Article Per Year (5 Year)
p-Index From 2021 - 2026
2.608
P-Index
This Author published in this journals
All Journal SAINS MEDIKA : JURNAL KEDOKTERAN DAN KESEHATAN Jurnal Ilmu Dasar AL KAUNIYAH Indonesian Journal of Cancer Chemoprevention UNEJ e-Proceeding Jurnal ORTOPEDAGOGIA BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) NurseLine Journal Jurnal SOLMA Jurnal Biolokus: Jurnal Penelitian Pendidikan Biologi dan Biologi Buletin Ilmiah Nagari Membangun INDONESIAN JOURNAL OF MEDICAL LABORATORY SCIENCE AND TECHNOLOGY Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Livestock and Animal Research EduInovasi: Journal of Basic Educational Studies Jurnal Kesehatan Masyarakat
Kiky Martha Ariesaka
Universitas Negeri Malang
Religion Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Control & Systems Engineering Economics, Econometrics & Finance Education Engineering Environmental Science Health Professions Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Public Health Social Sciences Veterinary Other

Published : 21 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 21 Documents
Search

 1   2   3 
Enhancement of Teachers' Knowledge in Gamification for Improving Reading Skills in Students with Autism Spectrum Disorder Kurniawan, Agung; Ariesaka, Kiky Martha; Fukata, Editya; Wijaya, Andreas Budi; Putri, Angelica Igsanti; Prasetya, Ahmada Viosepta; Devi, Athaayaa Nastiti Ulayya
Jurnal ORTOPEDAGOGIA Vol 10, No 2 (2024): November
Publisher : Universitas Negeri Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17977/um031v10i22024p75-82

Abstract

Autism Spectrum Disorder (ASD) is a developmental disorder characterized by challenges with social interaction, communication, and repetitive behaviors. Students with ASD often struggle with reading skills due to deficits in language comprehension, attention, and social communication. Gamification, applying game-design elements in non-game contexts, has emerged as a promising approach to enhance learning for these students. This study aimed to develop and implement a gamification-based learning application to improve the reading skills of students with ASD in special schools. The initiative sought to empower teachers through comprehensive training and support, enabling them to effectively use gamified educational tools. The method followed the ADDIE model: Analysis involved a needs assessment; Design included creating a training program and evaluation instruments; Development involved creating training materials and preparing for pilot testing; Implementation included conducting the training for teacher and administering pre-tests and post-tests; Evaluation consisted of analyzing test data and feedback. The training session was conducted on July 17, 2024, at SLB Autis Lab UM. Paired t-test results showed a significant increase in mean scores from pre-test (78.67±11.87) to post-test (88.00±10.14), with a P-value of 0.014, indicating effective training. Participant feedback highlighted the gamification application’s appealing interface, ease of use, and positive impact on student motivation, participation, and reading skills. The gamification-based learning application effectively improves reading skills in students with ASD and enhances teachers’ knowledge and skills in using such tools. Ongoing support and professional development for educators are crucial for integrating innovative tools into teaching practices, fostering academic success and overall development for students with ASD.
IN SILICO AND IN VITRO ANALYSIS OF BLASHV AND BLATEM GENE PRIMERS Khoiro, Aisha Azaria Nisa’ul; Purwanti, Elly; Miharja, Fuad Jaya; Ariesaka, Kiky Martha; Nuryady, Moh. Mirza
BIOLINK (Jurnal Biologi Lingkungan Industri Kesehatan) Vol. 11 No. 2 (2025): Biolink February
Publisher : Universitas Medan Area

