cover
Contact Name
Kuntaman
Contact Email
jcmidpamki@gmail.com
Phone
+6281337051550
Journal Mail Official
jcmidpamki@gmail.com
Editorial Address
Departemen Mikrobiologi, Fakultas Kedoteran Universitas Airlangga, Jl. Prof. Dr. Moestopo 47 Surabaya 60286
Location
Kota surabaya,
Jawa timur
INDONESIA
Journal of Clinical Microbiology and Infectious Diseases
ISSN : -     EISSN : 28089405     DOI : https://doi.org/10.51559/jcmid
Core Subject : Science,
Journal of Clinical Microbiology and Infectious Diseases; peer-reviewed journal aiming to communicate high-quality research articles, reviews, and general articles in the field. JCMID publishes articles that encompass basic research/clinical studies related to microbiology and infectious disease. The Journal aims to bridge and integrate the intellectual, methodological, and substantive diversity of medical scholarship and encourage a vigorous dialogue between medical scholars and practitioners.
Articles 63 Documents
An unusual Lecythophora fungal keratitis case report: - Qonita Imma Irfani; R Ludhang Pradipta Rizki; Suhardjo
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.11

Abstract

Introduction: The infective process of the cornea caused by any number of pathological fungi that can invade the ocular surface is referred to as fungal keratitis or Keratomycosis. Fungal keratitis is a major vision-impairing condition worldwide as it is so difficult to treat. In order to prevent or reduce severe complications following an infection, microbiological culture and direct microscopic examination are critical to be done. Thus, early diagnosis and prompt treatment can be established. In this report, we want to explain a rare case of Lecythophora spp. fungal keratitis on women with ocular trauma caused by the rope’s end.Case Description: A 62-year-old woman presented to the hospital with complaints of watery eyes, redness, corneal ulcer, and a sensation of something in the eye in her left eye for 12 days with progressive vision loss. A history of left eye trauma was found. The patient had left ocular trauma from the rope end. There were no other symptoms that suggested an underlying disease. On microbial examination, we observed a Lecythophora spp. The colony was flat, smooth, moist to slimy, pink to violet on the surface, and tan on the reverse. Antifungal susceptibility tests revealed the species was still tolerant to Terbinafine, while resistance to Ketoconazole, Fluconazole, and Itraconazole was detected. Because Terbinafine was unavailable, the patient was still receiving ketoconazole, fluconazole, and natamycin therapy. Therefore no significant improvement was achieved. The patient continued to require corneal ulcer debridement twice a day to gain further improvement.Conclusion: Fungal Keratitis or Keratomycos is an invasive infection caused by a variety of Fungi, and sometimes it can be happened by the history of Corneal trauma and make a progressive decrease in vision.
Streptococcus agalactiae is resistant to β-lactam antibiotics in a diabetic patient with foot infection: a case report Yolanda Pitra Kusumadewi; Afdina Melya Ganes Febiyanti; Ilma Tazkiya; Galang Ridha Allatief; Annisa Somaningtyas; Cicilia Widhi Astuti; Ika Puspitasari; Kuwat Triyana; Tri Wibawa; Titik Nuryastuti
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.13

Abstract

Introduction: Diabetic foot infection is a complication that often occurs in people with diabetes mellitus. Staphylococcus aureus is the most common microorganism found in diabetic foot infections. In addition, coagulase-negative staphylococci, Enterococcus faecalis, Streptococcus agalactiae, and Pseudomonas aeruginosa can also be demonstrated. Diabetic foot infection treatment usually takes a long time which may increasing the risk of antibiotic resistance. This article will present a unique and interesting case about Streptococcus agalactiae resistant to β-lactam infection. Case description: A 56-year-old man presented with a long history of diabetes mellitus but had not taken anti-diabetic drugs and had no history of previous use of antibiotics. Since 2016 his right foot had a recurring wound that he routinely treated. Microbiology culture of the wound swab obtained three bacteria namely Streptococcus agalactiae, Proteus mirabilis and Klebsiella pneumoniae which is resistant to β-lactam antibiotics. Conclusion: The identification of Group B Streptococcus bacteria (Streptococcus agalactiae) which are resistant to β-lactam antibiotics (penicillin, third and fourth generation cephalosporins) which were found in this case, reminds all medical personnel to be more careful and prudent in the rational use of antibiotics.
The The circulation of sars-cov-2 virus inward environment of covid-19 intensive care unit, Dr. Soetomo Hospital Surabaya Eko B. Koendhori; L. Alimsardjono; S. R. S. Oktaviani; A. M. Widya; Deby Kusumaningrum; Naritha; N. D. Kurniati; P. N. Endraputra; K. Kuntaman
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.15

