Claim Missing Document
Check
Articles

Found 23 Documents
Search

Penyuluhan dan Pemeriksaan Kesehatan serta Pengobatan Gratis pada Masyarakat Desa Sindurejo Kecamatan Gedangan Kabupaten Malang untuk Skrining Penyakit Tidak Menular Ariesaka, Kiky Martha; Iftitahurroza, Hilma Tsurayya; Nuryady, Moh Mirza
Jurnal SOLMA Vol. 14 No. 1 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i1.15729

Abstract

Latar Belakang: Kesehatan merupakan aspek mendasar bagi produktivitas dan kualitas hidup manusia. Hingga saat ini, penyakit tidak menular (PTM) masih menjadi perhatian global, termasuk di Indonesia. PTM, seperti kardiovaskular, diabetes, dan kanker, menyebabkan lebih dari 70% kematian global, dengan tingkat kematian tertinggi di negara berkembang. Di Indonesia, prevalensi diabetes dan hipertensi meningkat, khususnya di wilayah pedesaan. Berdasarkan hasil wawancara dengan pemangku kebijakan setempat, Desa Sindurejo, Kab. Malang menghadapi tantangan deteksi dan penanganan PTM karena jarak yang signifikan  dari pusat layanan kesehatan. Kegiatan pengabdian masyarakat ini bertujuan untuk menjawab permasalahan deteksi PTM tersebut  dengan melakukan skrining dan penyuluhan kesehatan di Desa Sindurejo. Metode: Kegiatan ini melibatkan mitra yaitu kepala desa Sindurejo dengan target sasaran seluruh warga lansia di desa Sindurejo. Metode melibatkan pemeriksaan kesehatan yang terdiri atas pengukuran berat badan, tanda-tanda vital (tekanan darah, laju denyut nadi, frekuensi napas, dan suhu tubuh), dan pengukuran kadar gula darah sewaktu (GDS), asam urat dan kolesterol, serta penyuluhan dengan metode ceramah. Hasil: Hasil kegiatan yang dilaksanakan pada Januari 2024 di Desa Sindurejo menunjukkan antusiasme partisipasi warga, diikuti oleh total 46 orang lansia. Kegiatan skrining dan pemeriksaan gratis berhasil mendiagnosis PTM pada sebagian besar individu, sementara penyuluhan meningkatkan kesadaran akan pentingnya pencegahan PTM. Kesimpulan: Kesimpulannya, kegiatan ini memberikan dampak positif pada kesehatan masyarakat pedesaan dan mendukung upaya global mengurangi beban PTM melalui deteksi dini dan modifikasi gaya hidup sehat
Breeding Site Preferences and Resistance Status of Aedes aegypti in Malang City Nuryady, Moh Mirza; Purwanti, Elly; Permana, Tutut Indria; Ariesaka, Kiky Martha
Jurnal Kesehatan Masyarakat Vol. 21 No. 2 (2025)
Publisher : Universitas Negeri Semarang in collaboration with Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI Tingkat Pusat) and Jejaring Nasional Pendidikan Kesehatan (JNPK)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/kemas.v21i2.21666

Abstract

Dengue Hemorrhagic Fever (DHF) remains a significant health challenge in urban and semi-urban regions, including Malang City, Indonesia, where Aedes aegypti is the primary vector. This study aimed to identify the breeding site preferences of Ae. aegypti and assess its resistance to 0.8% malathion and 0.05% cypermethrin insecticides. Using a descriptive observational design, ovitraps were deployed in three districts to collect mosquito larvae and eggs, and interviews with residents provided additional data on breeding site preferences. Resistance tests followed WHO guidelines, with mortality rates analysed after insecticide exposure. Results indicated that Ae. aegypti larvae were predominantly found in bathroom water tanks (45%) and flower vases (35%). Resistance status revealed geographical variability: Ae. aegypti in District 1 were resistant to cypermethrin, while populations in Districts 2 and 3 were susceptible, with average status of Ae. Aegypti to cypermethrin is tolerant. For malathion, resistance was widespread, particularly in District 3, with average status of Ae. Aegypti to malathion is resistant. These findings suggest that the use of malathion for vector control in Malang is no longer effective, while cypermethrin remains viable under strict monitoring to prevent future resistance. This study underscores the need for targeted insecticide use and regular monitoring to optimize vector control strategies and minimize DHF transmission.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Pemberian Senam Low Impact untuk Meningkatkan Kesehatan Reproduksi bagi Remaja Siswa-Siswi SMAN 7 Malang Hilma Tsurayya Iftitahurroza; Anditri Weningtyas; Kiky Martha Ariesaka; Lintang Widya Sishartami; Arif Ladika; Faridatus Solikha; Fannia Yosa Bakhtiar
EduInovasi:  Journal of Basic Educational Studies Vol. 4 No. 3 (2024): EduInovasi:  Journal of Basic Educational Studies
Publisher : Intitut Agama Islam Nasional Laa Roiba Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47467/edu.v4i3.4413

