Claim Missing Document
Check
Articles

TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO Syukur, Sumaryati; Aneloi N, Zozy; Putri, Femilya
Jurnal Riset Kimia Vol 2, No 2 (2009): March
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v2i2.156

Abstract

 ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and  TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard.  Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin    
MENINGKATKAN AKTIVITAS DAN KOMPETENSI BELAJAR SISWA MENGGUNAKAN PENDEKATAN KONTEKSTUAL DISERTAI DENGAN LKS PADA MATA PELAJARAN BIOLOGI KELAS VIII4 MTsN BONJOL Fitri, Arya Wisata; Lufri, Lufri; Noli, Zozy Aneloi
Kolaboratif Vol 1, No 3 (2014): Jurnal Pendidikan Biologi Kolaboratif
Publisher : Kolaboratif

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (214.526 KB)

Abstract

The approach of this research called classroom action research. The subject of the research were the students of MTsN Bonjol class VIII4. This research aimed to describe the process of improving student learning activities and competencies used a contextual approach which is accompanied by worksheets on subjects MTsN Bonjol VIII4 biology class. This research used a qualitative approach supported quantitative approach. Data were obtained in the form of qualitative and quantitative data. Qualitative data were collected through observation, field notes, and interviews. Quantitative data was obtained through cognitive tests, observation activity, affective and psychomotor competencies. The study findings suggest that the used of contextual approach accompanied worksheets accompanied can improved student learning activities and competencies. The increase was seen in each aspect of the learning activity, affective and psychomotor competencies ranging from pre cycle, the first cycle and second cycle. The increase was also seen in the results of the exam pre cycle is 48, in the first cycle 58.6, and 82.8 in the second cycle. Based on results of research, can concluded the used of contextual approach accompanied worksheets accompanied can improve student learning activities and competencies on subjects MTsN Bonjol VIII4 biology class.
Peningkatan Kandungan Alkaloid Kalus Mahkota Dewa (Phaleria macrocarpa [Scheff.]Boerl.) Dengan Pemberian Prekursor Triptofan pada Medium Murashige & skoog Wenny Rahma Gusni; Suwirmen Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 4, No 1 (2015)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.4.1.%p.2015

Abstract

An experiment aimed to increase alkaloid content of Phaleria macrocarpa callus using tryptophan as a precursor in Murashige & Skoog media was done from September 2013 to January 2014 at the Laboratory of Plant Physiology, Faculty of Sciences, Andalas University. This experiment used Completely Randomized Design (CRD) with 6 treatments and 4 replications. The treatments were 6 consentrations of tryptophan i.e.0 mg/L (control), 100 mg/L, 125 mg/L, 150 mg/L, 175 mg/L, 200 mg/L. The results showed that tryptophan 200 mg/L gave the best concentration in producing the highest alkaloid content of Phaleria macrocarpa callus.
Kompatibilitas Spora Glomus Hasil Isolasi dari Rizosfer Macaranga triloba dengan Tiga Jenis Tanaman Inang Gian Wulandari; - Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 3, No 2 (2014)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.3.2.%p.2014

Abstract

The study about compatibility of Glomus spores isolated from the rhizosphere Macaranga triloba with three types of host plants have been done from February to November 2013 in greenhouses and Plant Physiology Laboratory, Department of Biology, Andalas University, Padang. The aim of this study was to determine compatibility of corn (Zea mays), jatropha (Jatropha curcas) and scallion (Allium fistulosum) as host plants of Glomus spores isolated from the rhizosphere Macaranga triloba. This experiment used completely randomized design (CRD) with 3 treatments and 9 replications. The treatments were corn, jatropha and scallion. The results showed that spore density of the corn and scallion gave the same effect, whereas jatropha gave different effects on the two plants. The degree of infection of corn roots and scallion showed a high criteria, while the percentage degree of infection on jatropha roots showed a moderate criteria. The corn and scallion were compatible host plants of Glomus spores isolated from the rhizosphere of Macaranga triloba.Key words: compatibility, host plants, Glomus spores
Induksi Embriogenesis Somatik Pada Anggrek Vanda Sumatrana Schltr. dengan Penambahan Beberapa Konsentrasi Asam 2,4-Diklorofenoksiasetat (2,4-D) Anita Tri Astuti; Zozy Aneloi Noli; Suwirmen Suwirmen
Jurnal Biologi Universitas Andalas Vol 7, No 1 (2019)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.7.1.6-13.2019

Abstract

The research about induction of somatic embryogenesis of  Orchid Vanda sumatrana Schltr.  by giving 2,4-Diclorophenoxiacetic acid (2,4-D), was conducted from May to July 2016 in plant Physiology and tissue Culture Laboratory, Biology Departement, Matematics and Natural Science Faculty, Andalas University. The aim of this study was found the concentration of 2,4-D to induce somatic embryogenesis of Vanda sumatrana. The research used Completely Randomized Resign (CDR) with 6 treatments and 4 replication. The treatments were : without 2,4-D (control); 1 mg/L; 2 mg/L; 3 mg/L; 4 mg/L; 5 mg/L. The result showed that 2 mg/L 2,4-D and 3 mg/L 2,4-D were concentrations to induct somatic embryogenesis.
Pertumbuhan Daun Angsana (Pterocarpus indicus Willd) dan Akumulasi Logam Timbal (Pb) Gita Prima Yudha; Zozy Aneloi Noli; M. Idris
Jurnal Biologi Universitas Andalas Vol 2, No 2 (2013)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.2.2.%p.2013

