Article Per Year (5 Year)
p-Index From 2021 - 2026
3.116
P-Index
This Author published in this journals
All Journal Jurnal Ilmu Dasar AL KAUNIYAH Indonesian Journal of Cancer Chemoprevention UNEJ e-Proceeding Jurnal ORTOPEDAGOGIA BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) Jurnal SOLMA Jurnal Biologi Tropis Jurnal Biolokus: Jurnal Penelitian Pendidikan Biologi dan Biologi INDONESIAN JOURNAL OF MEDICAL LABORATORY SCIENCE AND TECHNOLOGY Jurnal Mandala Pengabdian Masyarakat Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat EduInovasi: Journal of Basic Educational Studies Sasambo: Jurnal Abdimas (Journal of Community Service) Jurnal Kesehatan Masyarakat NurseLine Journal
Kiky Martha Ariesaka
Universitas Negeri Malang
Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Control & Systems Engineering Education Environmental Science Health Professions Immunology & microbiology Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Public Health Social Sciences Other

Published : 23 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 23 Documents
Search

 1   2   3 
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Pemberian Senam Low Impact untuk Meningkatkan Kesehatan Reproduksi bagi Remaja Siswa-Siswi SMAN 7 Malang Hilma Tsurayya Iftitahurroza; Anditri Weningtyas; Kiky Martha Ariesaka; Lintang Widya Sishartami; Arif Ladika; Faridatus Solikha; Fannia Yosa Bakhtiar
EduInovasi:  Journal of Basic Educational Studies Vol. 4 No. 3 (2024): EduInovasi:  Journal of Basic Educational Studies
Publisher : Intitut Agama Islam Nasional Laa Roiba Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47467/edu.v4i3.4413

Abstract

Adolescent reproductive health is a crucial aspect in the development of the quality of life for young generations. This community service activity aims to evaluate the effectiveness of low-impact exercise in improving reproductive health among students of SMAN 7 Malang. The method used is a participatory approach with low-impact exercise training conducted over 12 weeks. A total of 120 randomly selected students participated in this program. Reproductive health data were collected through questionnaires before and after the intervention, covering aspects such as knowledge of reproductive health, healthy living habits, and the frequency of reproductive health symptoms. Evaluation results showed a significant increase in participants' reproductive health scores after participating in the low-impact exercise program. The conclusion of this activity indicates that low-impact exercise can be an effective method in school reproductive health education programs. It is hoped that this program can be implemented routinely and become part of the physical education curriculum to improve adolescent reproductive health.
Peningkatan Kapasitas Guru Sekolah Luar Biasa tentang Diet Gluten Free Casein Free (GFCF) pada Anak dengan Autism Spectrum Disorder Kurniawan, Agung; Fukata, Editya; Ariesaka, Kiky Martha; Wijaya, Andreas Budi; Putri, Angelica Igsanti; Prasetya, Ahmada Viosepta; Devi, Athaayaa Nastiti Ulayya; Putra, Alvino Ramadhany; Khodijah, Khodijah; Auliarahma, Zhafirah
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 10 No. 4 (2025): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/dfr7v968

