cover
Contact Name
Dr. Nani Radiastuti
Contact Email
n_radiastuti@yahoo.com
Phone
-
Journal Mail Official
alkauniyah@uinjkt.ac.id
Editorial Address
-
Location
Kota tangerang selatan,
Banten
INDONESIA
AL KAUNIYAH
ISSN : 19783736     EISSN : 25026720     DOI : 10.15408/kauniyah
Core Subject : Science,
Al-Kauniyah: Jurnal Biologi (p-ISSN: 1978-3736, e-ISSN: 2502-6720) is an Open Access Journal published by Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islamic University Jakarta, and established since 2007. Since 2016 Al-Kauniyah has established a collaboration with the Association of Lecturer in Biology and Biology Education throughout the State Islamic Higher University (PTKIN) in Indonesia. Until 2015, Al-Kauniyah covered environmental biology solely, but since 2016 the journal has been extended to cover the entire field of biological science (bioscience). By publishing biannually, on April and October, Al-Kauniyah is intended to communicate original researches and current issues on the subject of biology. Since volume 9 issue 1 April 2016, Al-Kauniyah had been changes the layout. This journal warmly welcomes contributions from scholars of related disciplines. Manuscripts can be submitted to AL-KAUNIYAH
Arjuna Subject : -
Articles 460 Documents
Diversity of Diurnal Butterflies (Lepidoptera) in Three Different Habitats in Batutegi Protected Forest, Lampung Hasni Ruslan; Sumayyah Sumayyah; Reza Taufiq Darmawan; Alena Puspa Murti; Regitha Cahyani; Wirayudho Birowo
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.38870

Abstract

AbstractBatutegi protected forest has various ecosystems that are habitat for butterfly species despite being largely unexplored. This study aimed to investigate the diversity of diurnal butterflies in three different habitats of Batutegi Protected Forest, Lampung. Sampling using exploration methods was conducted in forest, river, and swamp habitat. The results showed that swamp habitat had 28 species, river habitat had 19 species, and forest habitat had 20 species. Shannon-Wiener diversity index for all habitat was at moderate level. Hutchinson's t-test results showed diversity index between three habitats was significantly different. Evenness index was at high level. The Nymphalidae family had the greatest number of species and individuals, while Lycaenidae and Riodinidae had the least. Eurema hecabe was found the highest in swamp vegetation. Cupha erymanthis was found the highest in river vegetation. Euthalia monina was found the highest in forest vegetation. Two protected species, Trogonoptera brookiana and Troides helena, were observed. Butterfly diversity was affected by habitat condition. This study can serve as fundamental reference in determining vegetation suitability for stabilizing Batutegi Protected Forest for educational and ecotourism purposes.AbstrakHutan Lindung Batutegi memiliki beragam ekosistem yang menjadi habitat spesies kupu-kupu. Penelitian ini bertujuan untuk mengetahui keanekaragaman jenis kupu-kupu di tiga habitat Hutan Lindung Batutegi, Lampung.  Pengambilan data dilakukan dengan metode eksplorasi di habitat rawa, sungai dan hutan. Jumlah spesies kupu-kupu ditemukan terbanyak pada habitat rawa sebanyak 28 spesies, spesies kupu-kupu di habitat hutan sebanyak 20 spesies, dan di habitat sungai sebanyak 19 spesies. Komposisi spesies kupu-kupu yang terdapat di habitat rawa dan sungai memiliki tingkat kesamaan yang tinggi. Indeks keanekaragaman kupu-kupu pada tiga habitat tergolong sedang. Hasil uji Hutchinson menunjukkan perbedaan bermakna antar habitat. Indeks kemerataan kupu-kupu di tiga habitat bernilai tinggi. Famili Nymphalidae memiliki spesies dan individu terbanyak, sedangkan famili Lycaenidae dan Riodinidae paling sedikit. Eurema hecabe ditemukan terbanyak di habitat rawa. Cupha erymanthis ditemukan terbanyak di habitat sungai. Euthalia monina ditemukan terbanyak di habitat hutan. Terdapat dua spesies kupu-kupu yang dilindungi, yaitu Troides helena dan Trogonoptera brookiana. Keanekaragaman kupu-kupu dipengaruhi oleh kondisi habitat. Penelitian ini dapat digunakan sebagai dasar pertimbangan kesesuaian habitat yang  perlu dipertahankan untuk menyeimbangkan daerah kawasan Hutan Lindung Batutegi sebagai sarana edukasi  dan ekowisata.
Bacteriocin Activity of Lactic Acid Bacteria from Giant Prawn (Macrobrachium rosenbergii) Della Meysari; Henny Helmi; Rahmad Lingga
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.38124

