cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota manado,
Sulawesi utara
INDONESIA
e-Journal BUDIDAYA PERAIRAN
ISSN : 23373768     EISSN : -     DOI : -
Core Subject : Social,
e-Journal BUDIDAYA PERAIRAN merupakan jurnal ilmiah yang mempublikasikan hasil-hasil penelitian maupun ulasan (review) dibidang budidaya perairan baik budidaya air tawar, payau mapun laut. Artikel jurnal dapat ditulis dalam bahasa inggris atau bahasa Indonesia. Jurnal diterbitkan 3 kali setahun yaitu bulan Januari, Mei dan September
Arjuna Subject : -
Articles 258 Documents
Efektivitas Ekstrak Daun Pacar Air (Impatiens balsamina L.) Untuk Meningkatkan Respon Imun Non Spesifik Ikan Nila (Oreochromis niloticus) Pasaribu, Wesly; Longdong, Sammy N.J
e-Journal BUDIDAYA PERAIRAN Vol 3, No 1 (2015)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.3.1.2015.6939

Abstract

The objective of this research was  to determine the most effective dose and the best induction time of  Impatiens balsamina extract in enhancing nonspesific immune response of nile tilapia (Oreochromis niloticus).  The tested fish were nile tilapia, 14-16 cm in length, and  39-42 g in weight, obtained from Balai Pengembangan dan Pembinaan Pembudidayaan Ikan (BP3I) Tateli. The  research was designed in 2x4 factorial in completely randomized design.  There were  two factors   tested  in this research, the dose  and  time.  There were four levels of dose,  A1 = 0 mg/mL extract, A2= 30 mg/mL extract, A3= 50 mg/mL extract, A4= 70 mg/mL extract; and there were  two levels of time,  B1= 7 days after injection and B2=14 days after injection.   The extract was injected intramuscularly  with a dose of  0.2 mL per fish.   Data collected in this research was the immune parameters (total leucocyte count and phagocytosis activity). The results showed that the most effective dose in enhancing nonspesific immune response was   A1=50 mg/mL extract and the best induction time was  B1= 7 day after injection.   The results also indicated  that there was significant  interaction between  dose and time in influencing  the total amount of leucocyte, but there was not  interaction in influencing the phagocytic activities. Keywords : Impatiens balsamina, immune Response, total leucocyte count, phagocytosis activity.
Identifikasi dan prevalensi ektoparasit pada ikan Nila (Oreochromis niloticus) di kolam budidaya Kampung Hiung, Kecamatan Manganitu, Kabupaten Kepulauan Sangihe Manurung, Usy N; Gaghenggang, Fatmawati
e-Journal BUDIDAYA PERAIRAN Vol 4, No 2 (2016)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.4.2.2016.13053

Abstract

A research had been conducted to identify and analyze the prevalence of ectoparasites on Nile tilapia (Oreochromis niloticus) cultured in Kampung Hiung, Manganitu District of Sangihe Island Regency during May 2016. Identification was conducted at The Laboratory of Fisheries and Maritime, Polytechnic of Negeri Nusa Utara.  The research found five parasite species infecting nile tilapia including Dactylogyrus sp, Oodinum sp, Lerneae sp, Gyrodactylus sp and Trichodina sp. The highest prevalence value was Dactylogyrus sp (86.67%), followed by Oodinium sp (33,33 %), Lerneae sp (13,33%), Gyrodactylus sp (6.67%) and Trichodina sp (6.67%) Keywords:  parasite, identification, prevalence, Oreochromis niloticus
Pemanfaatan kotoran ternak dengan dosis yang berbeda terhadap pertumbuhan dan biomassa cacing sutra (Tubifex sp.) Wenda, Detiben; Pangkey, Henneke; Mokolensang, Jeffrie F. F.
e-Journal BUDIDAYA PERAIRAN Vol 6, No 2 (2018)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.6.2.2018.20496