Abstract

Introduction: The big problem to overcome COVID-19 transmission is to suppress the viral particle circulation in the air and environment. A severe case of COVID-19 is commonly managed in a negative pressure ICU ward. Covid-ICU room in Dr. Soetomo hospital is a negative pressurized room comprising 5 rooms with an occupancy of 2 beds per room. Meanwhile, the patient’s environment is still possibly contaminated by the virus due to airborne transmission of the virus having tiny particles so the virus can easily spread through the patient’s environment. Thus, the purpose of this study is to evaluate the presentation of the SARS-CoV-2 virus, that was contaminating the room air, floor, and other surfaces inside the Covid-ICU. Method: The study was a cross-sectional descriptive study. The biological sample that analyzes was air. The air samples were taken from all areas including ante-room, patient room, gallery, clothing room, nurse station, and ICU area outside the room using an air sampler (As82 PURIVA H1) with a capacity of 200 m2/hour. The virus filter was put in the port of air entry, after air suction for 2 hours, it was immersed in VTM and continued for rtRT-PCR (real-time Reverse Transcriptase PCR) examination. Surfaces samples were taken by swabbing on the floor, bed cover, door handle, medical equipment, wall, and other equipment. They were swabbed for 5 specimens per location. After data was collected, it analyzes descriptively by using SPSS ver.25 Results: A total of 39 air samples were collected and examined with an RT-PCR machine, 5 (12.8%) positive namely 2 samples from the gallery and 3 from one room, whereas from 30 surfaces, 1 (3.3%) positive, from a sample of the bed cover. Conclusion: The SARS-CoV-2 virus is identified in the air and surface of Covid-ICU wards, indicating the risk for Covid-19 transmission. It is important for Infection Prevention and Control (IPC) policy implementation in a clinical setting.
Effect of low voltage electric currents on the decrease of Klebsiella pneumoniae ESBL and non-ESBL colonies Setya Wijoyo, Dhia Lintang; Koendhori, Eko Budi; Susilo, Imam; Wardhani, Puspa
Journal of Clinical Microbiology and Infectious Diseases Vol. 3 No. 1 (2023): Available online : June 2023
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v3i1.17

Abstract

Introduction: Klebsiella pneumoniae is a gram-negative bacteria and one of the most common causes of nosocomial infections, especially in the intensive care units. The use of liberal and irrational antibiotics is shown the emergence of antibiotic-resistant Klebsiella pneumoniae. This research was conducted to evaluate if low voltage electric current on three kinds of solvent media could have an eradication effect. Methods: This was an experimental study, which was done at the Microbiology Laboratory of Harapan Kita Women and Children Hospital-Jakarta. This study used to isolate bacteria non-ESBL and ESBL Klebsiella pneumoniae, thereupon will be dissolved in saline, Aqua destillata, and Ringer Lactate, each consisting of 8 samples. Each sample received a 0.5V and 10mA DC electric current; reduction of colonies was observed at 30, 60, 120 and 240 minutes using DensiCHEK. Result: There was a decrease in the colony number of 2 bacterial groups in the first 30 minutes in all three media (p <0.01). The reduction was higher in the non-ESBL K. pneumoniae group. The decrease of bacterial colonies was higher in the Klebsiella pneumoniae group non ESBL in ringer lactate medium during 240 minutes observation compared to saline and Aqua destillata (p <0.001; p <0.001, respectively). The saline solution showed no different effect compared to aquadestillata. Conclusion: A direct current of 10 mA and 0.5 V intervention, on Ringer lactate media, could have a bacterial killing effect to Klebsiella pneumoniae non ESBL started from 30 minutes.  Klebsiella pneumoniae ESBL needed a longer duration than non ESBL.
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
The effectiveness of patchouli oil as hand sanitizer: a comparative study between two antiseptic brands Zinatul Hayati; Dedy Syahrizal; Nisrina Nurhikmah; Fauzul Husna; Wilda Mahdani; Ade Oktiviyari; Tjut Mariam Zanaria
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.21