Abstract

Adolescent reproductive health is a crucial aspect in the development of the quality of life for young generations. This community service activity aims to evaluate the effectiveness of low-impact exercise in improving reproductive health among students of SMAN 7 Malang. The method used is a participatory approach with low-impact exercise training conducted over 12 weeks. A total of 120 randomly selected students participated in this program. Reproductive health data were collected through questionnaires before and after the intervention, covering aspects such as knowledge of reproductive health, healthy living habits, and the frequency of reproductive health symptoms. Evaluation results showed a significant increase in participants' reproductive health scores after participating in the low-impact exercise program. The conclusion of this activity indicates that low-impact exercise can be an effective method in school reproductive health education programs. It is hoped that this program can be implemented routinely and become part of the physical education curriculum to improve adolescent reproductive health.
Peningkatan Kapasitas Guru Sekolah Luar Biasa tentang Diet Gluten Free Casein Free (GFCF) pada Anak dengan Autism Spectrum Disorder Kurniawan, Agung; Fukata, Editya; Ariesaka, Kiky Martha; Wijaya, Andreas Budi; Putri, Angelica Igsanti; Prasetya, Ahmada Viosepta; Devi, Athaayaa Nastiti Ulayya; Putra, Alvino Ramadhany; Khodijah, Khodijah; Auliarahma, Zhafirah
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 10 No. 4 (2025): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/dfr7v968

Abstract

Salah satu intervensi non-farmakologis pada anak dengan Autism Spectrum Disorder (ASD) adalah diet Gluten Free Casein Free (GFCF), namun pengetahuan guru Sekolah Luar Biasa (SLB) tentang diet ini masih sangat terbatas. Program pengabdian ini bertujuan meningkatkan pemahaman guru mengenai konsep dan implementasi diet GFCF di sekolah. Metode yang digunakan adalah pelatihan berbasis model ADDIE (Analysis, Design, Development, Implementation, Evaluation) yang melibatkan 29 guru SDLB melalui pendekatan partisipatif. Evaluasi dilakukan dengan pre-test dan post-test yang dianalisis menggunakan uji paired T-test. Hasil menunjukkan adanya peningkatan signifikan pada skor pengetahuan guru setelah pelatihan (p=0,021), dengan rata-rata peningkatan 4,83 poin. Analisis kualitatif juga memperlihatkan partisipasi aktif, sikap positif terhadap penerapan diet GFCF, serta kepuasan tinggi terhadap proses pelatihan. Kegiatan ini merupakan pelatihan pertama di Indonesia yang menggunakan pendekatan model ADDIE untuk meningkatkan kapasitas guru SLB dalam menerapkan diet GFCF secara terstruktur. Temuan ini menunjukkan bahwa pelatihan terstruktur efektif meningkatkan kapasitas guru dalam mendukung tatalaksana holistik anak dengan ASD, sekaligus berkontribusi pada pengembangan ilmu pengetahuan terapan di bidang pendidikan khusus dan pencapaian Sustainable Development Goals (SDGs), khususnya pada aspek kesehatan dan pendidikan berkualitas. Enhancing Special School Teachers’ Capacity on Gluten Free Casein Free (GFCF) Diet for Children with Autism Spectrum Disorder Abstract One of the non-pharmacological interventions for children with Autism Spectrum Disorder (ASD) is the Gluten Free Casein Free (GFCF) diet; however, teachers in special schools (SLB) still have very limited knowledge about this dietary approach. This community service program aimed to improve teachers’ understanding of the concept and implementation of the GFCF diet in schools. The method used was training based on the ADDIE model (Analysis, Design, Development, Implementation, Evaluation), involving 29 special elementary school teachers. Evaluation was carried out using pre- and post-tests analyzed with a paired t-test. The results showed a significant increase in teachers’ knowledge scores after the training (p=0.021), with an average improvement of 4.83 points. Qualitative analysis also revealed active participation, positive attitudes toward the application of the GFCF diet, and high satisfaction with the training process. These findings demonstrate that structured training is effective in enhancing teachers’ capacity to support the holistic management of children with ASD, while also contributing to the advancement of applied science in special education and the achievement of the Sustainable Development Goals (SDGs), particularly in the areas of health and quality education.
Integrasi Edukasi Manajemen Stress Berbasis Flipbook dan Medical Check-Up untuk Pekerja Migran Wanita Indonesia di Singapura Weningtyas, Anditri; Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Iftitahurroza, Hilma Tsurayya; Wiratama, Arif Ladika; Bakhtiar, Fannia Yosa; Putri, Adhiena Liany Anastasia
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20348