Abstract

An examination of lead accumulation on leaves growth Angsana (Pterocarpus indicus Willd) was conducted from August to November 2012 in Plant Physiology Laboratory, Andalas University, Padang. The aim of the study was to find correlation between accumulation of lead and leaves size and stomatal density. Statistical analysis used kruskal wallis-test and linear regression. The result showed that Angsana’s leaves stopped growing after 25 days old with achieved 25.99 cm width, 345 per mm2 stomatal density and 0.73 mg per gr of chlorophyll content. Concentration of lead increased gradually from 0.00 mg per kg at early and 0.021 mg per kg in 25 days. There was no significant correlation between age of leaves and lead concentration. However, there was a positive correlation between width of leaves and lead concetration (R= 0.862).Keywords: Pterocarpus indicus, accumulation of Pb, age and size of leave.
Pertumbuhan Rumput Kerbau (Paspalum conjugatum Berg.) yang Diinokulasi Beberapa Dosis Fungi Mikoriza Arbuskular (FMA) pada Media yang Mengandung Merkuri (Hg) Putri Seti Ayu; Zozy Aneloi Noli; Solfiyeni Solfiyeni
Jurnal Biologi Universitas Andalas Vol 4, No 2 (2015)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.4.2.%p.2015

Abstract

The research about the growth of Buffalo Grass (Paspalum conjugatum Berg.) inoculated with several doses of Arbuscular Mychorrizal Fungi (AMF) ) in Media Containing with Mercury (Hg) had been done from February to July 2014 at the greenhouse, Plant Physiology and Tissue Culture Laboratory, Biology Department, Faculty of Mathematic and Natural Science and Environmental Laboratory, Faculty of Engineering, Andalas University. The aims of the research to know ability of P. conjugatum inoculated with several doses AMF in media containing with mercury and find the best dose of AMF for growh of P. conjugatum. The research used a Completely Randomized Design with five treatments and five replications. The treatments were control 0, 5, 10, 15, 20 g  AMF. The result showed that no effect inoculated of AMF up to 20 g to the height, number of leaves and dry weight of P. conjugatum.
Pertumbuhan Kunyit Putih (Curcuma zedoaria Rosc.) yang Diinokulasi Fungi Mikoriza Arbuskula Hasil Isolasi Dari RizosfirHornstedtia scyphifera Steud. Marta Linda; Zozy Aneloi Noli; M. Idris
Jurnal Biologi Universitas Andalas Vol 3, No 1 (2014)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.3.1.%p.2014

Abstract

A study on growth of turmeric (Curcuma zedoaria Rosc.) inoculated with Arbuscular Mycorrhizzal Fungi (AMF) isolated from the rhizosphere of Situngkek (Hornstedtia scyphifera Steud.) was done from March to August 2013 in the wire house and in Plant Physiology Laboratory, Department of Biology, Faculty of Natural Sciences, Andalas University. The aim of this study was to determine the growth of white turmeric inoculated with several doses of AMF. The experiment used Completely Randomized Design (CRD) with five treatments, control (A) and four replications. The inoculation doses were 10 g / Plant AMF (B), 20 g / plant AMF (C), 30 g / Plant AMF (D), 40 g / Plant AMF (E), 50 g / Plant AMF (F). The results showed that AMF inoculation gave no significant effect on plant height, number of leaf, leaf width and dry weight of turmeric. The highest root infection was 30 gr/plant (74.83 %). Generally, turmeric plant have a dependency on FMA inoculation with less and sufficient criteria of Habte and Manjunath. Keyword: Curcuma zedoaria, Mycorrhizal, Growth.
Pengurangan Masa Stratifikasi dengan Penambahan Hormon GA3 Pada Perkecambahan Benih Stroberi (Fragaria x annanassa (Weston) Duchesne) Mayola Arda; - Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 3, No 4 (2014)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.3.4.%p.2014