Abstract

Salah satu intervensi non-farmakologis pada anak dengan Autism Spectrum Disorder (ASD) adalah diet Gluten Free Casein Free (GFCF), namun pengetahuan guru Sekolah Luar Biasa (SLB) tentang diet ini masih sangat terbatas. Program pengabdian ini bertujuan meningkatkan pemahaman guru mengenai konsep dan implementasi diet GFCF di sekolah. Metode yang digunakan adalah pelatihan berbasis model ADDIE (Analysis, Design, Development, Implementation, Evaluation) yang melibatkan 29 guru SDLB melalui pendekatan partisipatif. Evaluasi dilakukan dengan pre-test dan post-test yang dianalisis menggunakan uji paired T-test. Hasil menunjukkan adanya peningkatan signifikan pada skor pengetahuan guru setelah pelatihan (p=0,021), dengan rata-rata peningkatan 4,83 poin. Analisis kualitatif juga memperlihatkan partisipasi aktif, sikap positif terhadap penerapan diet GFCF, serta kepuasan tinggi terhadap proses pelatihan. Kegiatan ini merupakan pelatihan pertama di Indonesia yang menggunakan pendekatan model ADDIE untuk meningkatkan kapasitas guru SLB dalam menerapkan diet GFCF secara terstruktur. Temuan ini menunjukkan bahwa pelatihan terstruktur efektif meningkatkan kapasitas guru dalam mendukung tatalaksana holistik anak dengan ASD, sekaligus berkontribusi pada pengembangan ilmu pengetahuan terapan di bidang pendidikan khusus dan pencapaian Sustainable Development Goals (SDGs), khususnya pada aspek kesehatan dan pendidikan berkualitas. Enhancing Special School Teachers’ Capacity on Gluten Free Casein Free (GFCF) Diet for Children with Autism Spectrum Disorder Abstract One of the non-pharmacological interventions for children with Autism Spectrum Disorder (ASD) is the Gluten Free Casein Free (GFCF) diet; however, teachers in special schools (SLB) still have very limited knowledge about this dietary approach. This community service program aimed to improve teachers’ understanding of the concept and implementation of the GFCF diet in schools. The method used was training based on the ADDIE model (Analysis, Design, Development, Implementation, Evaluation), involving 29 special elementary school teachers. Evaluation was carried out using pre- and post-tests analyzed with a paired t-test. The results showed a significant increase in teachers’ knowledge scores after the training (p=0.021), with an average improvement of 4.83 points. Qualitative analysis also revealed active participation, positive attitudes toward the application of the GFCF diet, and high satisfaction with the training process. These findings demonstrate that structured training is effective in enhancing teachers’ capacity to support the holistic management of children with ASD, while also contributing to the advancement of applied science in special education and the achievement of the Sustainable Development Goals (SDGs), particularly in the areas of health and quality education.
Integrasi Edukasi Manajemen Stress Berbasis Flipbook dan Medical Check-Up untuk Pekerja Migran Wanita Indonesia di Singapura Weningtyas, Anditri; Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Iftitahurroza, Hilma Tsurayya; Wiratama, Arif Ladika; Bakhtiar, Fannia Yosa; Putri, Adhiena Liany Anastasia
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20348

Abstract

Background: Pekerja migran wanita Indonesia di Singapura menghadapi berbagai permasalahan kesehatan mental dan fisik akibat tekanan kerja tinggi serta keterbatasan akses layanan kesehatan. Program ini bertujuan mengevaluasi efektivitas program manajemen stres menggunakan media flipbook yang terintegrasi dengan Medical Check-Up gratis bagi pekerja migran wanita Indonesia di Singapura. Metode: Metode penelitian menggunakan pendekatan Asset-Based Community Development dengan desain pre-post-test yang melibatkan 221 partisipan. Intervensi berupa edukasi manajemen stres melalui flipbook dan pemeriksaan kesehatan komprehensif meliputi antropometri, tekanan darah, gula darah, dan penilaian kesehatan mental menggunakan Kessler-10. Data dianalisis menggunakan uji Wilcoxon dengan tingkat signifikansi 95%. Hasil: Terdapat peningkatan pengetahuan yang signifikan dari pre-test 9,52 menjadi post-test 16,68 dengan selisih rata-rata 7,15 poin. Medical check-up menunjukkan bahwa 70,1 persen partisipan berisiko tinggi gangguan mental, 38,0 persen mengalami diabetes, dan 17,6 persen hipertensi. Kesimpulan: Program ini terbukti efektif meningkatkan pengetahuan manajemen stres secara menyeluruh pada seluruh partisipan. Integrasi manajemen stres dengan Medical Check-Up memberikan solusi komprehensif untuk mengatasi permasalahan kesehatan pekerja migran wanita Indonesia di Singapura.
Guru Cermat, Anak Hebat: Peningkatan Kapasitas Guru PAUD melalui Pelatihan Skrining Tumbuh Kembang di TK Muslimat NU 27 Malang Iftitahurroza, Hilma Tsurayya; Widya Sishartami, Lintang; Ariesaka, Kiky Martha; Weningtyas, Anditri; Kurniawati, Andini; Qurrataa'ayun, Ahmad Al; Aulia, Sabrina; Auliarahama, Zhafirah; Manggolono, Lintang Nirmalasari Gemalochaya
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20867

