Article Per Year (5 Year)
p-Index From 2021 - 2026
3.215
P-Index
This Author published in this journals
All Journal Jurnal Teknologi Laboratorium Journal of Health (JoH) Medical Laboratory Technology Journal THE JOURNAL OF MUHAMMADIYAH MEDICAL LABORATORY TECHNOLOGIST Meditory : The Journal of Medical Laboratory Journal of Health Sciences Medical Technology and Public Health Journal Medical Laboratory Analysis and Sciences Journal JURNAL ANALIS LABORATORIUM MEDIK Jurnal Riset Biologi dan Aplikasinya Sains dan Matematika Medicra (Journal of Medical Laboratory Science/Technology) Darmabakti : Junal Pengabdian dan Pemberdayaan Masyarakat Jurnal Pengabdian Masyarakat dalam Kesehatan Humanism : Jurnal Pengabdian Masyarakat Jurnal Abdimas Kartika Wijayakusuma Indonesian Journal of Innovation Studies Manajemen Pelayanan Kesehatan Indonesian Journal Health Science and Medicine Academia Open
Miftahul Mushlih
Universitas Muhammadiyah Sidoarjo
Religion Agriculture, Biological Sciences & Forestry Humanities Astronomy Biochemistry, Genetics & Molecular Biology Chemistry Computer Science & IT Dentistry Education Engineering Environmental Science Health Professions Immunology & microbiology Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Veterinary Other

Published : 34 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 34 Documents
Search

 1   2   3   4 
PERBANDINGAN IDENTIFIKASI Toxoplasma gondii MENGGUNAKAN METODE POLYMERASE CHAIN REACTION (PCR) DAN METODE ENZYME LINKED FLUORESCENT ASSAY (ELFA) Miftahul Mushlih; Alifia Nurfitriana; Kurnia Wahyu Ningsih; Nurul Azizah; Nia Lukita Arian
Meditory : The Journal of Medical Laboratory Vol 8, No 2 (2020): Meditory, Volume 8, No 2, Tahun 2020
Publisher : Jurusan Analisis Kesehatan, Poltekkes Kemenkes Denpasar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33992/m.v8i2.1266

Abstract

Toxoplasmosis is an infectious disease that does not show specific symptoms. This study aimed to determine the differences results of T. gondii detection in human blood using the PCR (polymerase chain reaction) with the ELFA (Enzym Linked Fluorescent Assay) method. The research was done by descriptive exploratory methods. Samples taken from 9 West Sumatra Pramita Clinics Laboratory and 1 person came from Sidoarjo as a control. Data analyzes was conducted by a chi-square test with a 95% confidence level. In the ELFA method detects IgG Anti-Toxoplasma. Whereas the molecular test detects  B1 gene target. The serological test was able to detect 9 patients of toxoplasmosis and 1 patient was negative/ control. The molecular test showed a specific band with 195 bp in length. The accuracy of the molecular test was 77% (T count (4.4) T table (3.84). Based on the results its can be concluded that there a difference in identification between the PCR method and the ELFA method.
POTENTIAL MOLECULES AGAINST COVID-19 FROM ANNONA MURICATA; AN IN-SILICO APPROACH Miftahul Mushlih; Andika Aliviameita; Puspitasari Puspitasari; Ahmad Shobrun Jamil
TEKNOLOGI MEDIS DAN JURNAL KESEHATAN UMUM Vol 6 No 1 (2022): Medical Technology and Public Health Journal March 2022
Publisher : UNUSA Press

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/mtphj.v6i1.3069

Abstract

At the end of 2019, a new virus emerged from Wuhan, China named Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). The key to viral infection to host cells is the use of the ACE2 receptor. This study aimed to explore the potential of drugs in Annona muricata plant using the Insilico method. Compounds obtained from KNApSAcK Based on the analysis using SwissADME (Lipinski creteria)criteria. 22 compounds passed the selection. Eight ligands were identified as being able to change the conformation of the initial form of RBD and ACE2 attachment. Eight molecules are able to change the initial conformation, namely Asimilobine, Coreximine, (+)-Stepharine, Coclaurine, Norcorydine, N- Nornuciferinhe, methoxyphenyl)methyl]-1,2,3,4-tetrahydroisoquinolin-5-ol, and Atherosperminine.
Pengenalan Pemeriksaan Berbasis Nucleic Acid Amplification Tests (NAATs) Di Sekolah Kesehatan Miftahul Mushlih; Puspitasari Puspitasari; Andika Aliviameyta
Darmabakti : Jurnal Pengabdian dan Pemberdayaan Masyarakat Vol 4 No 2 (2023): Darmabakti : Junal Pengabdian dan Pemberdayaan Masyarakat
Publisher : Lembaga Peneliian dan Pengabdian Masyarakat (LPPM) Universitas Islam Madura (UIM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31102/darmabakti.2023.4.2.153-159