Abstract

AbstractFood is one of the necessities of life. Food is often added with preservatives such as chemicals that harm human health. One of the safe natural preservatives is bacteriocin compounds. Bacteriocins can be produced by lactic acid bacteria (LAB). These bacteriocins have known as Generally Recognized as Safe (GRAS) status. This study aimed to isolate and identify BAL from the digestive tract of giant shrimp (Macrobrachium rosenbergii), as well as test the ability of the bacteriocin produced to the proteolytic enzyme, temperature, pH, and salt. The research methods used were bacterial isolation, bacterial characterization, hemolysis test, bacteriocin antibacterial activity tests, proteolytic enzyme influence tests on bacteriocin activity, temperature, pH, and salt content tests on bacteriocin activity, and antibiotic tests. The research results showed that there were 37 LAB isolates and there were 7 isolates that produced bacteriocins. The LAB isolated from the digestive tract of giant prawns is Gram-positive bacteria in the form of bacilli, catalase-negative, gamma hemolytic, methyl red positive, and homofermentative. The bacteriocins can inhibit the pathogenic bacteria Staphylococcus aureus and Escherichia coli and be degraded by the Protease-K enzyme. Moreover, the bacteriocins have the characteristics of being stable at acid to neutral pH (pH 2–7), stable at low and high temperatures (4–100 °C), and stable under conditions with a salt content of 2–6.5%. The results of the identification of LAB belonged to the Lactobacillus genus.AbstrakMakanan merupakan kebutuhan pokok dalam kehidupan sehari-hari manusia. Makanan sering kali ditambahkan bahan pengawet seperti bahan kimia yang berpengaruh buruk terhadap kesehatan manusia. Salah satu alternatif bahan pengawet alami yang aman bagi kesehatan manusia adalah senyawa bakteriosin. Bakteriosin dapat dihasilkan dari bakteri asam laktat (BAL). Bakteriosin yang diproduksi oleh BAL sudah berstatus Generally Recognized as Safe (GRAS). Penelitian ini bertujuan untuk mengisolasi dan mengidentifikasi BAL dari saluran pencernaan udang galah (Macrobrachium rosenbergii), serta menguji kemampuan bakteriosin yang dihasilkan terhadap enzim proteolitik, suhu, pH dan kadar garam. Metode penelitian yang dilakukan adalah isolasi bakteri, karakterisasi bakteri, uji hemolisis, uji aktivitas antibakteri bakteriosin, uji pengaruh enzim proteolitik, suhu, pH dan kadar garam terhadap aktivitas bakteriosin. Hasil isolasi terdapat 37 isolat BAL dan 7 isolat yang menghasilkan bakteriosin. BAL yang diisolasi dari saluran pencernaan udang galah merupakan bakteri Gram positif berbentuk basil, katalase negatif, gamma hemolisis, methyl red positif dan homofermentatif. Bakteriosin mampu menghambat bakteri patogen Staphylococcus aureus dan Escherichia coli, dapat didegradasi oleh enzim Protease-K, stabil pada pH asam hingga netral (pH 2–7), stabil pada suhu rendah maupun tinggi (4°–100 °C) dan stabil pada kondisi dengan kadar garam 2–6,5%.  Hasil identifikasi BAL dari usus udang galah yaitu bakteri termasuk dalam Genus Lactobacillus.
Carcass Weight and Skeletal Muscle Microscopic Structure of Red Nile Tilapia (Oreochromis niloticus) in The Different Aeration and Filtration Muhammad Anwar Djaelani; Kusuma Alya Fathurika; Kasiyati Kasiyati; Sunarno Sunarno
Al-Kauniyah: Jurnal Biologi Vol 17, No 2 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v17i2.31948