Abstract

Background: Pekerja migran wanita Indonesia di Singapura menghadapi berbagai permasalahan kesehatan mental dan fisik akibat tekanan kerja tinggi serta keterbatasan akses layanan kesehatan. Program ini bertujuan mengevaluasi efektivitas program manajemen stres menggunakan media flipbook yang terintegrasi dengan Medical Check-Up gratis bagi pekerja migran wanita Indonesia di Singapura. Metode: Metode penelitian menggunakan pendekatan Asset-Based Community Development dengan desain pre-post-test yang melibatkan 221 partisipan. Intervensi berupa edukasi manajemen stres melalui flipbook dan pemeriksaan kesehatan komprehensif meliputi antropometri, tekanan darah, gula darah, dan penilaian kesehatan mental menggunakan Kessler-10. Data dianalisis menggunakan uji Wilcoxon dengan tingkat signifikansi 95%. Hasil: Terdapat peningkatan pengetahuan yang signifikan dari pre-test 9,52 menjadi post-test 16,68 dengan selisih rata-rata 7,15 poin. Medical check-up menunjukkan bahwa 70,1 persen partisipan berisiko tinggi gangguan mental, 38,0 persen mengalami diabetes, dan 17,6 persen hipertensi. Kesimpulan: Program ini terbukti efektif meningkatkan pengetahuan manajemen stres secara menyeluruh pada seluruh partisipan. Integrasi manajemen stres dengan Medical Check-Up memberikan solusi komprehensif untuk mengatasi permasalahan kesehatan pekerja migran wanita Indonesia di Singapura.
Guru Cermat, Anak Hebat: Peningkatan Kapasitas Guru PAUD melalui Pelatihan Skrining Tumbuh Kembang di TK Muslimat NU 27 Malang Iftitahurroza, Hilma Tsurayya; Widya Sishartami, Lintang; Ariesaka, Kiky Martha; Weningtyas, Anditri; Kurniawati, Andini; Qurrataa'ayun, Ahmad Al; Aulia, Sabrina; Auliarahama, Zhafirah; Manggolono, Lintang Nirmalasari Gemalochaya
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20867

Abstract

Background: Early childhood is a golden period of growth and development that serves as the foundation for the quality of human resources in the future. Developmental screening in early childhood is crucial to detect growth and developmental disorders at an early stage. Early Childhood Education (ECE) teachers play a strategic role in conducting screenings within educational institutions. However, limited teacher capacity in performing developmental screenings often becomes a challenge. Methods: The program was conducted using a training approach designed based on the ADDIE model. The effectiveness of the training was evaluated by comparing the participants’ pre-test and post-test scores. Results: The activity was implemented at TK Muslimat NU 27 Malang and was attended by 12 participants, all of whom were PAUD teachers. The results showed a significant improvement in teachers’ knowledge and skills based on pre-test and post-test outcomes, as well as increased confidence in conducting growth and development screening in schools. Conclusion: This activity improved teachers’ capacity in children growth and development screening; however, further monitoring and evaluation of implementation are needed.
Bioinformatics study of the a222v substitution in sars-cov-2 spike protein Ariesaka, Kiky Martha; Nuryady, Moh Mirza; Rini, Ika Agus
Sains Medika: Jurnal Kedokteran dan Kesehatan Vol 16, No 2 (2025): December 2025
Publisher : Faculty of Medicine, Universitas Islam Sultan Agung (UNISSULA), Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30659/sainsmed.v16i2.39242