Abstract

Perkembangan pemeriksaan terbaru banyak mengarah dengan memanfaatkan kode unik dan spesifik yang ada di DNA. Pemeriksaan ini dikenal luas dengan nukleic acid amplification tests (NAATs). Kesenjangan pendidikan antara perkembangan teknologi dengan penerapan di sekolah memunculkan suatu masalah tersendiri. Tujuan dari kegiatan ini untuk melakukan pengenalan dan workshop secara langsung metode NAATs oleh Prodi teknologi laboratorium medis (TLM), UMSIDA kepada SMK Mitra Sehat Sidoarjo. Kegiatan dilakukan melalui tiga tahap, yaitu penjajakan untuk mengetahui tingkat implementasi pengenalan NAATs di sekolah, Pengenalan dasar teori pemeriksaan, dan Workshop secara langsung, yaitu siswa diajak untuk melakukan praktikum secara langsung pada kasus identifikasi Toxoplasma gondii. Selain dengan melatih keahlian siswa, kemampuan siswa juga diukur melalui pretest dan posttest. Berdasarkan analisis yang dilakukan terdapat peningkatan pengetahuan dan kemampuan siswa dalam mengenal dan melakukan pemeriksaan NAATs.
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples: Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 3 No. 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Analysis Of The Inhibitory Ability Of Spike Attachment Of The Delta Variant Of Sars Cov-2 With Ace2 By The Active Compound In Turmeric (Curcuma longa L.) In Silico : Analisis Kemampuan Penghambatan Penempelan Spike Sars Cov-2 Varian Delta Dengan Ace2 Oleh Senyawa Aktif Pada Kunyit (Curcuma longa L.) Secara In Silico Liyaajul, Pratasyah; Mushlih, Miftahul; Rini, Chylen Setiyo; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol. 6 No. 1 (2023): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v6i1.1703

Abstract

Turmeric (Curcuma longa L.) is an herbal plant that has many benefits as a treatment, including during the COVID-19 pandemic, one of the mechanisms of inhibition of SARS CoV-2 is to inhibit the attachment of ACE2 with Spike. The binding of the spike protein to the ACE2 receptor will produce conformational changes in the S protein, this study was conducted using an in silico method (computational analysis) which aims to determine the potential efficacy of Turmeric and its effectiveness in inhibiting the Delta variant of SARS CoV-2. The active compound contained in Turmeric (Curcuma longa L. ) obtained from the KNApSAcK database To determine compounds that can have potential and have good effectiveness in inhibition of the Delta Variant of SARS CoV-2, an analysis was carried out by looking at the binding energy and conformation changes that occur at the sticky point in each compound. Three-dimensional structure of SARS CoV-2 Varian Delta downloaded from the Protein Data Bank with PDB code 7V8B. Based on the analysis carried out, it was found that the compound (E)-nuciferoll has the lowest binding energy value of -1212.59 kcal / mol and is located at the initial attachment but cannot change the conformation, but from the sticky point of the compound (E)-nuciferol lies in the initial attachment of RBD-ACE2.
Pendampingan Sekolah Dasar Negeri 4 Kupang, Jabon dalam Menghadapi New Normal Mushlih, Miftahul; Segara, Bayu; Hadie, Djauharoh A; Zakaria, Rizal; Aliviameita, Andika
Humanism : Jurnal Pengabdian Masyarakat Vol 1 No 2 (2020): Agustus
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/hm.v1i2.5565