Abstract

AbstractRed tilapia (Oreochromis niloticus) is a freshwater fish that widely liked by Indonesian people. Keeping fish with good water quality will increase productivity. The aim of this research was to determine the effect of adding aeration and using filters on carcass weight, muscle fiber diameter and number of muscle fibers in red tilapia. This research used 24 red tilapia fish with an initial body weight of around 7 g. Divided into 4 groups, namely the maintenance group using one aerator without a filter (ANF), the maintenance group using two aerators without a filter (AANF), the maintenance group using one aerator and using a filter (AF) and the maintenance group using two aerators and using a filter (AAF). The results showed that rearing red tilapia fish in the group rearing two aerators and using a filter had a significant effect (P <0.05) on carcass weight, muscle fiber diameter, and number of muscle fibers. Observation of the muscle histology structure showed that there was no damage to the muscle histology structure. The conclusion of this research indicate that additional aerator equipped with filters will supports the growth of red tilapia fish.AbstrakIkan nila merah (Oreochromis niloticus) merupakan ikan yang banyak disukai masyarakat Indonesia. Pemeliharaan ikan dengan kualitas air yang baik akan memberikan peningkatan produktivitas. Tujuan penelitian ini adalah mengetahui pengaruh penambahan aerasi dan penggunaan filter terhadap bobot karkas, diameter serabut otot serta jumlah serabut otot pada ikan nila merah. Penelitian ini menggunakan 24 ekor ikan nila merah dengan bobot badan awal berkisar 7 g. Dibagi menjadi 4 kelompok, yaitu kelompok pemeliharaan menggunakan satu aerator tanpa filter (ANF), kelompok pemeliharaan menggunakan dua aerator tanpa filter (AANF), kelompok pemeliharaan menggunakan satu aerator dan menggunakan filter (AF) serta kelompok pemeliharaan menggunakan dua aerator dan menggunakan filter (AAF). Hasil menunjukkan pemeliharaan ikan nila merah pada kelompok pemeliharaan dua aerator dan menggunakan filter berpengaruh nyata (P <0,05) terhadap bobot karkas, diameter serabut otot, dan jumlah serabut otot. Pada pengamatan struktur histologi otot menunjukkan tidak adanya kerusakan struktur histologi otot. Kesimpulan penelitian ini penambahan aerator dilengkapi filter mendukung pertumbuhan ikan nila merah.
Perkecambahan Biji Anggrek Grammatophyllum stapeliiflorum Pada Media MS dengan Penambahan BAP Secara In Vitro Iga Permata Hany; Zozy Aneloi Noli; Suwirmen Suwirmen
Al-Kauniyah: Jurnal Biologi Vol 17, No 1 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v17i1.27624

Abstract

 AbstrakGrammatophyllum stapeliiflorum merupakan jenis anggrek epifit dengan pertumbuhan vegetatif dan generatif yang relatif lambat. Anggrek ini termasuk ke dalam kelompok CITES Apendiks II. Kultur in vitro merupakan usaha perbanyakan paling efektif untuk tanaman anggrek. Penggunaan media kultur dan Zat Pengatur Tumbuh (ZPT) yang tepat akan meningkatkan keberhasilan perkecambahan biji anggrek secara in vitro. Penelitian ini bertujuan untuk mengetahui pengaruh konsentrasi media MS dan penambahan BAP terbaik terhadap perkecambahan anggrek G. stapeliiflorum secara in vitro. Penelitian ini menggunakan rancangan acak lengkap dengan 6 perlakuan dan 4 ulangan. Perlakuan berupa variasi konsentrasi media MS dan BAP, yaitu: MS penuh; MS ½ hara makro; MS ¼ hara makro; MS penuh + 1 ppm BAP; MS ½ hara makro + 1 ppm BAP; dan MS ¼ hara makro + 1 ppm BAP. Parameter yang diamati pada penelitian ini, yaitu waktu muncul protokorm dan persentase tahap perkecambahan biji. Data dianalisis menggunakan uji ANOVA dan uji lanjut Duncan New Multiple Range Test dengan taraf 5%. Hasil penelitian menunjukkan bahwa pemberian BAP mampu mempercepat waktu muncul protokorm. Konsentrasi media MS ¼ hara makro + 1 ppm BAP merupakan konsentrasi terbaik untuk perkecambahan biji anggrek tahap 0 hingga tahap 3, sedangkan konsentrasi media MS ¼ hara makro merupakan konsentrasi terbaik untuk mencapai tahap 4 perkecambahan biji anggrek G. stapeliiflorum secara in vitro.AbstractGrammatophyllum stapeliiflorum is a type of epiphytic orchid with relatively slow vegetative and generative growth. This orchid is included in the CITES Appendix II group. In vitro culture is the most effective propagation method for orchid plants. The use of appropriate culture media and growth regulators will increase the success of orchid seed germination in vitro. This study aims to determine the effect of the best concentration of MS media and the addition of BAP on the germination of G. stapeliiflorum orchids in vitro. This study used a completely randomized design with 6 treatments and 4 replications. The treatments consisted of varying concentrations of MS and BAP media, namely: full MS; MS ½ macro nutrients; MS ¼ macro nutrients; full MS + 1 ppm BAP; MS ½ macro nutrients + 1 ppm BAP; and MS ¼ macro nutrients + 1 ppm BAP. The parameters observed in this study were the time when the protocorm appeared and the percentage of seed germination stages. Data were analyzed using the ANOVA test and the Duncan New Multiple Range Test with a level of 5%. The results of the study showed that administration of BAP was able to speed up the time when protocorm appeared. MS media concentration ¼ macro nutrients + 1 ppm BAP is the best concentration for stage 0 to stage 3 orchid seed germination, while MS media concentration ¼ macro nutrients is the best concentration for achieving stage 4 germination of G. stapeliiflorum orchid seeds in vitro. 
Analysis of Turtle Conservation Activities Effectiveness on Kelapa Dua Island, Kepulauan Seribu Graciella Stevani Gulo; Sri Setiawati Tumuyu; Mufti Petala Patria
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.37694