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31289/biolink.v11i2.13830

Abstract

Bacterial pollution that occurs in the environment causes an increase in disease and antibiotic use, which leads to resistance. This study analyzes antibiotic-resistant blaSHV and blaTEM genes in silico and in vitro. Antibiotic-resistant bacterial isolates on ESBL will be carried out PCR and electrophoresis. The type of research used is descriptive observational research conducted from April to September 2024. The sampling technique used was random sampling. Primer blaSHV with sequence F' AGGATTGACTGCCTTTTTG and R' ATTTGCTGATTTCGCTCG, while primer blaTEM has sequence F' ATCAGCAATAAACCAGC and R' CCCCGAAGAACGTTTTC. Data analysis was carried out by analyzing in silico results obtained from the NCBI website and observing the visualization results of PCR amplification indicated by the presence of DNA bands.  In silico results showed 25 organisms attached to blaSHV and 29 organisms to blaTEM. In vitro results shown by electrophoresis visualization showed blaSHV amplicons measuring 392 bp with an annealing temperature of 50.5°C, and blaTEM measuring 517 bp with an annealing temperature of 42°C. The success rate of PCR was shown by clear and specific amplification of both genes, indicating that the PCR method performed was effective in detecting blaSHV and blaTEM genes in ESBL antibiotic-resistant bacterial isolate samples.  
Penyuluhan dan Pemeriksaan Kesehatan serta Pengobatan Gratis pada Masyarakat Desa Sindurejo Kecamatan Gedangan Kabupaten Malang untuk Skrining Penyakit Tidak Menular Ariesaka, Kiky Martha; Iftitahurroza, Hilma Tsurayya; Nuryady, Moh Mirza
Jurnal SOLMA Vol. 14 No. 1 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i1.15729

Abstract

Latar Belakang: Kesehatan merupakan aspek mendasar bagi produktivitas dan kualitas hidup manusia. Hingga saat ini, penyakit tidak menular (PTM) masih menjadi perhatian global, termasuk di Indonesia. PTM, seperti kardiovaskular, diabetes, dan kanker, menyebabkan lebih dari 70% kematian global, dengan tingkat kematian tertinggi di negara berkembang. Di Indonesia, prevalensi diabetes dan hipertensi meningkat, khususnya di wilayah pedesaan. Berdasarkan hasil wawancara dengan pemangku kebijakan setempat, Desa Sindurejo, Kab. Malang menghadapi tantangan deteksi dan penanganan PTM karena jarak yang signifikan  dari pusat layanan kesehatan. Kegiatan pengabdian masyarakat ini bertujuan untuk menjawab permasalahan deteksi PTM tersebut  dengan melakukan skrining dan penyuluhan kesehatan di Desa Sindurejo. Metode: Kegiatan ini melibatkan mitra yaitu kepala desa Sindurejo dengan target sasaran seluruh warga lansia di desa Sindurejo. Metode melibatkan pemeriksaan kesehatan yang terdiri atas pengukuran berat badan, tanda-tanda vital (tekanan darah, laju denyut nadi, frekuensi napas, dan suhu tubuh), dan pengukuran kadar gula darah sewaktu (GDS), asam urat dan kolesterol, serta penyuluhan dengan metode ceramah. Hasil: Hasil kegiatan yang dilaksanakan pada Januari 2024 di Desa Sindurejo menunjukkan antusiasme partisipasi warga, diikuti oleh total 46 orang lansia. Kegiatan skrining dan pemeriksaan gratis berhasil mendiagnosis PTM pada sebagian besar individu, sementara penyuluhan meningkatkan kesadaran akan pentingnya pencegahan PTM. Kesimpulan: Kesimpulannya, kegiatan ini memberikan dampak positif pada kesehatan masyarakat pedesaan dan mendukung upaya global mengurangi beban PTM melalui deteksi dini dan modifikasi gaya hidup sehat
Breeding Site Preferences and Resistance Status of Aedes aegypti in Malang City Nuryady, Moh Mirza; Purwanti, Elly; Permana, Tutut Indria; Ariesaka, Kiky Martha
Jurnal Kesehatan Masyarakat Vol. 21 No. 2 (2025)
Publisher : Universitas Negeri Semarang in collaboration with Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI Tingkat Pusat) and Jejaring Nasional Pendidikan Kesehatan (JNPK)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/kemas.v21i2.21666