Abstract

COVID-19, caused by SARS-CoV-2, has infected over 200 million people and caused 4.3 million deaths globally, with over 3.7 million cases and 110,000 deaths in Indonesia. SARS-CoV-2, a single-stranded RNA virus, has a genome encoding proteins such as Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N). The S protein, comprising S1 and S2 domains, facilitates ACE2 receptor binding and membrane fusion. This study examines the phylogenetic relationship of the A222V substitution in the S protein with various global isolates. We collected 25 complete SARS-CoV-2 sequences from the GISAID database, performed multiple sequence alignments using Clustal W in MEGA-X software, and constructed phylogenetic trees using the neighbor-joining method. The urgency of this paper lies in understanding the impact of the A222V mutation on the virus's infectivity and spread, which is crucial for developing targeted treatments and vaccines. The A222V variant, first identified in Spain in summer 2020, has spread rapidly across Europe, raising concerns about its potential to increase transmissibility or affect vaccine efficacy. The A222V variant likely affects protein conformation or stability rather than receptor binding or membrane fusion. Understanding these changes is essential as it can influence the virus's behavior and efficacy of public health interventions. The study found high mutation rates in the S gene with diverse point mutations. Phylogenetic analysis revealed that A222V isolates clustered closely with D614G variants. In conclusion, not all mutations result in amino acid changes, and A222V has minimal impact on ACE2 binding but may influence protein stability.
Formulation and Characterization Profile of Sugarcane (Saccharum officinarum L.) Leaf Extract Emulsion Sishartami, Lintang Widya; Weningtyas, Anditri; Ariesaka, Kiky Martha; Wiratama, Arif Ladika; Wibisono, Taurisma Aulia Nanda
Jurnal Biologi Tropis Vol. 25 No. 4b (2025): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4b.10932

Abstract

Sugarcane (Saccharum officinarum L.) leaves contain various bioactive compounds, which exhibit antioxidant and pharmacological potential. However, their application in pharmaceutical preparations faces challenges due to low solubility, stability, and bioavailability. Therefore, the development of an emulsion formulation is needed to improve its stability and absorption. This study aims to determine the phytochemical content of sugarcane leaf extract and to evaluate the physical stability of its emulsion formulation. The extraction was obtained through maceration using 96% ethanol, followed by phytochemical screening. Emulsions were prepared using sugarcane leaf extract as the active ingredient, Virgin Coconut Oil (VCO) as the oil phase, Tween 80 as a surfactant, and PEG 400 as a co-surfactant. The formulations were tested for organoleptic properties, emulsion type, percent transmittance, pH, particle size, polydispersity index, zeta potential, centrifugation, and cycling stability. The results showed that sugarcane leaf extract contained flavonoids, alkaloids, tannins, phenols, triterpenoids, and saponins. Among the four tested formulas, F1 and F2 showed the best stability, with pH 6–7, high percent transmittance, uniform particle size with polydispersity index <0.3, and absence of phase separation. These findings suggest that F1 and F2 represent optimal emulsion formulations for further pharmaceutical development.
SANTERA (Santri Sehat Terawat): Edukasi Penyakit Menular Berbasis Lingkungan dan Gaya Hidup Sehat bagi Santri Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Weningtyas, Anditri; Iftitahurroza, Hilma Tsurayya; Ismaya, Matius Dimas Reza Dana; Wiratama, arif Ladika; Wibisono, Taurisma Aulia Nanda; Bakhtiar, Fannia Yosa
Jurnal Mandala Pengabdian Masyarakat Vol. 6 No. 2 (2025): Jurnal Mandala Pengabdian Masyarakat
Publisher : Progran Studi Farmasi Universitas Mandala Waluya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35311/jmpm.v6i2.672

