Claim Missing Document
Check
Articles

Found 35 Documents
Search

PERBANDINGAN IDENTIFIKASI Toxoplasma gondii MENGGUNAKAN METODE POLYMERASE CHAIN REACTION (PCR) DAN METODE ENZYME LINKED FLUORESCENT ASSAY (ELFA) Miftahul Mushlih; Alifia Nurfitriana; Kurnia Wahyu Ningsih; Nurul Azizah; Nia Lukita Arian
Meditory : The Journal of Medical Laboratory Vol 8, No 2 (2020): Meditory, Volume 8, No 2, Tahun 2020
Publisher : Jurusan Analisis Kesehatan, Poltekkes Kemenkes Denpasar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33992/m.v8i2.1266

Abstract

Toxoplasmosis is an infectious disease that does not show specific symptoms. This study aimed to determine the differences results of T. gondii detection in human blood using the PCR (polymerase chain reaction) with the ELFA (Enzym Linked Fluorescent Assay) method. The research was done by descriptive exploratory methods. Samples taken from 9 West Sumatra Pramita Clinics Laboratory and 1 person came from Sidoarjo as a control. Data analyzes was conducted by a chi-square test with a 95% confidence level. In the ELFA method detects IgG Anti-Toxoplasma. Whereas the molecular test detects  B1 gene target. The serological test was able to detect 9 patients of toxoplasmosis and 1 patient was negative/ control. The molecular test showed a specific band with 195 bp in length. The accuracy of the molecular test was 77% (T count (4.4) T table (3.84). Based on the results its can be concluded that there a difference in identification between the PCR method and the ELFA method.
POTENTIAL MOLECULES AGAINST COVID-19 FROM ANNONA MURICATA; AN IN-SILICO APPROACH Miftahul Mushlih; Andika Aliviameita; Puspitasari Puspitasari; Ahmad Shobrun Jamil
TEKNOLOGI MEDIS DAN JURNAL KESEHATAN UMUM Vol 6 No 1 (2022): Medical Technology and Public Health Journal March 2022
Publisher : UNUSA Press

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/mtphj.v6i1.3069

Abstract

At the end of 2019, a new virus emerged from Wuhan, China named Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). The key to viral infection to host cells is the use of the ACE2 receptor. This study aimed to explore the potential of drugs in Annona muricata plant using the Insilico method. Compounds obtained from KNApSAcK Based on the analysis using SwissADME (Lipinski creteria)criteria. 22 compounds passed the selection. Eight ligands were identified as being able to change the conformation of the initial form of RBD and ACE2 attachment. Eight molecules are able to change the initial conformation, namely Asimilobine, Coreximine, (+)-Stepharine, Coclaurine, Norcorydine, N- Nornuciferinhe, methoxyphenyl)methyl]-1,2,3,4-tetrahydroisoquinolin-5-ol, and Atherosperminine.
Kadar Glukosa Darah Puasa Akseptor Kontrasepsi Suntik dan AKDR Siti Cholifah; Paramitha Amelia Kusumawardani; Miftahul Mushlih; Siti Nur Azizah
Jurnal Ilmiah Kesehatan Vol. 14 No. 1 (2021): Jurnal Ilmiah Kesehatan
Publisher : Universitas Muhammadiyah Pekajangan Pekalongan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.48144/jiks.v14i1.536

Abstract

Pengenalan Pemeriksaan Berbasis Nucleic Acid Amplification Tests (NAATs) Di Sekolah Kesehatan Miftahul Mushlih; Puspitasari Puspitasari; Andika Aliviameyta
Darmabakti : Jurnal Pengabdian dan Pemberdayaan Masyarakat Vol 4 No 2 (2023): Darmabakti : Junal Pengabdian dan Pemberdayaan Masyarakat
Publisher : Lembaga Peneliian dan Pengabdian Masyarakat (LPPM) Universitas Islam Madura (UIM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31102/darmabakti.2023.4.2.153-159