Abstract

Dengue Hemorrhagic Fever (DHF) remains a significant health challenge in urban and semi-urban regions, including Malang City, Indonesia, where Aedes aegypti is the primary vector. This study aimed to identify the breeding site preferences of Ae. aegypti and assess its resistance to 0.8% malathion and 0.05% cypermethrin insecticides. Using a descriptive observational design, ovitraps were deployed in three districts to collect mosquito larvae and eggs, and interviews with residents provided additional data on breeding site preferences. Resistance tests followed WHO guidelines, with mortality rates analysed after insecticide exposure. Results indicated that Ae. aegypti larvae were predominantly found in bathroom water tanks (45%) and flower vases (35%). Resistance status revealed geographical variability: Ae. aegypti in District 1 were resistant to cypermethrin, while populations in Districts 2 and 3 were susceptible, with average status of Ae. Aegypti to cypermethrin is tolerant. For malathion, resistance was widespread, particularly in District 3, with average status of Ae. Aegypti to malathion is resistant. These findings suggest that the use of malathion for vector control in Malang is no longer effective, while cypermethrin remains viable under strict monitoring to prevent future resistance. This study underscores the need for targeted insecticide use and regular monitoring to optimize vector control strategies and minimize DHF transmission.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Pemberian Senam Low Impact untuk Meningkatkan Kesehatan Reproduksi bagi Remaja Siswa-Siswi SMAN 7 Malang Hilma Tsurayya Iftitahurroza; Anditri Weningtyas; Kiky Martha Ariesaka; Lintang Widya Sishartami; Arif Ladika; Faridatus Solikha; Fannia Yosa Bakhtiar
EduInovasi:  Journal of Basic Educational Studies Vol. 4 No. 3 (2024): EduInovasi:  Journal of Basic Educational Studies
Publisher : Intitut Agama Islam Nasional Laa Roiba Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47467/edu.v4i3.4413

Abstract

Adolescent reproductive health is a crucial aspect in the development of the quality of life for young generations. This community service activity aims to evaluate the effectiveness of low-impact exercise in improving reproductive health among students of SMAN 7 Malang. The method used is a participatory approach with low-impact exercise training conducted over 12 weeks. A total of 120 randomly selected students participated in this program. Reproductive health data were collected through questionnaires before and after the intervention, covering aspects such as knowledge of reproductive health, healthy living habits, and the frequency of reproductive health symptoms. Evaluation results showed a significant increase in participants' reproductive health scores after participating in the low-impact exercise program. The conclusion of this activity indicates that low-impact exercise can be an effective method in school reproductive health education programs. It is hoped that this program can be implemented routinely and become part of the physical education curriculum to improve adolescent reproductive health.
EFEKTIVITAS MODUL GIZI SEIMBANG DAN BAHAYA ANEMIA DALAM MENINGKATKAN PENGETAHUAN MAHASISWA ASIA UNIVERSITY TAIWAN Weningtyas, Anditri; Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Tsurayya, Hilma; Iftitahurroza, Iftitahurroza; Ladika, Arif; Bakhtiar, Fannia Yosa
BULETIN ILMIAH NAGARI MEMBANGUN Vol. 7 No. 4 (2024)
Publisher : LPPM (Institute for Research and Community Services) Universitas Andalas Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/bina.v7i4.657

Abstract

The objective of this study was to evaluate the impact of utilizing balanced nutrition and anemia awareness modules as socialization media on the knowledge levels of university students in Taiwan. Balanced nutrition is a critical element for maintaining optimal health, especially among students who often face academic and social pressures. This socialization initiative aimed to provide a deeper understanding of the importance of balanced nutrition and anemia prevention to enhance awareness and knowledge among students. The study employed a quantitative approach involving 32 students from Asia University College of Medical and Health Sciences as participants. Data were collected through pre-tests and post-tests using a questionnaire comprising 10 questions to assess knowledge levels before and after the intervention. The data were analyzed using the Wilcoxon test with SPSS software to identify significant differences in knowledge scores. The results revealed a significant improvement in the students' knowledge after the socialization program. Before the intervention, the average knowledge score of the participants was 22.4 ± 6.93. Following the intervention, the score increased to 15.8 ± 6.53, with a p-value of 0.005, indicating the program's success. In conclusion, the balanced nutrition module proved to be an effective socialization tool for enhancing students' understanding of anemia prevention and the importance of healthy eating habits. Recommendations from this study include the development of more interactive modules and the implementation of continuous educational programs to ensure long-term improvements in students' comprehension of balanced nutrition and anemia prevention.
Peningkatan Kapasitas Guru Sekolah Luar Biasa tentang Diet Gluten Free Casein Free (GFCF) pada Anak dengan Autism Spectrum Disorder Kurniawan, Agung; Fukata, Editya; Ariesaka, Kiky Martha; Wijaya, Andreas Budi; Putri, Angelica Igsanti; Prasetya, Ahmada Viosepta; Devi, Athaayaa Nastiti Ulayya; Putra, Alvino Ramadhany; Khodijah, Khodijah; Auliarahma, Zhafirah
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 10 No. 4 (2025): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/dfr7v968