Abstract

AbstractThe exploitation of turtles has resulted in a decline in the turtle population. The relocation of turtle eggs from nesting habitats is a widely accepted conservation practice. This research aims to analyze the effectiveness of turtle conservation activities on Kelapa Dua Island. The study adopts a mixed-methods approach, collecting primary data through field observations and interviews and secondary data from the Kepulauan Seribu National Park Office (BTNKpS). The collected data includes information on turtle nest monitoring activities, turtle preservation techniques, and the hatching success rate. The research results show that the hawksbill turtle (Eretmochelys imbricata) is the most commonly found turtle species. The average hatching success rate over the past six years is 71.98%. This value can still be optimized to reach 80% by establishing hatcheries on the nesting islands or islands near the nesting sites. Through this strategy, monitoring can be conducted more regularly, the turtle egg relocation process can be carried out relatively quickly, and vibrations or shocks to the turtle eggs during transportation can be minimized, thus increasing the hatching success rate. Regular monitoring of the environmental conditions of the artificial nests, including temperature, pH, and humidity, is also essential to improve the hatching percentage.AbstrakEksploitasi penyu telah menyebabkan penurunan populasi penyu. Relokasi telur penyu dari habitat penetasan adalah praktik konservasi yang umum diterima. Penelitian ini bertujuan untuk menganalisis efektivitas kegiatan konservasi penyu di Pulau Kelapa Dua. Studi ini mengadopsi pendekatan metode campuran, mengumpulkan data primer melalui observasi lapangan dan wawancara serta data sekunder dari Balai Taman Nasional Kepulauan Seribu (BTNKpS). Data yang terkumpul meliputi informasi tentang kegiatan pemantauan sarang penyu, teknik pelestarian penyu, dan tingkat keberhasilan penetasan. Hasil penelitian menunjukkan bahwa penyu sisik (Eretmochelys imbricata) merupakan spesies penyu yang paling banyak ditemukan. Tingkat keberhasilan penetasan rata-rata selama enam tahun terakhir adalah 71,98%. Nilai ini masih bisa dioptimalkan hingga mencapai 80% dengan mendirikan hatchery di pulau-pulau peneluran atau pulau-pulau yang berdekatan dengan lokasi peneluran. Melalui strategi ini, pemantauan dapat dilakukan lebih rutin, proses relokasi telur penyu dapat dilakukan dengan relatif cepat, dan getaran atau benturan pada telur penyu selama proses transportasi dapat diminimalkan, sehingga meningkatkan tingkat keberhasilan penetasan. Pemantauan teratur terhadap kondisi lingkungan sarang buatan, termasuk suhu, pH, dan kelembaban, juga penting untuk meningkatkan persentase penetasan. 
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
A Comparative Study Of Stomatal Characteristics of The Nine Pandanus Species From Nias Island, North Sumatra Province, Indonesia Helmin Parida Zebua; Nursahara Pasaribu; Etti Sartina Siregar
Al-Kauniyah: Jurnal Biologi Vol 17, No 2 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v17i2.31081