Abstract

Introduction: Hand hygiene is a non-pharmacological intervention recommended worldwide to prevent and control infectious diseases. Hand sanitizer is an antiseptic that contains active agents and could eradicate pathogenic microorganisms caused by infectious diseases. The addition of patchouli oil as an active agent in hand sanitizers has been proven to have a bactericidal and bacteriostatic effect against bacteria and viruses. This study aims to compare Hand sanitizer A's effectiveness (which does not contain patchouli oil) with Hand sanitizer B (containing patchouli oil) by comparing the number of normal hand flora colonies before and after using both hand sanitizers. Methods: This study is a pre-experimental design with a static group pretest and posttest design. There were 16 Medical Laboratory Technologists (MLT) enrolled in the study. Each MLT received two interventions, using Hand sanitizer A and B. The hand swabs were collected before and after using both hand sanitizers. The swabs inoculated on the media, incubated, and colony-forming units were counted. Result: This study showed a significant difference between hand sanitizers containing and not containing patchouli oil in reducing the number of normal hand flora colonies with a p-value = 0.033 (α < 0.05). The median value of total colonies decreased in Hand sanitizer B is 15, lower than the median value of Hand sanitizer A, which is 36. Conclusion: Hand sanitizer B containing patchouli oil possessed preferable effects to Hand sanitizer A, which does not contain patchouli oil in reducing the number of normal hand flora colonies.
Limit of Detection (LOD) of in-house N1N2 CDC real-time RT-PCR assay and commercial kits to detect SARS-CoV-2 Simon Yosonegoro Liem; Fera Ibrahim; Andi Yasmon
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 2 (2022): Available Online: December 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i2.23

Abstract

Introduction: There are two types of SARS-CoV-2 real-time RT-PCR (rRT-PCR) kits used in the laboratory in Indonesia, in-house and commercial kits. Our laboratory developed an in-house kit based on N1N2 CDC. In this study, we reported the In-house kit's Limit of Detection (LOD) compared with several commercial kits. Method: This report was an experimental study conducted in Clinical Microbiology Laboratory, Microbiology Department, FMUI in Jakarta. Commercial SARS-CoV-2 RNA (Vircell, Granada, Spain, Lot No. 20MBC137004-R) was used. The LoD was determined using a 2-fold dilution of the RNA in DNase/RNase-free water (Vircell®). The diluted RNA(s) were used as templates for in-house and commercial rRT-PCR kits.  Result: The LOD of in-house rRT-PCR and three commercial kits (BioCoV-19 [Bio Farma], Standard M [SD Biosensor], and Real-Q [BioSewoom]) showed higher sensitivity (3.5 copies/reaction) than Power Chek [Kogenebiotech] (7 copies/reaction).  Conclusion: The LOD of our In-house kit showed high performance in sensitivity and comparable with other commercial kit.
Characteristics of candidiasis patients and Candida species antifungal sensitivity patterns in tertiary referral hospitals, Indonesia Grisye Sahetapy; Fidriati Olivia Manongga; Ni Nyoman Sri Budayanti; I Nengah Tony Rustawan
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 2 (2022): Available Online: December 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i2.27

Abstract

Introduction: Candida species causes opportunistic infections, such as candidiasis, in patients with compromised immune systems and people receiving long-term antibiotics treatment. The use of antifungals causes resistance. Hence, it is necessary to know the antifungal sensitivity pattern of these organisms, which must be considered in definitive therapy. Therefore, this study aims to determine the characteristics of people with candidiasis and the antifungal sensitivity pattern of Candida species isolates in patients at Prof. Dr. IGNG Ngoerah Hospital, Denpasar, Indonesia. Method: This is a retrospective descriptive study using secondary data from isolates of Candida species that were isolated and identified with the Vitek2® Compact system (bioMérieux, France). The experiment was carried out at the Clinical Microbiology laboratory of Prof. Dr. IGNG Ngoerah Hospital from February 1 to July 30, 2020. Results: A total of 87 Candida species were isolated based on gender, where 55.2% and 44.8% were found in males and females, respectively. Furthermore, the most common isolate was Candida albicans, which accounts for 48.3% of the total microbes. Approximately 41.1% of Candida species were found in the sputum specimens. Furthermore, these species are 100% 98.9% and sensitive to Flucytosine and Micafungin, respectively, while 97.7% and 93.1% sensitivity was recorded for Caspofungin, Voriconazole, Amphotericin B and Fluconazole. Candida species were found in patients with diabetes mellitus and malignancy. They were also observed after using antibiotics for prophylactic, empirical and definitive therapy. Conclusion: The dominant Candida species found was Candida albicans. Characteristics of candidiasis patients were found in people with diabetes mellitus, malignancy and the use of antibiotics in prophylactic, empirical and definitive therapy. Infections caused by these organisms need to be considered in administering antifungal therapy to prevent resistance.
Prevalence of uropathogen producing extended spectrum beta lactamase (ESBL) at urinary tract infection in chronic kidney disease patients Wijaya, Carolin; Eriata, Anselmus Helbert; Rustawan, I Nengah Tony; Candra, I Kadek Bayu Adhi; Budayanti, Ni Nyoman Sri
Journal of Clinical Microbiology and Infectious Diseases Vol. 3 No. 1 (2023): Available online : June 2023
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v3i1.29