Abstract

Salah satu intervensi non-farmakologis pada anak dengan Autism Spectrum Disorder (ASD) adalah diet Gluten Free Casein Free (GFCF), namun pengetahuan guru Sekolah Luar Biasa (SLB) tentang diet ini masih sangat terbatas. Program pengabdian ini bertujuan meningkatkan pemahaman guru mengenai konsep dan implementasi diet GFCF di sekolah. Metode yang digunakan adalah pelatihan berbasis model ADDIE (Analysis, Design, Development, Implementation, Evaluation) yang melibatkan 29 guru SDLB melalui pendekatan partisipatif. Evaluasi dilakukan dengan pre-test dan post-test yang dianalisis menggunakan uji paired T-test. Hasil menunjukkan adanya peningkatan signifikan pada skor pengetahuan guru setelah pelatihan (p=0,021), dengan rata-rata peningkatan 4,83 poin. Analisis kualitatif juga memperlihatkan partisipasi aktif, sikap positif terhadap penerapan diet GFCF, serta kepuasan tinggi terhadap proses pelatihan. Kegiatan ini merupakan pelatihan pertama di Indonesia yang menggunakan pendekatan model ADDIE untuk meningkatkan kapasitas guru SLB dalam menerapkan diet GFCF secara terstruktur. Temuan ini menunjukkan bahwa pelatihan terstruktur efektif meningkatkan kapasitas guru dalam mendukung tatalaksana holistik anak dengan ASD, sekaligus berkontribusi pada pengembangan ilmu pengetahuan terapan di bidang pendidikan khusus dan pencapaian Sustainable Development Goals (SDGs), khususnya pada aspek kesehatan dan pendidikan berkualitas. Enhancing Special School Teachers’ Capacity on Gluten Free Casein Free (GFCF) Diet for Children with Autism Spectrum Disorder Abstract One of the non-pharmacological interventions for children with Autism Spectrum Disorder (ASD) is the Gluten Free Casein Free (GFCF) diet; however, teachers in special schools (SLB) still have very limited knowledge about this dietary approach. This community service program aimed to improve teachers’ understanding of the concept and implementation of the GFCF diet in schools. The method used was training based on the ADDIE model (Analysis, Design, Development, Implementation, Evaluation), involving 29 special elementary school teachers. Evaluation was carried out using pre- and post-tests analyzed with a paired t-test. The results showed a significant increase in teachers’ knowledge scores after the training (p=0.021), with an average improvement of 4.83 points. Qualitative analysis also revealed active participation, positive attitudes toward the application of the GFCF diet, and high satisfaction with the training process. These findings demonstrate that structured training is effective in enhancing teachers’ capacity to support the holistic management of children with ASD, while also contributing to the advancement of applied science in special education and the achievement of the Sustainable Development Goals (SDGs), particularly in the areas of health and quality education.
Integrasi Edukasi Manajemen Stress Berbasis Flipbook dan Medical Check-Up untuk Pekerja Migran Wanita Indonesia di Singapura Weningtyas, Anditri; Ariesaka, Kiky Martha; Sishartami, Lintang Widya; Iftitahurroza, Hilma Tsurayya; Wiratama, Arif Ladika; Bakhtiar, Fannia Yosa; Putri, Adhiena Liany Anastasia
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20348

Abstract

Background: Pekerja migran wanita Indonesia di Singapura menghadapi berbagai permasalahan kesehatan mental dan fisik akibat tekanan kerja tinggi serta keterbatasan akses layanan kesehatan. Program ini bertujuan mengevaluasi efektivitas program manajemen stres menggunakan media flipbook yang terintegrasi dengan Medical Check-Up gratis bagi pekerja migran wanita Indonesia di Singapura. Metode: Metode penelitian menggunakan pendekatan Asset-Based Community Development dengan desain pre-post-test yang melibatkan 221 partisipan. Intervensi berupa edukasi manajemen stres melalui flipbook dan pemeriksaan kesehatan komprehensif meliputi antropometri, tekanan darah, gula darah, dan penilaian kesehatan mental menggunakan Kessler-10. Data dianalisis menggunakan uji Wilcoxon dengan tingkat signifikansi 95%. Hasil: Terdapat peningkatan pengetahuan yang signifikan dari pre-test 9,52 menjadi post-test 16,68 dengan selisih rata-rata 7,15 poin. Medical check-up menunjukkan bahwa 70,1 persen partisipan berisiko tinggi gangguan mental, 38,0 persen mengalami diabetes, dan 17,6 persen hipertensi. Kesimpulan: Program ini terbukti efektif meningkatkan pengetahuan manajemen stres secara menyeluruh pada seluruh partisipan. Integrasi manajemen stres dengan Medical Check-Up memberikan solusi komprehensif untuk mengatasi permasalahan kesehatan pekerja migran wanita Indonesia di Singapura.
Guru Cermat, Anak Hebat: Peningkatan Kapasitas Guru PAUD melalui Pelatihan Skrining Tumbuh Kembang di TK Muslimat NU 27 Malang Iftitahurroza, Hilma Tsurayya; Widya Sishartami, Lintang; Ariesaka, Kiky Martha; Weningtyas, Anditri; Kurniawati, Andini; Qurrataa'ayun, Ahmad Al; Aulia, Sabrina; Auliarahama, Zhafirah; Manggolono, Lintang Nirmalasari Gemalochaya
Jurnal SOLMA Vol. 14 No. 3 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i3.20867