Abstract

AbstractThe identification of Pandanus species generally relies on morphological characteristics and requires confirmation from other identification features, such as stomata. A comparative study of stomatal characteristics among nine Pandan species originally from Nias Island, namely Pandanus atrocarpus, P. auranticus, P. labyrinthicus, P. militaris, P. odoratissimus, P. penangensis, P. tectorius, and P. utilis has been investigated. Anomocytic stomata without papillae on subsidiary cells were observed on both leaf surfaces, with significant interspecific differences in adaxial and abaxial stomatal frequencies. Pandanus tectorius exhibited the highest adaxial (30.71 ± 0.81) and abaxial (1.87 ± 0.12) stomatal frequencies. Pandanus labyrinthicus showed the highest stomatal index (adaxial 16.61 ± 2.51, abaxial 0.87 ± 0.11), while P. penangensis had the largest stomatal size (137.54 ± 6.66 µm). Overall, the stomatal parameters, including frequency, index, and size, were higher on the adaxial surface than the abaxial surface, emphasizing interspecific variations. These findings contribute valuable supportive data for the botanical systematics of Pandanus spp. in the region, enhancing our understanding of morphological characteristics crucial for species identification.AbstrakIdentifikasi jenis dari Pandanus cenderung menggunakan ciri morfologi dan memerlukan konfirmasi dari karakter lainnya, salah satunya stomata. Studi perbandingan stomata di antara sembilan spesies Pandan di Pulau Nias, Sumatera Utara telah dilakukan, yaitu Pandanus atrocarpus, P. auranticus, P. labirinthicus, P. militaris, P. odoratissimus, P. penangensis, P. tectorius, dan P. utilis. Hasil penelitian menunjukkan bahwa keseluruhan jenis Pandanus memiliki tipe stomata berupa anomositik pada kedua permukaan daun atau amfistomatous tanpa adanya papilosa pada sel tambahan. Frekuensi stomata adaksial dan abaksial memiliki perbedaan yang nyata secara statistik lintas jenis. Frekuensi stomata tertinggi pada daun adaksial/abaksial diamati berturut-turut dari P. tectorius (30,71 ± 0,81) dan P. tectorius (1,87 ± 0,12). Indeks stomata daun tertinggi diamati berturut-turut berasal dari P. labirinthicus (16,61 ± 2,51) untuk adaxial dan P. labirinthicus (0,87 ± 0,11) untuk abaxial. Ukuran stomata terbesar diamati berturut-turut berasal dari P. penangensis (137,54 ± 6,66 µm) dan P. odoratissimus (64,56 ± 3,96 µm). Secara umum, tipe stomata pada semua jenis adalah anomositik tanpa adanya papila pada sel penjaga. Parameter stomata lainnya, yaitu frekuensi, indeks, dan ukuran pada bagian adaksial cenderung lebih tinggi dibandingkan permukaan abaksial dengan variasi nilai secara interspesifik.
Pengaruh Pemberian Jus Pare (Momordica charantia L.) Terhadap Kualitas Sperma dan Histologi Testis Tikus Wistar Haris Setiawan; Roby Ahmad Subagja
Al-Kauniyah: Jurnal Biologi Vol 17, No 1 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v16i2.1.23216