Abstract

The purpose of this study was to analyze the use of cattle dung on the growth and biomass of silk worms. The experiment was conducted at Freshwater Aquaculture Center (BPBAT) Tatelu, Tatelu Village, Dimembe Subdistrict, North Minahasa Regency, North Sulawesi Province, about 35 km from Manado city. The media used was pig manure, chicken manure, cow dung, and fine mud added with EM4. The method used was complete randomized design (RAL) with 4 treatments including A. 500 g of pig manure, 500 g of chicken manure 500 g of cow dung, and 500 g of fine mud; B. 600 g of pig manure, 400 g of chicken manure 500 g of cow dung, 500 g of fine mud; C. 700 g of pig manure, 300 g of chicken manure, 500 g of cow dung, 500 g of fine mud; and K (control) was 2000 g of fine mudinand, each with 3 replications. Water quality parameters measured during the study were temperature, pH, DO, nitrate and nitrite. The results showed that there was a very significant effect on growth but not for the value of silk worm biomass. The highest growth was found in treatment A that was 38 g, while for the highest biomass also in treatment A namely 1.5 g / cm3. Water quality parameters during the study were 24.3-25.4° C, pH 7,1-7,3; DO 2.7-5,7 ppm; nitrate 1.1-1.4 ppm; nitrite 0.011-0.201 ppm.Keywords:  Cattle dung, growth, biomass, Tubifex sp., aquaculture
Efektifitas ovaprim terhadap lama waktu pemijahan, daya tetas telur dan sintasan larva ikan lele dumbo, Clarias gariepinus Sinjal, Hengky
e-Journal BUDIDAYA PERAIRAN Vol 2, No 1 (2014)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.2.1.2014.3788

Abstract

Abstract This study aimed to determine the effect of different doses of ovaprim on spawning time, egg hatchability, and survival of  African catfish larvae (Clarias gariepinus). The research was done in the Central Local Fish Seed (BBI) Jayapura, Papua Province. Experimental design used was Randomized Complete Design. The study consisted of four treatments namely 0 ml, 0.3 ml, 0.6 ml and 0.9 ml ovaprim, each with three replications. Data collected were spawning time, egg hatchability, and survival rate of African catfish larvae. The number of containers used was as much as 12 buckets (for spawning, hatching, and observation of survival rate of larvae). The results showed that treatment with different doses of ovaprim hormones provided a significant influence on the latency time of spawning, egg hatchability and survival rate of larval. The dose of 0.3 ml ovaprim caould increase the latency time of spawning, egg hatchability and survival rate of African catfish larvae. The average latency time of hatching was 552 minutes,  spawning and  egg hatchability 84.16% and survival rate of  living larvae was 85.76%. Keywords : African catfish, Ovaprim, spawning time, egg hatchability, survival rate
Kijing Taiwan Flour Subtitution in 3-5 cm Tilapia Fish Feed Frmulation (Substusi Tepung Kijing Taiwan Dalam Formulasi Pakan Ikan Nila Ukuran 3-5 cm) Saiful, Nurrahmi Iriani; Lumenta, Cyska; Sampekalo, Julius
e-Journal BUDIDAYA PERAIRAN Vol 3, No 1 (2015)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.3.1.2015.6926

Abstract

The research was conducted in the Nutrition and Fish Feed Technology Laboratory. Breeding container used is 15 units of Aquarium and each container stocked with 10 fishes at size 3-5 cm. The objectives of this research is: to determine the effect of feeding with different composition of Kijing Taiwan flour to the Relative growth of tilapia fish and to determine which Kijing Taiwan feed composition that has the best feed efficiency value for tilapia. The research design used was a Completely Randomized Design (CRD) using five (5) different treatments and three (3) repetitions. Where Treatment A (0% without flour Kijing Taiwan), treatment B (10% flour Kijing Taiwan), treatment C (20% flour Kijing Taiwan), treatment D (30% flour Kijing Taiwan) and treatment E (40% flour Kijing Taiwan ). The frequency of feeding was 3 times a day with a weight of 5% from the fish total weight. An observation of growth was done once a week. The analysis results of the five treatments applied, showed that the relative growth value during the research for Treatment E contribute (387.62%), followed by treatment D (268.57%), treatment C (202.86%), treatment B (182, 86%) and treatment A (131.43%). Meanwhile for the Feed Efficiency Value in treatment E contribute (48.73%) followed by treatment B (40.14%), treatment C (37.03%), treatment D (36.70%) and treatment A (28.91%). It can be concluded that the feed with additional 40% of Kijing Taiwan flour provide better relative growth and better feed efficiency value than any other feeds.   Keywords: Substitution, flour Kijing Taiwan, relative growth, feed efficiency and tilapia
Pemanfaatan tepung kulit pisang kepok (Musa balbisiana colla) dalam formulasi pakan ikan nila (Oreochromis niloticus) Jeharu, Albertus A.Y; Lumenta, Cyska; Sampekalo, Julius
e-Journal BUDIDAYA PERAIRAN Vol 3, No 3 (2015)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.3.3.2015.10358

