice percentage of 24.75±4.113%. The result of the organoleptic test with the highest average value was found in the concentration 5% from fresh C. citratus treatment. The results of the organoleptic test with Kruskal-Wallis showed that there were no significant differences in the color, texture, smell, and taste of rice. The conclusion of this study showed that C. citratus can be used effectively against S. oryzae.
Research trends in isolation and identification of bacteria from Indonesia with various roles: Review Article Nuryady, Moh. Mirza; Aisha, Aisha; Aulia, Diva; Savitri, Aulia
Journal of Biotechnology and Natural Science Vol. 1 No. 2 (2021): December
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (667.989 KB) | DOI: 10.12928/jbns.v1i2.5232

Abstract

Bacteria are agents that can be used widely and are genetically easy to manipulate and reproduce. Many studies related to the isolation and identification of bacterial isolates from Indonesia have been carried out for various purposes. This research is still ongoing and has never been informed about the abundance of data from previous studies. The purpose of this study is to provide an overview of research topic trends related to the isolation and identification of bacterial isolates from Indonesia. The method used in this review is by setting inclusion and exclusion criteria and selecting a random sample of articles for analysis. The results of a review of research trends in isolation and identification of bacterial isolates from Indonesia showed four main topics discussed, namely the topics of food processing, agriculture, health, and bioremediation. Analysis of 41 articles shows that the most common discussion is the exploration of Lactate Origin-producing bacteria, the role of improving food quality. Furthermore, it was identified that the most isolated bacterial isolates came from food and plants, with 14 publications from a total of 41 articles. It can be concluded that exploratory research on Lactic Acid Bacteria for improving the quality of food products is currently the most studied topic by researchers in Indonesia.
Pemanfaatan Agen Biologis dalam Pengelolaan Sampah Organik Rumah Tangga di Dusun Bejen Kabupaten Bantul Nuryady, Moh. Mirza; Fauzi, Ahmad; Setyawan, Dwi; Nurwidodo, Nurwidodo; Pratiwi, Ambar; Utami, Inggita; Putra, Ichsan Luqmana Indra; Munir, Misbahul
Aksiologiya: Jurnal Pengabdian Kepada Masyarakat Vol 8 No 4 (2024): November
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/aks.v8i4.11104

Abstract

Sampah organik merupakan hasil dari sisa makan, kayu, ranting, daun, dan kertas, sampah organik mendominasi di Indonesia. Salah satu penghasil sampah organik adalah rumah tangga. Dusun Bejen kabupaten Bantul merupakan penghasil sampah organik tersebut. Dengan adanya Pengabdian Kepada Masyarakat (PKM) menambah pengetahuan dan keterampilan serta kesadaran Warga Dusun Bejen Bantul meningkat dan permasalahan sampah yang belum tertangani di lokasi tersebut dapat terselesaikan. Kegiatan ini dilaksanakan di halaman Musholla Al-Manar, Dusun Bejen pada tanggal 19 Oktober 2021. Pelatihan yang dilakukan berupa pengolahan sampah organik dengan teknik keranjang takakura, eco-enzyme dan ember tumpuk dengan Black Soldier Fly (BSF). Dari hasil pengabdian kepada masyarakat Dusun Bejen terbukti meningkatkan pengetahuan dan keterampilan dalam mengolah sampah organik skala rumah tangga.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
STEM-PBL integrative electronic module: Is that effective in improving students' critical thinking skills? Phandini, Intan; Miharja, Fuad Jaya; Husamah, Husamah; Fauzi, Ahmad; Nuryady, Mohammad Mirza
Jurnal Inovasi Pendidikan IPA Vol. 9 No. 2: Oktober 2023
Publisher : Faculty of Mathematics and Natural Sciences, Universitas Negeri Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21831/jipi.v9i2.60871