Abstract

Perkembangan pemeriksaan terbaru banyak mengarah dengan memanfaatkan kode unik dan spesifik yang ada di DNA. Pemeriksaan ini dikenal luas dengan nukleic acid amplification tests (NAATs). Kesenjangan pendidikan antara perkembangan teknologi dengan penerapan di sekolah memunculkan suatu masalah tersendiri. Tujuan dari kegiatan ini untuk melakukan pengenalan dan workshop secara langsung metode NAATs oleh Prodi teknologi laboratorium medis (TLM), UMSIDA kepada SMK Mitra Sehat Sidoarjo. Kegiatan dilakukan melalui tiga tahap, yaitu penjajakan untuk mengetahui tingkat implementasi pengenalan NAATs di sekolah, Pengenalan dasar teori pemeriksaan, dan Workshop secara langsung, yaitu siswa diajak untuk melakukan praktikum secara langsung pada kasus identifikasi Toxoplasma gondii. Selain dengan melatih keahlian siswa, kemampuan siswa juga diukur melalui pretest dan posttest. Berdasarkan analisis yang dilakukan terdapat peningkatan pengetahuan dan kemampuan siswa dalam mengenal dan melakukan pemeriksaan NAATs.
Validasi Metode Analisa Kadar Logam Fe Pada Rambut Masyarakat di Sekitar Kawasan Industri Semen Corry Handayani; Miftahul Mushlih; Juni Lestari
Jurnal Katalisator Vol 3, No 1 (2018): KATALISATOR
Publisher : LLDIKTI Wilayah X

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (252.45 KB) | DOI: 10.22216/jk.v3i1.2317

Abstract

Logam berat dalam tubuh manusia biasanya terakumulasi pada beberapa organ tubuh seperti ginjal, hati, kuku, jaringan adiposa, dan rambut. Analisis kandungan logam berat pada darah ataupun urin tidak akurat. Logam berat yangberada pada darah atau urine tidak bertahan lama dan dapat segera dikeluarkan melalui siklus metabolism tubuh sedangkan analisis logam berat melalui rambutlebih akurat. Hal ini disebabkan logam berat lebih bertahan lama di rambut. Jumlah logam dalam rambut berkorelasi dengan jumlah logam yang diabsorpsi oleh tubuh. Oleh karena itu, rambut dapat dipakai sebagai biopsi material. Telah dilakukan uji metode destruksi basah untuk penentuan kadar besi (Fe) dalam rambut. Destruksi basah menggunakan campuran HNO3 dan HClO4. Analisis kandungan besi (Fe) hasil destruksi dilakukan dengan Spectrophotometer Serapan Atom (SSA). Untuk menentukan metode destruksi yang lebih valid dilakukan validasi metode yang meliputi uji akurasi, presisi, dan linearitas serta penentuan LoD dan LoQ. Uji presisi dilakukan dengan menghitung persen recovery, yaitu 100.996%. Sementara itu, linearitas kurva standar diperoleh sebesar 0,997% dengan LoD 0.27312 mg/g dan LoQ 0.9104 mg/g Hasil ini dapat digolongkan dalam kategori teliti dapat disimpulkan bahwa metoda destruksi ini dapat dipercaya atau lebih valid untuk analisis Fe dalam Rambut dengan SSA.
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Analysis Of The Inhibitory Ability Of Spike Attachment Of The Delta Variant Of Sars Cov-2 With Ace2 By The Active Compound In Turmeric (Curcuma longa L.) In Silico : Analisis Kemampuan Penghambatan Penempelan Spike Sars Cov-2 Varian Delta Dengan Ace2 Oleh Senyawa Aktif Pada Kunyit (Curcuma longa L.) Secara In Silico Liyaajul, Pratasyah; Mushlih, Miftahul; Rini, Chylen Setiyo; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 6 No. 1 (2023): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v6i1.1703

Abstract

Turmeric (Curcuma longa L.) is an herbal plant that has many benefits as a treatment, including during the COVID-19 pandemic, one of the mechanisms of inhibition of SARS CoV-2 is to inhibit the attachment of ACE2 with Spike. The binding of the spike protein to the ACE2 receptor will produce conformational changes in the S protein, this study was conducted using an in silico method (computational analysis) which aims to determine the potential efficacy of Turmeric and its effectiveness in inhibiting the Delta variant of SARS CoV-2. The active compound contained in Turmeric (Curcuma longa L. ) obtained from the KNApSAcK database To determine compounds that can have potential and have good effectiveness in inhibition of the Delta Variant of SARS CoV-2, an analysis was carried out by looking at the binding energy and conformation changes that occur at the sticky point in each compound. Three-dimensional structure of SARS CoV-2 Varian Delta downloaded from the Protein Data Bank with PDB code 7V8B. Based on the analysis carried out, it was found that the compound (E)-nuciferoll has the lowest binding energy value of -1212.59 kcal / mol and is located at the initial attachment but cannot change the conformation, but from the sticky point of the compound (E)-nuciferol lies in the initial attachment of RBD-ACE2.
Insilico study of Phyllanthus niruri potency as an antiviral Sars Cov 2: Omicron and delta variants : Analisis Potensi Phyllanthus niruri sebagai antivirus Sars Cov 2: varian Omicron dan delta secara insilico Mushlih , Miftahul; Aliviameita, Andika; Puspitasari; Firmansyah, Nukayo; Murosidah, Pratasya Liyaajul
Procedia of Social Sciences and Humanities Vol. 3 (2022): Proceedings of the 1st SENARA 2022
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/pssh.v3i.251