Abstract

Kejadian pandemi Corona menyebabkan perubahan seluruh aspek kehidupan di masyarakat termasuk di dunia pendidikan. Pemerintah telah memutuskan adanya kehidupan normal yang mengharuskan setiap orang terbiasa untuk hidup berdampingan dengan wabah virus Corona. Tujuan dari kegiatan ini adalah untuk memberikan bimbingan dan dukungan fasilitas di SDN 4 Kupang, Jabon, Sidoarjo dalam rangka menghadapi kehidupan dunia normal (new normal) akibat adanya pandemi covid 19. Metode yang digunakan adalah Pembimbingan dan pelatihan kepada guru dan siswa. Peserta dari kegiatan ini meliputi guru SDN 4 Kupang (6 Orang) dan seluruh siswa SD N dari kelas 1 sampai kelas 6 yang berjumlah 19 orang. Hasil dari kegiatan ini adalah ditemukan kendala pada sekolah guna menghadapi kehidupan baru diantaranya meliputi kesulitan menyediakan fasilitas pendukung wajib new normal serta kesadaran siswa yang masih rendah untuk berkegiatan sesuai dengan norma kehidupan baru. Luaran dari kegiatan ini adalah terselesaikannya kendala sekolah di dalam menghadapi kehidupan yang normal dan meningkatnya wawasan guru dan siswa wabah covid 19.
Specific Primer Design of Leucine Rich Repeats and Guanylate Kinase Domain Containing (LRGUK) Genes in Type II Diabetes Mellitus Patients Mushlih, Miftahul; Tis’iyyah , Siti Nur Maghfiroh; Rini, Chylen Setiyo; Sari, Azizah Krismonita
TEKNOLOGI MEDIS DAN JURNAL KESEHATAN UMUM Vol 6 No 2 (2022): Medical Technology and Public Health Journal September 2022
Publisher : Universitas Nahdlatul Ulama Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/mtphj.v6i2.3476

Abstract

Diabetes Mellitus type II (DT2) is a disorder of insulin function (insulin resistance) caused by 2 factors, i.e. environmental and genetic factors. Previous studies have identified the presence of specific alleles that differentiate between DT2 and non-DT2 sufferers. Identification of the allele indicated leucine rich repeats and guanylate kinase domain containing (LRGUK) gene. The aim of this research was to design a specific primer to amplify LRGUK gene. The primer design was based on a 576 bp nucleotide base and added 100 bp in the 5'  and 100 bp in the 3' direction using NCBI-Primer BLAST. The primers produced were selected based on eight criteria’s. The results were validated with 6 samples of DT2 patients and visualized using agarose gel. The results of the analysis showed that the primers Forward 5'-TCCTACTCTGTGTCCTTCCTTG-3' and Reverse 5'-GTGGTGACAAGGAGG TTTGC-3' were able to amplify specifically with a length of 687 bp.
Kelelahan Tenaga Kesehatan: Penurunan Kualitas Layanan di Indonesia Imamah, Siti Aliyatul; Rini, Chylen Setiyo; Puspitasari, Puspitasari; Mushlih, Miftahul
Manajemen Pelayanan Kesehatan Vol. 1 No. 1 (2024): Januari
Publisher : Indonesian Journal Publisher

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47134/mpk.v1i1.2923

Abstract

Burnout merupakan sindrom stres yang berhubungan dengan pekerjaan, seperti kelelahan emosional, sinisme dan ketidakefektifan profesional. Tujuan penelitian ini untuk mengetahui pengaruh Burnout Tenaga Kesehatan Terhadap Kualitas Pelayanan Di Rumah Sakit Bhayangkara Pusdik Sabhara Sidoarjo. Desain penelitian ini dilakukan secara eksperimental dengan menggunakan metode cross sectional study. Hasil penelitian menunjukkan adanya pengaruh burnout tenaga kesehatan terhadap kualitas pelayanan di Rumah Sakit Bhayangkara Pusdik Sabhara Sidoarjo. Pada kategori burnout cukup dan burnout sedang terdapat pengaruh yang signifikan dengan kualitas pelayanan, namun pada kategori burnout tinggi tidak terdapat pengaruh dengan kualitas pelayanan.
Peningkatan Keterampilan Siswa Pada Pemeriksaan Mikrobiologi Air Minum Di SMK Muhammadiyah 1 Pandaan Rini, Chylen Setiyo; Mushlih, Miftahul; Efendi, Nur; Rohmah, Jamilatur
Jurnal Abdimas Kartika Wijayakusuma Vol 6 No 2 (2025): Jurnal Abdimas Kartika Wijayakusuma
Publisher : LPPM Universitas Jenderal Achmad Yani