Abstract

 AbstrakBuah pare merupakan salah satu kandidat agen kontrasepsi karena memiliki beberapa senyawa seperti flavonoid, triterpenoid, steroid, charantin, dan momordicin yang memiliki peran sebagai agen antispermatogenik. Penelitian bertujuan untuk mengetahui pengaruh pemberian jus pare (Momordica charantia L.) terhadap kualitas sperma dan histologi testis tikus Wistar (Rattus norvegicus Berkenhout, 1769). Penelitian menggunakan 20 ekor tikus Wistar jantan, dibagi menjadi 4 perlakuan yang terdiri dari kelompok pemberian akuades (K), kelompok pemberian jus pare konsentrasi 25% (P1), 50% (P2), dan 75% (P3) yang dilakukan selama 49 hari menggunakan sonde lambung 1 mL. Pada hari ke-50 tikus dibedah untuk diambil cauda epididymis dan testis. Cauda epididymis dilarutkan ke dalam Phospate Buffer Saline (PBS) untuk pengamatan kualitas sperma yang terdiri dari motilitas, jumlah, viabilitas, dan morfologi sperma. Testis dibuat sediaan histologi dengan metode parafin (pewarnaan Hematoxylin-Eosin). Seluruh parameter dianalisis menggunakan uji One-Way Anova dan dilanjutkan Duncan test (P <0,05). Hasil menunjukkan terdapat penurunan motilitas, viabilitas, dan jumlah sperma pada konsentrasi 50% dibandingkan dengan kontrol (P <0,05), namun tidak terdapat perbedaan pada morfologi sperma (P >0,05). Terdapat penurunan jumlah sel spermatogonium, spermatosit, dan spermatozoa pada konsentrasi 25% dibandikan dengan kontrol (P <0,05), namun tidak terlihat penurunan pada sel spermatid dan index spermatogenesis (P >0,05). Jus pare dapat menurunkan sebagian besar parameter kualitas sperma sehingga berpotensi sebagai antispermatogenik.AbstractBitter melon fruit is one of the candidates for contraceptive agents because it contains several compounds such as flavonoids, triterpenoids, steroids, charantin, and momordicin which have a role as antispermatogenic agents. The research aims to determine the effect of giving bitter melon juice (Momordica charantia L.) on sperm quality and testicular histology of Wistar rats (Rattus norvegicus Berkenhout, 1769). The study used 20 male Wistar rats, divided into 4 treatments consisting of groups given distilled water (K), groups given bitter melon juice with concentrations of 25% (P1), 50% (P2), and 75% (P3) which were carried out for 49 days. using a 1 mL gastric probe. On the 50th day, mice were dissected to remove the cauda epididymis and testes. The cauda epididymis is dissolved in Phosphate Buffer Saline (PBS) to measure sperm quality consisting of sperm motility, number, viability and morphology. Testes were made into histological preparations using the paraffin method (Hematoxylin-Eosin staining). All parameters were analyzed using the One-Way Anova test and continued with the Duncan test (P<0.05). The results showed that there was a decrease in sperm motility, viability and number at a concentration of 50% compared to the control (P<0.05), but there was no difference in sperm morphology (P>0.05). There was a decrease in the number of spermatogonium cells, spermatocytes and spermatozoa at a concentration of 25% compared to the control (P<0.05), but there was no visible decrease in spermatid cells and spermatogenesis index (P>0.05). Bitter melon juice can reduce most sperm quality parameters so it has the potential to be antispermatogenic. 
INDEX AL-KAUNIYAH: JURNAL BIOLOGI VOL. 17 NO. 1 APRIL 2024 Index index
Al-Kauniyah: Jurnal Biologi Vol 17, No 1 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v17i1.36731

Abstract

Evaluasi Lokus Potensial matK dan ITS2 Untuk DNA Barcoding Anggrek Bulbophyllum lobbii Lindl. Mukhamad Su&#039;udi; Fuad Bahrul Ulum; Muhammad Ardiyansah; Nurfajri Eka Fitri
Al-Kauniyah: Jurnal Biologi Vol 17, No 2 (2024): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v17i2.33897