Abstract

Background: Early childhood is a golden period of growth and development that serves as the foundation for the quality of human resources in the future. Developmental screening in early childhood is crucial to detect growth and developmental disorders at an early stage. Early Childhood Education (ECE) teachers play a strategic role in conducting screenings within educational institutions. However, limited teacher capacity in performing developmental screenings often becomes a challenge. Methods: The program was conducted using a training approach designed based on the ADDIE model. The effectiveness of the training was evaluated by comparing the participants’ pre-test and post-test scores. Results: The activity was implemented at TK Muslimat NU 27 Malang and was attended by 12 participants, all of whom were PAUD teachers. The results showed a significant improvement in teachers’ knowledge and skills based on pre-test and post-test outcomes, as well as increased confidence in conducting growth and development screening in schools. Conclusion: This activity improved teachers’ capacity in children growth and development screening; however, further monitoring and evaluation of implementation are needed.
Co-Authors Agil Wahyu Wicaksono Agung Kurniawan Ain Yuanita Insani Ain Yuanita Insani Al Munawir Aldina, Siti Nur Anditri Weningtyas Andreas Budi Wijaya Ardhanu Kusumanto Arif Ladika Aulia, Sabrina Auliarahama, Zhafirah Auliarahma, Zhafirah Azka Darajat Bakhtiar, Fannia Yosa Brilliant Givya Ariansari Brilliant Givya Ariansari Devi, Athaayaa Nastiti Ulayya Diani Fatmawati Editya Fukata Elly Purwanti Erfan Efendi Fanani, Erianto Fannia Yosa Bakhtiar Faridatus Solikha Fatmawati, Diani Fuad Adi Prasetyo Fuad Adi Prasetyo Fuad Jaya Miharja Fulviansyah, Zaidhan Lucano Ganes, Tegar Gelaner, Nauval Akhmadian Haryono, Putri Dwinita Hilda Khairinnisa Hilma Tsurayya Iftitahurroza Iftitahurroza, Hilma Tsurayya Iftitahurroza, Iftitahurroza Ika Agus Rini, Ika Agus Ika Rahmawati Sutejo Ika Wahyuni Inggita Utami Juliana, Levina Imelda Khodijah Khodijah Khoiriyah, Zakiyatul Khoiro, Aisha Azaria Nisa’ul KURNIAWATI, ANDINI Ladika, Arif Lintang Widya Sishartami Lintang Widya Sishartami Maliza, Rita Manggolono, Lintang Nirmalasari Gemalochaya Mochammad Yunus, Mochammad Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Mudzakir Taufiqurrahman Mudzakkir Taufiqurrahman Mudzakkir Taufiqurrqhman Nanang Tri Wahyudi Nazila, Farah Nungki Anggorowati Prasetya, Ahmada Viosepta Purwanti, Elly Putra, Alvino Ramadhany Putri, Adhiena Liany Anastasia Putri, Angelica Igsanti Qurrataa'ayun, Ahmad Al Siti Nur Aldina Sri Wahyuni Sri Wahyuni Suhartanti, Ajeng Sri Susetyarini, Rr Eko Tsurayya, Hilma Tutut Indria Permana Ulfa, Darlah Immaria Wahyu Dian Puspita Wahyuni, Sri Widya Sishartami, Lintang Wiratama, Arif Ladika Zakiyatul Khoiriyah Zucha, Muhammad Ary