Abstract

Background: Early childhood is a golden period of growth and development that serves as the foundation for the quality of human resources in the future. Developmental screening in early childhood is crucial to detect growth and developmental disorders at an early stage. Early Childhood Education (ECE) teachers play a strategic role in conducting screenings within educational institutions. However, limited teacher capacity in performing developmental screenings often becomes a challenge. Methods: The program was conducted using a training approach designed based on the ADDIE model. The effectiveness of the training was evaluated by comparing the participants’ pre-test and post-test scores. Results: The activity was implemented at TK Muslimat NU 27 Malang and was attended by 12 participants, all of whom were PAUD teachers. The results showed a significant improvement in teachers’ knowledge and skills based on pre-test and post-test outcomes, as well as increased confidence in conducting growth and development screening in schools. Conclusion: This activity improved teachers’ capacity in children growth and development screening; however, further monitoring and evaluation of implementation are needed.
Formulation and Characterization Profile of Sugarcane (Saccharum officinarum L.) Leaf Extract Emulsion Sishartami, Lintang Widya; Weningtyas, Anditri; Ariesaka, Kiky Martha; Wiratama, Arif Ladika; Wibisono, Taurisma Aulia Nanda
Jurnal Biologi Tropis Vol. 25 No. 4b (2025): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i4b.10932

Abstract

Sugarcane (Saccharum officinarum L.) leaves contain various bioactive compounds, which exhibit antioxidant and pharmacological potential. However, their application in pharmaceutical preparations faces challenges due to low solubility, stability, and bioavailability. Therefore, the development of an emulsion formulation is needed to improve its stability and absorption. This study aims to determine the phytochemical content of sugarcane leaf extract and to evaluate the physical stability of its emulsion formulation. The extraction was obtained through maceration using 96% ethanol, followed by phytochemical screening. Emulsions were prepared using sugarcane leaf extract as the active ingredient, Virgin Coconut Oil (VCO) as the oil phase, Tween 80 as a surfactant, and PEG 400 as a co-surfactant. The formulations were tested for organoleptic properties, emulsion type, percent transmittance, pH, particle size, polydispersity index, zeta potential, centrifugation, and cycling stability. The results showed that sugarcane leaf extract contained flavonoids, alkaloids, tannins, phenols, triterpenoids, and saponins. Among the four tested formulas, F1 and F2 showed the best stability, with pH 6–7, high percent transmittance, uniform particle size with polydispersity index <0.3, and absence of phase separation. These findings suggest that F1 and F2 represent optimal emulsion formulations for further pharmaceutical development.
SANTERA (Santri Sehat Terawat): Edukasi Penyakit Menular Berbasis Lingkungan dan Gaya Hidup Sehat bagi Santri Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Weningtyas, Anditri; Iftitahurroza, Hilma Tsurayya; Ismaya, Matius Dimas Reza Dana; Wiratama, arif Ladika; Wibisono, Taurisma Aulia Nanda; Bakhtiar, Fannia Yosa
Jurnal Mandala Pengabdian Masyarakat Vol. 6 No. 2 (2025): Jurnal Mandala Pengabdian Masyarakat
Publisher : Progran Studi Farmasi Universitas Mandala Waluya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35311/jmpm.v6i2.672