Abstract

The aim of this research is to develop an electronic module that integrates STEM and PBL projects to improve students' critical thinking skills. Development research conducted using the ADDIE model. The research was conducted at Muhammadiyah 2 Junior High School (JHS) of Batu. Product trials were carried out involving 25 class VII students. The data collection instrument was carried out using a questionnaire given to media experts, material experts, teachers and students to test the feasibility and practicality of the media, as well as the pretest-posttest to measure students' critical thinking skills. The results of the study show four things: 1) the E-Module learning media is in the very feasible category with a weighting percentage of eligibility, namely 77.5% by media experts and 98% by material experts. 2) E-Module learning media is included in the very practical category by science teachers with a percentage of 97%, and the practical category by students with a percentage of 79%. 3) The results of the implementation show that students are very enthusiastic in participating in learning activities using the E-Module, seen from the percentage of aspects of interest in the media which reaches 86%. 4) E-Module learning media has a significant effect so that it has the potential to improve students' critical thinking skills (Sig = 0.000). Thus, the E-Module with the STEM approach based on the PBL Model can be used in learning environmental pollution material by students.
Effect of Water Clover Extract (Marsilea crenata Presl.) on the Diameter of the Staphylococcus epidermidis Inhibition Zone Lud Waluyo; Arsya Lingga Datu; Mohammad Mirza Nuryady; Erni Yohani Mahtuti
Quagga: Jurnal Pendidikan dan Biologi Vol 17 No 1 (2025): QUAGGA : Jurnal Pendidikan dan Biologi
Publisher : Program Studi Pendidikan Biologi, Fakultas Keguruan dan Ilmu Pendidikan, Universitas Kuningan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25134/quagga.v17i1.23

Abstract

The incidence of acne in Indonesia reaches 85% with an age range of around 15-24 years. The research aims to analyze the effect of water clover extract (Marsilea crenata Presl.) on the inhibition zone of Staphylococcus epidermidis. This type of research is a true experiment with a quantitative approach. The experimental design is The Post Test-Only Control Group Design. The research population was a pure culture of Staphylococcus epidermidis and the sample used was Staphylococcus epidermidis with a density of 1.5 x 10-8. The research method is the well diffusion method. Data were analyzed using one-way analysis of variance (ANOVA).  The results of the research were that the concentration of water clover extract (Marsilea crenata Presl.) 25% volume 30µl, 50µl, 75µl, and 100µl had an average diameter of the inhibition zone, namely 6.41 mm, 7.51mm, 8.36 mm, and 9.70 mm. The conclusion of this research is that there is an influence of water clover extract (Marsilea crenata Presl.) on the diameter of the inhibition zone of Staphylococcus epidermidis and the most effective concentration in inhibiting bacterial growth is 25% extract with a volume of 100 µl with an average diameter of the inhibition zone of 9.70 mm.
Pendampingan Pengolahan Produk Kreatif Resin Berbahan Anggrek sebagai Kerajinan Tangan Masyarakat Desa Dadaprejo, Kota Batu Nuryady, Mohammad Mirza; Permana, Tutut Indria; Fatmawati, Diani; Levina, Levina; Juliana, Imelda; Janufian, Fairus Athar; Ariesaka, Kiky Martha
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 8 No. 2 (2026): Mei
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/4km80049