Abstract

Background: Urinary tract infection (UTI) is one of the most common bacterial infections encountered by clinicians in developing countries. UTI in patients with Chronic Kidney Disease (CKD) caused by ESBL-producing gram-negative bacteria has been increased in different countries. The common uropathogenic Gram negative bacteria are Escherichia coli and Klebsiella pneumoniae. The aim of this study was to identify prevalence of the common uropathogen producing ESBL E. coli and K. pneumonia among the patients with urinary tract infection (UTI) in chronic kidney disease as well as the susceptibility of antibiotic therapy. Methods: This was a cross-sectional retrospective study to evaluate clinical urine isolates collected from Prof. Dr. I.G.N.G. Ngoerah Hospital within July 2019 until July 2020. Identification and susceptibility tests in urine isolate were performed by Vitex-2 System (Biomerieux) and interpreted with CLSI 2020 standard. Results: From 1291 urine specimens,  210 urine specimens were collected (29.43%) from patients with UTI in CKD  during 12 months. Prevalence of uropathogen in chronic kidney disease from urine specimens were E.coli (41.57%), K.pneumoniae (13.15%), and Pseudomonas aeruginosa  (7.36%). It was found that ESBL produced E. coli (56.32%) and also K. pneumoniae (54%). Susceptibility antibiotic E. coli and K. pneumonia of UTI patient with CKD with ESBL producers were meropenem (99,10%), amikacin (98,07%), tigecycline (92,30%), gentamicin (80%), and fosfomycin (79,47%). Conclusion: ESBL producers in patient UTI in CKD patients were E. coli 56,32%, K. pneumoniae 54% that were sensitive to meropenem, amikacin, tigecycline gentamicin, fosfomycin.
Sepsis caused by Salmonella serovar paratyphi B in immunocompromised patient with kasabach-merritt syndrome in dr. Soetoro general academic hospital Surabaya: a case report Suharyadi Sasmanto; Wasito, Eddy Bagus
Journal of Clinical Microbiology and Infectious Diseases Vol. 3 No. 1 (2023): Available online : June 2023
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v3i1.30

Abstract

Introduction: Salmonella species are recognized worldwide as a common cause of childhood infections, particularly gastroenteritis, bacteremia, and enteric fever. Some salmonella infection cases, especially those caused by Salmonella paratyphi B, which are rare, are reported to cause sepsis in children and neonates. The treatment of Salmonella paratyphi B-induced sepsis is challenging, particularly in immunocompromised babies as in Kasabach-Merritt Syndrome (KMS). This case report aims to report the case of a 1.7-year-old girl who had Salmonella serovar paratyphi B-induced sepsis and presented with KMS. Case description: A 1.7 years old girl has complaints of fever for 5 days prior to admission to the hospital with a history of a growing haemangioma in the abdominal area since the first 40 days since birth. The patient was diagnosed with KMS. During the period of hospitalization, there were no complaints of fever, therefore, the patient was discharged. The next day, the patient complained of persistent fever and general weakness. Vital signs examination revealed tachycardia and hyperthermia. Laboratory results showed the hemoglobin was 8.7 gr/dL, leucocyte 20.640/uL, neutrophil 65%, lymphocyte 20.5%, platelet 14.000 uL, CRP 14.22 mg/dL. The patient was diagnosed with Kasabach-Merritt Syndrome (KMS) and has been in control as an outpatient and received oral therapy with methylprednisolone, propranolol and tranexamic acid. The patient was readmitted for chemotherapy with bleomycin and vincristine as part of the KMS treatment regimen. Empiric antibiotic (200 mg ampicillin i.v.) also administered as Salmonella sp. Bacteria was found on the blood culture. Conclusion: Salmonella paratyphi B is a rare infection, the symptoms are typically mild. Rapid identification of bacterial infection and antimicrobial susceptibility testing is crucial for effective treatment.