Abstract

Lingkungan pesantren yang padat dan komunal menyebabkan santri rentan terhadap penyakit menular serta gaya hidup tidak sehat. Berdasarkan hasil wawancara dengan guru, ditemukan masalah kesehatan yang dominan seperti skabies, diare, serta kelelahan akibat kebiasaan menahan buang air besar dan melewatkan sarapan. Tujuan dari kegiatan ini adalah untuk meningkatkan pengetahuan dan kesadaran santri mengenai pentingnya kebersihan diri dan gaya hidup sehat melalui edukasi kesehatan kontekstual. Kegiatan dilaksanakan dalam tiga tahap kunjungan dan menggunakan pendekatan model ADDIE yang mencakup analisis kebutuhan, perancangan materi, pengembangan media edukatif berupa presentasi dan flyer, pelaksanaan edukasi secara interaktif kepada santri, serta evaluasi menggunakan kuesioner kepuasan. Hasil menunjukkan bahwa seluruh indikator kepuasan memperoleh skor rerata tinggi, berkisar antara 76,5% hingga 83%, dengan kategori sangat baik. Selain itu, peserta menunjukkan antusiasme dan partisipasi aktif selama sesi edukasi, serta adanya niat untuk menerapkan dan menyebarluaskan informasi yang diperoleh. Tim pengabdian juga memberikan dukungan fasilitas kesehatan berupa alat kebersihan, alat pemeriksaan sederhana, dan obat-obatan umum yang dibutuhkan oleh Unit Kesehatan Pesantren. Kegiatan ini memberikan dampak positif jangka pendek dalam hal peningkatan pengetahuan dan kesadaran, serta memperkuat kapasitas kelembagaan dalam menjaga kesehatan santri. Oleh karena itu, program ini dinilai berhasil mencapai tujuannya dan berpotensi untuk direplikasi di lingkungan pesantren lainnya dengan penyesuaian konteks lokal.
Transformasi Perilaku Hidup Bersih dan Sehat Melalui Model Edukasi Berbasis Komunitas di Pondok Pesantren Nurul Ulum Putri Malang Iftitahurroza, Hilma Tsurayya; Sishartami, Lintang Widya; Ariesaka, Kiky Martha; Weningtyas, Anditri; Kurniawati, Andini; Qurrataa'yun, Ahmad Al; Aulia, Sabrina; Auliarahma, Zhafirah; Manggolono, Lintang Nirmalasari Gemalochaya
Jurnal SOLMA Vol. 15 No. 1 (2026)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v15i1.21347

Abstract

Pendahuluan: Pondok pesantren memiliki peran strategis dalam membentuk karakter dan perilaku santri, namun kondisi kesehatan di lingkungan pesantren masih memerlukan perhatian, terutama terkait penerapan Perilaku Hidup Bersih dan Sehat (PHBS). Di Pondok Pesantren Nurul Ulum Putri Malang, masih ditemukan rendahnya pemahaman dan praktik PHBS di kalangan santri, sehingga diperlukan upaya edukasi yang kontekstual dan partisipatif. Metode: Ceramah interaktif, diskusi, demonstrasi praktik, dan pendampingan kader santri sehat. Hasil: Nilai rata-rata pretest sebesar 78,63 meningkat menjadi 87,87 pada postest, dengan nilai p = 1,0059 × 10⁻⁵ (p < 0,001), menunjukkan peningkatan signifikan pengetahuan santri setelah edukasi. Santri menunjukkan antusiasme tinggi dan mulai menerapkan perilaku sehat seperti menjaga kebersihan diri, lingkungan, dan sanitasi. Kesimpulan: Edukasi PHBS berbasis komunitas terbukti efektif meningkatkan pengetahuan dan sikap santri terhadap perilaku hidup bersih dan sehat di pesantren.
Pendampingan Pengolahan Produk Kreatif Resin Berbahan Anggrek sebagai Kerajinan Tangan Masyarakat Desa Dadaprejo, Kota Batu Nuryady, Mohammad Mirza; Permana, Tutut Indria; Fatmawati, Diani; Levina, Levina; Juliana, Imelda; Janufian, Fairus Athar; Ariesaka, Kiky Martha
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 8 No. 2 (2026): Mei
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/4km80049