Abstract

An experiment on the reduction of stratification period with addition of GA3 hormone to strawberry (Fragaria x annanassa (Weston) Duchesne) seeds germination has been done from December 2013 to February 2014 in the Laboratory of Plant Physiology, Department of Biology, Faculty of Sciences, Andalas University, Padang. The experiment aimed to reduce the stratification period and determine the reliable concentration of GA3 on strawberries seeds germination. The experiment was conducted by using Split Plot Design which consisted of stratification levels (0 week, 1 week and 2 weeks) as main plots, while GA3 consentration (0 ppm, 25 ppm, 50 ppm and 75 ppm) as sub plots. The results from that 25 ppm GA3 combined to 0 week showed the best acceleration to  the emergence of sprouts, increased the number of seed germinations and sprouts length but did not significantly affected to the length of time required for the germination.Key word :GA3, germination, stratification, strawberry
Respon Berbagai Sumber Bahan Stek terhadap Kemampuan Berakar Stek Alstonia scholaris (L) R. Br. sebagai Upaya Penyediaan Bibit untuk Lahan Terdegradasi Kiki Ayunda Putri; Suwirmen Suwirmen; Zozy Aneloi Noli
Jurnal Biologi Universitas Andalas Vol 5, No 1 (2017)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.5.1.1-5.2017

Abstract

The research about  the respon  of the material cuttings retrieval on rooting ability of  Alstonia scholaris (L.) R. Br. Cuttings  in an effort provision of seeds for Degraded lands ,  conducted from October until December 2015 at Physiology Plant Laboratorium of Biology Department, Mathematics and Natural Science Faculty of Andalas University, Padang. The aim of this research to found the best  material cuttings on A. scholaris. This research used Completely Randomized Design (CRD) method. The treatments were the basal (A), the middle (B), and the apical (C). The results showed that the apical was the best material cuttings, with a average number of roots (3.967), and the average of root dry weights (0.832)g. The conclusion of this research is the that material cuttings of apical is the bst one for Pulai cutting.
Co-Authors . Mansyurdin A. Fadhil Desafa Adam Raihan Priambada Adelia, sabbrina Adrial, Rico Afdhal Muttaqin Agusti Apriliani Alimin Mahyudin Alponsin Alponsin Anita Sari Anita Tri Astuti Anthoni Agustien Arif Budiman Asih Maharani Asih, Enda Tarni Asnul Fitria Astuti Aulia Suci Desila Aulia, Annisa Aulya, Nailul Rahmi Ayola Pajrita Ayu Utami Rezki Azharia Khalida Chairul Chairul Chairul Chairul Cleopatra Dahyunir Dahlan De Yudanur, Parissa Anandita Dedi Mardiansyah Delfi, Shyla Aulia Della Amelia Dezi Meutya Dapersal Dian Fitriyani Diana Fadhilah Dilla, Arfa Iskhia Djong Hon Tjong Dola Ratna Yulizar Dwi Pujiastuti Dwi Puryanti Efrizal Efrizal Efrizal Efrizal Eka Muliani Elfans Bawalsyah S.A. Elvaswer Elvina Sari Emelta, Citra Endah Mutia Sari Feby Zulya Femilya Putri Fera Malta Feriska Handayani Ferry Lismanto Syaiful Feskaharny Alamsjah Fiqi Diyona Fira Julia Putri Fitri, Arya Wisata Gian Wulandari Gita Prima Yudha Haldis Alvaro Hany, Iga Permata Helsya Vellarentika Labukti Hesti Dwi Marcellinna Husri Meli Iga Permata Hany Imam Taufiq Ivo Octaviani Izmiarti Izmiarti, Izmiarti Julita Julita Kiki Ayunda Putri Kurniadi Ilham Liza Febriani Sukma Lubis, Amelia Sriwahyuni Lufri Lufri M. Ali Shafii M. Idris M. Teguh Dhiya Ulhaq Mairawita Mairawita, Mairawita Maliza, Rita Marta Linda Marta, Fepi Dwi Mayola Arda Media Media Meqorry Yusfi Miftah Mussaumi Adi Mildawati Mildawati Mildawati Millania Putri Shayen Millania Putri Shayen Muhammad Azwar Muhammad Hanafi Naura Muthiah Arli Naura Muthiah Arli Naura Muthiah Arli Nazhira - Fadhilah Nini Firmawati Nopiyanti, Tita Novia Rika Deli Nur, Fauziah Nurhafitri, Amanda Olly Norita Tetra Pasha, Gusti Ari Afrilya Periadnadi Periadnadi Prima Fauziah Haq Puspita, Ayumi Rizci Puti Khairunnajwa Amar Putra Santoso Putri Aliyyanti Putri Seti Ayu Putri, Mellanie Alia Putri, Suci Indah Rahma Devi Ramacos Fardela Resti Rahayu Reswita Reswita Reza Oktavia Riesca Salsabilah Rahmayati Rilwan Efendi Rismayani, Dessy Rizqa Zidna Chairafahmi Rusiati, Anisa Rahman Santhyami Santhyami Sherin Dien Salsabila Siagian, Marhamah Solfiyeni Solfiyeni Sri Handani Suci Rahmadani Putri Sumaryati Syukur Suwirmen Suwirmen, Suwirmen Syabila, Hutri Dinda Tesri Maideliza Tesri Maideliza Tiara Tiara Tita Nopiyanti Titiek Rukmini Trengginas Eka Putra Tressa Pratywi Gupitasari Wenny Rahma Gusni Yella Prastika Yuda Yossi Eka Saputri Yulianti, Sisi Zulfi Zulkarnain, Alivia