Abstract

Lingkungan pesantren yang padat dan komunal menyebabkan santri rentan terhadap penyakit menular serta gaya hidup tidak sehat. Berdasarkan hasil wawancara dengan guru, ditemukan masalah kesehatan yang dominan seperti skabies, diare, serta kelelahan akibat kebiasaan menahan buang air besar dan melewatkan sarapan. Tujuan dari kegiatan ini adalah untuk meningkatkan pengetahuan dan kesadaran santri mengenai pentingnya kebersihan diri dan gaya hidup sehat melalui edukasi kesehatan kontekstual. Kegiatan dilaksanakan dalam tiga tahap kunjungan dan menggunakan pendekatan model ADDIE yang mencakup analisis kebutuhan, perancangan materi, pengembangan media edukatif berupa presentasi dan flyer, pelaksanaan edukasi secara interaktif kepada santri, serta evaluasi menggunakan kuesioner kepuasan. Hasil menunjukkan bahwa seluruh indikator kepuasan memperoleh skor rerata tinggi, berkisar antara 76,5% hingga 83%, dengan kategori sangat baik. Selain itu, peserta menunjukkan antusiasme dan partisipasi aktif selama sesi edukasi, serta adanya niat untuk menerapkan dan menyebarluaskan informasi yang diperoleh. Tim pengabdian juga memberikan dukungan fasilitas kesehatan berupa alat kebersihan, alat pemeriksaan sederhana, dan obat-obatan umum yang dibutuhkan oleh Unit Kesehatan Pesantren. Kegiatan ini memberikan dampak positif jangka pendek dalam hal peningkatan pengetahuan dan kesadaran, serta memperkuat kapasitas kelembagaan dalam menjaga kesehatan santri. Oleh karena itu, program ini dinilai berhasil mencapai tujuannya dan berpotensi untuk direplikasi di lingkungan pesantren lainnya dengan penyesuaian konteks lokal.
Co-Authors Agil Wahyu Wicaksono Agung Kurniawan Ain Yuanita Insani Ain Yuanita Insani Al Munawir Aldina, Siti Nur Anditri Weningtyas Andreas Budi Wijaya Ardhanu Kusumanto Arif Ladika Aulia, Sabrina Auliarahama, Zhafirah Auliarahma, Zhafirah Azka Darajat Bakhtiar, Fannia Yosa Brilliant Givya Ariansari Brilliant Givya Ariansari Devi, Athaayaa Nastiti Ulayya Diani Fatmawati Editya Fukata Elly Purwanti Erfan Efendi Fanani, Erianto Fannia Yosa Bakhtiar Faridatus Solikha Fatmawati, Diani Fuad Adi Prasetyo Fuad Adi Prasetyo Fuad Jaya Miharja Fulviansyah, Zaidhan Lucano Ganes, Tegar Gelaner, Nauval Akhmadian Haryono, Putri Dwinita Hilda Khairinnisa Hilma Tsurayya Iftitahurroza Iftitahurroza, Hilma Tsurayya Ika Agus Rini, Ika Agus Ika Rahmawati Sutejo Ika Wahyuni Inggita Utami Ismaya, Matius Dimas Reza Dana Janufian, Fairus Athar Juliana, Imelda Juliana, Levina Imelda Khodijah Khodijah Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul KURNIAWATI, ANDINI Levina Levina, Levina Lintang Widya Sishartami Lintang Widya Sishartami Maliza, Rita Manggolono, Lintang Nirmalasari Gemalochaya Mochammad Yunus, Mochammad Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mudzakir Taufiqurrahman Mudzakkir Taufiqurrahman Mudzakkir Taufiqurrqhman Nanang Tri Wahyudi Nazila, Farah Nungki Anggorowati Prasetya, Ahmada Viosepta Prayogi, Fahrizal Ryuzen Purwanti, Elly Putra, Alvino Ramadhany Putri, Adhiena Liany Anastasia Putri, Angelica Igsanti Qurrataa'ayun, Ahmad Al Qurrataa'yun, Ahmad Al Siti Nur Aldina Sri Wahyuni Sri Wahyuni Suhartanti, Ajeng Sri Susetyarini, Rr Eko Tsaqif, Anindya Zerlina Tutut Indria Permana Ulfa, Darlah Immaria Wahyu Dian Puspita Wahyuni, Sri Wibisono, Taurisma Aulia Nanda Widya Sishartami, Lintang Wiratama, Arif Ladika Zakiyatul Khoiriyah Zucha, Muhammad Ary