Abstract

Pandemi Covid-19 memberikan dampak yang luar biasa terhadap kehidupan sosial bermasyarakat utamanya di sektor ekonomi. Industri Ekonomi kreatif memiliki peran yang sangat besar dalam roda perekonomian, oleh karena itu dibutuhkan upaya untuk mendukung ekonomi kreatif warga. Desa wisata anggrek Dadaprejo terkenal dengan tumbuhan anggreknya, umumnya bunga anggrek akan gugur dan menjadi limbah dalam beberapa minggu. Hal ini menjadi peluang agar bunga anggrek tetap dapat memiliki nilai ekonomis dengan dijadikan kerjainan tangan berupa resin anggrek. Kegiatan ini bertujuan untuk melatih warga agar dapat memanfaatkan bunga anggrek sebelum menjadi limbah untuk dimanfaatkan menjadi produk kerajinan tangan yang dapat membantu perekonomian warga. Target dari kegiatan ini adalah pertama masyarakat di sekitar wisata anggrek dapat memanfaatkan sumber daya yang ada untuk dijadikan produk kerajinan kreatif untuk meningkatkan ekonomi serta dengan adanya kerajinan tangan tersebut dapat semakin mendukung wisata desa anggrek. Hasil kegiatan ini terdapat kelompok masyarakat yang berhasil menjadikan resin anggrek ini sebagai usaha yang berkelanjutan dengan penjualan di bulan pertama mencapai dua kali lipat modal awal. Selain itu pemahaman masyarakat tentang industry kreatif serta pengetahuan tentang pengolahan resin sebagai kerajinan tangan menunjukkan adanya peningkatan pemahaman. Assistance in Processing Creative Orchid Resin Products as Handicrafts for the Dadaprejo Village Community, Batu City The Covid-19 pandemic has had a tremendous impact on social life, especially in the economic sector. The creative economy industry has a very large role in the economy; therefore, efforts are needed to support the citizens' creative economy. The Dadaprejo Orchid Tourism Village is famous for its orchid plants, mostly orchids fall and become waste within a few weeks. This is an opportunity so that orchids can still have economic value by being made into hands in the form of orchid resin. This activity aims to train residents to be able to use orchids before they become waste to be used as handicraft products that can help the local economy. The target of this activity is first that the community around orchid tourism can take advantage of existing resources to be used as creative craft products to improve the economy and with these handicrafts they can support orchid village tourism. As a result of this activity, there were community groups who succeeded in making this orchid resin a sustainable business with sales in the first month reaching double the initial capital. In addition, the public's understanding of the creative industry as well as about resin processing as a handicraft shows an increase in understanding.
Expression of gonadotropin-releasing hormone receptor type-II correlates with proliferation activity in tissue microarray of rare ovarian tumor Kiky Martha Ariesaka; Ardhanu Kusumanto; Muhammad Ary Zucha; Nungki Anggorowati; Agil Wahyu Wicaksono; Moch Yunus; Erianto Fanani; Moh Mirza Nuryady
JURNAL INDONESIA DARI ILMU LABORATORIUM MEDIS DAN TEKNOLOGI Vol 6 No 2 (2024): Promising and Valuable Research Towards Diagnosis, Prognosis and Treatment of Dis
Publisher : Universitas Nahdlatul Ulama Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/ijmlst.v6i2.6034