Abstract

Pandemi Covid-19 memberikan dampak yang luar biasa terhadap kehidupan sosial bermasyarakat utamanya di sektor ekonomi. Industri Ekonomi kreatif memiliki peran yang sangat besar dalam roda perekonomian, oleh karena itu dibutuhkan upaya untuk mendukung ekonomi kreatif warga. Desa wisata anggrek Dadaprejo terkenal dengan tumbuhan anggreknya, umumnya bunga anggrek akan gugur dan menjadi limbah dalam beberapa minggu. Hal ini menjadi peluang agar bunga anggrek tetap dapat memiliki nilai ekonomis dengan dijadikan kerjainan tangan berupa resin anggrek. Kegiatan ini bertujuan untuk melatih warga agar dapat memanfaatkan bunga anggrek sebelum menjadi limbah untuk dimanfaatkan menjadi produk kerajinan tangan yang dapat membantu perekonomian warga. Target dari kegiatan ini adalah pertama masyarakat di sekitar wisata anggrek dapat memanfaatkan sumber daya yang ada untuk dijadikan produk kerajinan kreatif untuk meningkatkan ekonomi serta dengan adanya kerajinan tangan tersebut dapat semakin mendukung wisata desa anggrek. Hasil kegiatan ini terdapat kelompok masyarakat yang berhasil menjadikan resin anggrek ini sebagai usaha yang berkelanjutan dengan penjualan di bulan pertama mencapai dua kali lipat modal awal. Selain itu pemahaman masyarakat tentang industry kreatif serta pengetahuan tentang pengolahan resin sebagai kerajinan tangan menunjukkan adanya peningkatan pemahaman. Assistance in Processing Creative Orchid Resin Products as Handicrafts for the Dadaprejo Village Community, Batu City The Covid-19 pandemic has had a tremendous impact on social life, especially in the economic sector. The creative economy industry has a very large role in the economy; therefore, efforts are needed to support the citizens' creative economy. The Dadaprejo Orchid Tourism Village is famous for its orchid plants, mostly orchids fall and become waste within a few weeks. This is an opportunity so that orchids can still have economic value by being made into hands in the form of orchid resin. This activity aims to train residents to be able to use orchids before they become waste to be used as handicraft products that can help the local economy. The target of this activity is first that the community around orchid tourism can take advantage of existing resources to be used as creative craft products to improve the economy and with these handicrafts they can support orchid village tourism. As a result of this activity, there were community groups who succeeded in making this orchid resin a sustainable business with sales in the first month reaching double the initial capital. In addition, the public's understanding of the creative industry as well as about resin processing as a handicraft shows an increase in understanding.
Co-Authors AA Sudharmawan, AA Agustin, Jihan Ully Agustina, Jihan Aurelia Ainur Rofieq Aisha, Aisha Aldina, Siti Nur Alimatul, Zada Amaliyah Dina Anggraeni Anggitania Dyan Anggraini Anka Mohammad Dinindra Arsya Lingga Datu Asmah Hidayati Aulia, Diva Ayu, Putri Dhiga Agung Sasongkojati Diani Fatmawati Diani Fatmawati Diani Fatmawati Diani Fatmawati Dinindra, Anka Muhammad Dwi Setyawan Elly Purwanti Elly Purwanti Erni Yohani Mahtuti Fatmawati, Diani Fauzi Ahmad Muda Findo Bayu Adji Fitrine Ekawasti, Fitrine Fuad Jaya Miharja Hidajah Rachmawati Husamah Husamah Ichsan Luqmana Indra Putra, Ichsan Luqmana Indra Iin Hindun Iin Hindun Ika Wahyuni Ikmal Reza Fahlevy Ilma Nurul Khoiriyah Inggita Utami Ivan Ardiansyah Janufian, Fairus Athar Jihan Ully Agustin Juliana, Imelda Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul Kiky Martha Ariesaka Kurnia Ayu Miranti Kurnia Ayu Miranti Kwon, Ohseok Lestari, Novi Puji Levina Levina, Levina Lise Chamisijatin Lisma Dahlia Lud Waluyo Lutfi, Muhammad Ahman Maliza, Rita Martha Ariesaka, Kiky Miftachur Rohma Misbahul Munir Muhammad Ahman Luthfi Setiawan Naadiya, Nurun Ndzani Latifatur Rofi’ah Nur Ilmi Dwi Sasmitasari Nur Islakhun Nisa’ Nurwidodo, Nurwidodo P. Patmawati Patmawati, P. Phandini, Intan Poncojari Wahyono Pratiwi, Ambar Purwanti, Elly Putri Ayu Irrodah Putri, Aura Febiola Afi Rr. Eko Susetyarini Sasmitasari, Nur Ilmi Dwi Savitri, Aulia Shifa Alkautsar Siti Mariyatul Qibtiyah Siti Nur Aldina Sri Wahyuni Sri Wahyuni Susetyarini, Rr Eko Tamala, Shofi Tutut Indria Permana Ulfa, Darlah Immaria Utami, Inggita Wahyuni, Sri Warkoyo, W. Zada Alimatul Mu’azah Zakiyatul Khoiriyah