Abstract

The objectives of this research was to determine the effect of feeding with different compositions of meal banana skin to the relative growth, absolute growth, feed efficiency and the best value for tilapia fish. This research was conducted at the Laboratory of Aquaculture Technology Faculty of Fisheries and Marine Sciences of Sam Ratulangi University. The fish samples used in the study was tilapia fish with a length of 3-5 cm with an average weight of 0.8-1 g.  Feed used as treatments contanined different banana skin powder including treatment A:10%, B 20%,  C 30%,  D 40%, and E 50% banana skin powder. Fish was cultured in an aquarium equipped with a recirculation system. The parameters observed included absolute growth, relative growth and feed efficiency value. The experimental design used was complete randomized design (CRD) with five treatments, each with three replications. The results showed that feeding with feed containing 20%banana skin powder gave the highest absolute growth value of 2.93. Feeding with 10% banana skin powder gave the highest relative growth (363%) the highest feed efficiency value is 46.6%. Keywords: banana skin powder (Musa balbisiana colla), absolute growth, relative growth, feed efficiency, Oreochromis niloticus
Aplikasi probiotik dengan bahan lokal untuk meningkatkan pertumbuhan dan tingkat kelangsungan hidup Bawal air tawar (Colossoma macropomum) Saselah, Jetti T.; Mandeno, Jefri
e-Journal BUDIDAYA PERAIRAN Vol 5, No 3 (2017)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.5.3.2017.17946

Abstract

The purpose of this study was to find out how to make probiotics with local materials and to study the effect of feed supplemented with probiotic on the growth and survival rate of freshwater pomfret fish. This study used complete randomized design with 4 treatments, each  with 3 replications. The treatments consisted of A (Probiotics 1.5 mL/100 g feed), B (Probiotics 3 mL/100 g feed), C (Probiotic 4.5 mL/100 g feed) and D (control).  The fish was fed treatment diet  two times a day. The results showed that the highest weight and length of fish were obtained in treatment  C and the lowest in treatment B. Survival rate of pomfret was quite high ranging from 96-100%.Keywords:  pomfret fish, probiotic, growth, survival rate
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Pertumbuhan benih ikan mas, Cyprinus carpio, yang diberi pakan dengan dosis dan frekuensi berbeda Biduan, Tinus O O.; Salindeho, Indra R. N.; Sambali, Hariyani
e-Journal BUDIDAYA PERAIRAN Vol 8, No 1 (2020)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.8.1.2020.27491

Abstract

The objectives of this research were to find out the optimum dose and frequency of feeding regime to ensure the maximum growth of carp-seeds, Cyprinus carpio, reared in the backyard pond with recirculation system. The experiment was carried out in 2x3 factorial experimental design and the experimental units were designed in randomized block.  Two factors were tested in this experiment; the first factor, dose of feeding, had three levels, 3%, 4% and 5% of the total body weight per day; and the second factor had 2 levels, 2 and 3 times per day.   Hence there were 6 treatments were applied, and each treatment was triplicated.   Each repetition represented group of fish with different weight.  There were 18 experimental units, and each experimental unit was composed of 8 tested fish, therefore there were 144 tested fish, which were weighed at the beginning of the experiment and then every week during the 6 weeks period of the experiment.  The weight data were converted into FCR, absolute, relative and daily growth rate, and were statistically analyzed using JMP statistic-program (SAS-institute).             The results showed the absolute growth of fish at dose of 3% was significantly lower than that of fish at the dose of 4% and 5%, which was not significantly different.   The relative and daily growth rate was not significantly affected by the different dose of feeding regime.  There was no significant difference in FCR, absolute, relative and daily growth rate between fish fed 2 and 3 times per day.  The best FCR, 1,46, was performed by fish fed 3% of the body weight per day, and this value was significantly different with that of the fish fed 4% or 5%.   The results of this experiment suggest that, carp reared in backyard pond with recirculation system should be fed twice a day, with a dose of 3% of the body weight each day.
Evaluasi Usaha Pembudidayaan Ikan di Desa Matungkas Kabupaten Minahasa Utara Koten, Elias; Mondoringin, Lukas L.J.J; Salindeho, Indra R.N
e-Journal BUDIDAYA PERAIRAN Vol 3, No 1 (2015)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.3.1.2015.6971

Abstract

The purppuse of research was to study the feasibility of fish culture technically and economically.  Primary data was gathered by interview to fish farmer and secondary data was obtained from related references.  Data analyzed were break even point and foof conversion ratio.  Water source of pond was spring water and the pond depth was 0.50 – 1.75 m.  Juveniles were obtained fron Tatelu Freshwater Aquaculture Board  and other palces.  Fish was fedr pellet for 3-4 months. Pond conctruction did not match the criteria . Fish farmer did not used capital from bank and farmers did not use book account in running the business. Food conversion ratio was 2.5 – 3.5. The price of pellet was Rp. 8.500/kg ang fish price was Rp. 25.000/kg.  Fish farmer dit not receive enough profit in running fish culture   Keywords:  feasibility study, pond construction, fish culture, Matungkas Village

Page 10 of 26 | Total Record : 258