Abstract

Activation of Gonadotropin-Releasing Hormone type II Receptors (GnRHR-II) exhibits antiproliferative activity. GnRHR-II is not only expressed exclusively in the pituitary, but also in a variety of tumors. To date, the clinical relevance of GnRHR-II in ovarian tumors is unclear. In addition, there is a lack of literature addressing GnRHR-II in ovarian tumors, especially rare types. This study was conducted to investigare the correlation between GnRHR-II expression with clinicopathology and proliferative activity of rare ovarian tumors. The purpose of this study was an analytic observational study with a cross-sectional design that utilized 18 ovarian tumor samples on tissue microarray (TMA). The expression of GnRHR-II and Ki67 was assessed using immunohistochemical staining (IHC) and observed using the IHC profiler plugin ImageJ software to obtain their respective H-scores. The data was analyzed using independent t-test, ANOVA, Pearson's test, and Fisher's exact test based on data types. The value of p<0.05 was considered statistically significant. GnRHR-II is expressed in various forms in ovarian tumors, including extrapituitary expression. GnRHR-II expression was highest in the sex cord stromal tumor (SCST) group, 110.30 ± 23.89 (p<0.0001). In addition, there was also a significant difference between GnRHR-II expression with age (p<0.001) and the primary tumor (p<0.05), but not with tumor type (p=0.101). There is a correlation between GnRHR-II expression and proliferative activity (r=-0.043, p=0.866). Elevated GnRHR-II expression is significantly correlation with SCST, individuals over 40 years of age, and tumors confined to the ovary and it is correlates with lower proliferative activity, although this correlation is very weak.
Co-Authors Agil Wahyu Wicaksono Agung Kurniawan Ahnaf, Ahmad Baihaqi Ain Yuanita Insani Ain Yuanita Insani Ain Yuanita Insani Al Munawir Aldina, Siti Nur Anditri Weningtyas Andreas Budi Wijaya Ardhanu Kusumanto Arif Ladika Aulia, Sabrina Auliarahama, Zhafirah Auliarahma, Zhafirah Azka Darajat Bakhtiar, Fannia Yosa Brilliant Givya Ariansari Brilliant Givya Ariansari Brilliant Givya Ariansari Devi, Athaayaa Nastiti Ulayya Diani Fatmawati Editya Fukata Elly Purwanti Erfan Efend Erfan Efendi Fanani, Erianto Fannia Yosa Bakhtiar Faridatus Solikha Fatmawati, Diani Fuad Adi Prasetyo Fuad Adi Prasetyo Fuad Adi Prasetyo Fuad Jaya Miharja Fulviansyah, Zaidhan Lucano Ganes, Tegar Gelaner, Nauval Akhmadian Haliza, Septiana Nur Haryono, Putri Dwinita Hilda Khairinnisa Hilma Tsurayya Iftitahurroza Iftitahurroza, Hilma Tsurayya Ika Rahmawati Sutejo Ika Wahyuni Inggita Utami Ismaya, Matius Dimas Reza Dana Janufian, Fairus Athar Juliana, Imelda Juliana, Levina Imelda Khodijah Khodijah Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul KURNIAWATI, ANDINI Levina Levina, Levina Lintang Widya Sishartami Lintang Widya Sishartami Maliza, Rita Manggolono, Lintang Nirmalasari Gemalochaya Mochammad Yunus, Mochammad Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Moh. Mirza Nuryady Mudzakir Taufiqurrahman Mudzakir Taufiqurrahman Mudzakkir Taufiqurrahman Mudzakkir Taufiqurrqhman Muhammad Ary Zucha Nanang Tri Wahyudi Nazila, Farah Nungki Anggorowati Nurbin, Afif Radika Prasetya, Ahmada Viosepta Purwanti, Elly Putra, Alvino Ramadhany Putri, Adhiena Liany Anastasia Putri, Angelica Igsanti Qurrataa'ayun, Ahmad Al Qurrataa'yun, Ahmad Al Sajidah, Akifah Hanin Najwa Siti Nur Aldina Sri Wahyuni Sri Wahyuni Suhartanti, Ajeng Sri Susetyarini, Rr Eko Tutut Indria Permana Ulfa, Darlah Immaria Wahyu Dian Puspita Wibisono, Taurisma Aulia Nanda Widya Sishartami, Lintang Wiratama, Arif Ladika Zakiyatul Khoiriyah