Abstract

Corona Virus Disease 19 (Covid 19) caused by infection with severe acute respiratory syndrome coronavirus 2 (Sars Cov-2). In its development, this virus has several variants due to mutations, including the Omicron (B.1.1.529) and delta (B.1.617.2) variants of concern, one of the keys to infection with this virus is the angiotensin receptor enzyme 2 (ACE-2). This study aimed to explore the potential of Phyllanthus niruri plant insilico. The active plant components were explored from the KNackSAcK family, then selected using Lipinski criteria using SWISS ADME, docking using HEX 8.0. The results of the analysis showed that 5 of the 21 compounds met Lipinski's criteria, i.e Hypophyllanthin, Hinokinin, 4-Methoxynorsecurinine, Nirtetralin, & Lintetralin. Nirtetralin & 4-Methoxynorsecurinine were able to change the binding conformation of RBD-ACE2 in the Omicron variant, while Hinokinin was able to change the binding conformation of RBD-ACE2 in the delta variant. These results were different from the first discovered sars cov 2, in which Hinokinin, 4-Methoxynorsecurinine, & Nirtetralin were able to change the conformation of RBD-ACE2.
Pendampingan Sekolah Dasar Negeri 4 Kupang, Jabon dalam Menghadapi New Normal Mushlih, Miftahul; Segara, Bayu; Hadie, Djauharoh A; Zakaria, Rizal; Aliviameita, Andika
Humanism : Jurnal Pengabdian Masyarakat Vol 1 No 2 (2020): Agustus
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/hm.v1i2.5565

Abstract

Kejadian pandemi Corona menyebabkan perubahan seluruh aspek kehidupan di masyarakat termasuk di dunia pendidikan. Pemerintah telah memutuskan adanya kehidupan normal yang mengharuskan setiap orang terbiasa untuk hidup berdampingan dengan wabah virus Corona. Tujuan dari kegiatan ini adalah untuk memberikan bimbingan dan dukungan fasilitas di SDN 4 Kupang, Jabon, Sidoarjo dalam rangka menghadapi kehidupan dunia normal (new normal) akibat adanya pandemi covid 19. Metode yang digunakan adalah Pembimbingan dan pelatihan kepada guru dan siswa. Peserta dari kegiatan ini meliputi guru SDN 4 Kupang (6 Orang) dan seluruh siswa SD N dari kelas 1 sampai kelas 6 yang berjumlah 19 orang. Hasil dari kegiatan ini adalah ditemukan kendala pada sekolah guna menghadapi kehidupan baru diantaranya meliputi kesulitan menyediakan fasilitas pendukung wajib new normal serta kesadaran siswa yang masih rendah untuk berkegiatan sesuai dengan norma kehidupan baru. Luaran dari kegiatan ini adalah terselesaikannya kendala sekolah di dalam menghadapi kehidupan yang normal dan meningkatnya wawasan guru dan siswa wabah covid 19.
Specific Primer Design of Leucine Rich Repeats and Guanylate Kinase Domain Containing (LRGUK) Genes in Type II Diabetes Mellitus Patients Mushlih, Miftahul; Tis’iyyah , Siti Nur Maghfiroh; Rini, Chylen Setiyo; Sari, Azizah Krismonita
TEKNOLOGI MEDIS DAN JURNAL KESEHATAN UMUM Vol 6 No 2 (2022): Medical Technology and Public Health Journal September 2022
Publisher : Universitas Nahdlatul Ulama Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/mtphj.v6i2.3476

Abstract

Diabetes Mellitus type II (DT2) is a disorder of insulin function (insulin resistance) caused by 2 factors, i.e. environmental and genetic factors. Previous studies have identified the presence of specific alleles that differentiate between DT2 and non-DT2 sufferers. Identification of the allele indicated leucine rich repeats and guanylate kinase domain containing (LRGUK) gene. The aim of this research was to design a specific primer to amplify LRGUK gene. The primer design was based on a 576 bp nucleotide base and added 100 bp in the 5'  and 100 bp in the 3' direction using NCBI-Primer BLAST. The primers produced were selected based on eight criteria’s. The results were validated with 6 samples of DT2 patients and visualized using agarose gel. The results of the analysis showed that the primers Forward 5'-TCCTACTCTGTGTCCTTCCTTG-3' and Reverse 5'-GTGGTGACAAGGAGG TTTGC-3' were able to amplify specifically with a length of 687 bp.