Abstract

AbstrakBulbophyllum lobbii Lindl. merupakan anggrek dari famili Orchidaceae yang berpotensi sebagai bahan baku obat herbal. Identikasi morfologi anggrek B. lobii memiliki keterbatasan karena kemiripan spesies dengan anggrek lain. Alternatif identifikasi secara molekuler menggunakan sekuen matK dan ITS2 sebagai barcode dalam DNA barcoding diharapkan menjadi salah satu lokus pembeda spesies anggrek B. lobbii secara akurat dan efisien. Penelitian ini bertujuan untuk mengidentifikasi sekuen matK dan ITS2 sebagai penanda molekuler yang efektif untuk anggrek B. lobbii. DNA genom B. lobbii diisolasi dengan metode Cethyl Trimethyl Ammonium Bromide (CTAB) dan amplifikasi DNA dengan PCR. Hasil penelitian menunjukkan sekuen matK dari B. lobbii memiliki tingkat homologi tinggi dengan dua spesies B. lobbii (KY966747.1 dan KY966691.1) dari China dengan nilai Per. Ident sebesar 99,20%, sedangkan sekuen ITS2 memiliki homologi tertinggi dengan nilai Per. Ident sebesar 99,76% pada spesies B. lobbii (MG253848.1) dari Polandia. Hasil analisis menunjukkan sekuen ITS2 dapat mengidentifikasi spesies dari tingkatan subspesies atau diatasnya (ordo atau genus) dan juga meningkatkan resolusi filogenetik yang baik pada hasil BLAST, sedangkan sekuen matK memberikan sedikit kontribusi dalam pengelompokkan hubungan kekerabatan antara spesies B. lobbii dengan spesies pembanding lainnya. Sekuen ITS2 dapat direkomendasikan sebagai penanda molekuler yang paling baik untuk identifikasi sampel anggrek Bulbophyllum, khususnya Bulbophyllum lobbii.AbstractBulbophyllum lobbii Lindl. is an orchid from the Orchidaceae family which has potential as a raw material for herbal medicine. Morphological identification of the B. lobii orchid has limitations due to the species' similarity to other orchids. The alternative molecular identification using matK and ITS2 sequences as barcodes in DNA barcoding is expected to be one of the loci for distinguishing the B. lobbii orchid species accurately and efficiently. This study aims to identify matK and ITS2 sequences as effective molecular markers for the orchid B. lobbii. Bulbophyllum lobbii genomic DNA was isolated using the Cethyl Trimethyl Ammonium Bromide (CTAB) method and DNA amplification by PCR. The results showed that the matK sequence from B. lobbii has a high level of homology with two B. lobbii species (KY966747.1 and KY966691.1) from China with a value of Per. Ident is 99.20%, while the ITS2 sequence has the highest homology with a Per. Ident value of 99.76% with the species B. lobbii (MG253848.1) from Poland. The results of the analysis show that the ITS2 sequence can identify species from the subspecies level or above (ordo or genus) and also improves good phylogenetic resolution in BLAST results, while the matK sequence makes little contribution in grouping the relationship between the B. lobbii species and other comparison species. The ITS2 sequence can be recommended as the best molecular marker for identifying Bulbophyllum orchid samples, especially Bulbophyllum lobbii. 

Filter by Year

2013 2026


Filter By Issues
All Issue Vol. 19 No. 1 (2026): AL-KAUNIYAH JURNAL BIOLOGI Vol 18, No 2 (2025): AL-KAUNIYAH JURNAL BIOLOGI Vol. 18 No. 2 (2025): AL-KAUNIYAH JURNAL BIOLOGI Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI Vol. 17 No. 2 (2024): AL-KAUNIYAH JURNAL BIOLOGI Vol 17, No 2 (2024): AL-KAUNIYAH JURNAL BIOLOGI Vol 17, No 1 (2024): AL-KAUNIYAH JURNAL BIOLOGI Vol 16, No 2 (2023): AL-KAUNIYAH JURNAL BIOLOGI Vol 16, No 1 (2023): AL-KAUNIYAH JURNAL BIOLOGI Vol. 16 No. 1 (2023): AL-KAUNIYAH JURNAL BIOLOGI Vol 15, No 2 (2022): AL-KAUNIYAH JURNAL BIOLOGI Vol 15, No 1 (2022): AL-KAUNIYAH: JURNAL BIOLOGI Vol 14, No 2 (2021): AL-KAUNIYAH JURNAL BIOLOGI Vol 14, No 1 (2021): AL-KAUNIYAH JURNAL BIOLOGI Vol 13, No 2 (2020): AL-KAUNIYAH JURNAL BIOLOGI Vol 13, No 1 (2020): Al-Kauniyah Jurnal Biologi Vol 12, No 2 (2019): Al-Kauniyah Jurnal Biologi Vol 12, No 1 (2019): Al-Kauniyah Jurnal Biologi Vol 11, No 2 (2018): Al-Kauniyah Jurnal Biologi Vol 11, No 1 (2018): Al-Kauniyah Jurnal Biologi Vol 10, No 2 (2017): Al-Kauniyah Jurnal Biologi Vol 10, No 1 (2017): Al-Kauniyah Jurnal Biologi Vol 9, No 2 (2016): Al-Kauniyah Jurnal Biologi Vol 9, No 1 (2016): Al-Kauniyah Jurnal Biologi Vol 8, No 2 (2015): Al-Kauniyah Jurnal Biologi Vol 8, No 1 (2015): Al-Kauniyah Jurnal Biologi Vol 7, No 2 (2014): Al-Kauniyah Jurnal Biologi Vol 7, No 1 (2014): Al-Kauniyah Jurnal Biologi Vol 6, No 2 (2013): Al-Kauniyah Jurnal Biologi Vol 6, No 1 (2013): Al-Kauniyah Jurnal Biologi More Issue