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26874/jakw.v6i2.876

Abstract

Air sangat penting bagi kelangsungan hidup manusia, karena manusia sebagai makhluk hidup sangat membutuhkannya. Air minum adalah air yang sudah mengalami atau tidak mengalami proses pengolahan, namun tetap memenuhi standar kesehatan dan aman untuk langsung dikonsumsi. Salah satu syarat kriteria yang untuk memenuhi standar air minum yang berkualitas yakni kriteria biologis yang terbebas dari kontaminasi bakteri, terutama yang bersifat patogen. Pemeriksaan mikrobiologi belum diajarkan pada sekolah SMK Muhammadiyah 1 Pandaan. Melihat kondisi tersebut, tim pengabdi masyarakat TLM UMSIDA bekerja sama dengan SMK Muhammadiyah 1 Pandaan memberikan pelatihan pemeriksaan mikrobiologi dari sampel air minum. Kegiatan pengabdian kepada masyarakat dilakukan pada Juli-Agustus 2024 yang diikuti 53 siswa/i.. Hasil analisis dari kegiatan ini yaitu meningkatnya pemahaman dari siswa/i mengenai pemeriksaan mikrobiologi dari sampel air minum.
Optimasi Kecepatan Sentrifugasi Sampel Darah untuk Pemeriksaan Diabetes Melitus Tipe 2 (T2D) Berbasis Molekuler Miftahul Mushlih; Fitrian Desi Prameswari; Jamilatur Rohmah; Andika Aliviameita; Mushlih, Miftahul
Journal of Health Vol. 12 No. 2 (2025): Journal of Health (JoH) - July
Publisher : LPPM STIKES Guna Bangsa Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30590/joh.v12n2.5

Abstract

Type 2 Diabetes Mellitus (T2D) is a metabolic disorder caused by dysfunction of insulin secretion by pancreatic beta cells and the inability of insulin tissue to respond appropriately to insulin. Molecular-based examination can make it easier to determine appropriate diagnostic biomarkers and the biology of this disease appears long before clinical symptoms develop. Blood isolation samples from the buffy coat contained higher levels of DNA than whole blood samples. The aim of this research is to determine whether there are differences in the results of the centrifugation speed of blood samples for molecular-based examination of Type 2 Diabetes Mellitus (T2D). Optimal centrifugation speed can produce high-quality DNA required for molecular analysis, thereby improving the accuracy of diagnosis and effectiveness of T2D treatment. DNA contaminated by cellular debris can result in small amounts of DNA obtained for further analysis. The research was carried out qualitatively using descriptive experimental research using purposive sampling techniques. The total samples used were 25 samples, taken from 5 patients and then divided into 5 treatment groups (no centrifugation, centrifugation speed 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes). Test testing is carried out qualitatively (electrophoresis). The results showed that there was no significant difference in DNA visualization in molecular examination of T2D disease between blood samples that were not centrifuged and those that were centrifuged at speeds of 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes. However, centrifugation speeds between 1500 rpm and 4500 rpm showed thicker and clearer DNA bands.
Co-Authors Ahmad Shobrun Jamil Aini, Aqiliyanti Nur Alifia Nurfitriana Amin, Hindah Sabrina Andika Aliviameita Andika Aliviameyta Anggie Wedha Puspita Apriliana, Dinda ARDIANSYAH, SYAHRUL Arief Wisaksono Aulia, Faradila Nur Azhar, Risya Auliya' Putri Azhar, Risya Auliya’ Putri Bayu Segara Budi Setiadi Daryono Chylen Setiyo Rini Dewanata, Pandu Aji Dian Delta Dina Trikumalasari Djauharoh Djauharoh Evi Rinata Firda, Aminatul Fitri Kumala Sari Fitrian Desi Prameswari Galuh Ratmana Hanum Hadie, Djauharoh A Hindah Sabrina Amin Huesein, Iknan, Siti Asriani Imamah, Siti Aliyatul Jamilatur Rohmah Jayanti, Liah Dwi Kartikasari, Erina Wahyu Kurnia Wahyu Ningsih Livia Nur Azzah Liyaajul, Pratasyah Meryn Linanda Agustin Nia Lukita Arian NUR EFENDI NURUL AZIZAH Nurul Azizah Paramitha Amelia Kusumawardani Puspitasari Puspitasari Puspitasari Puspitasari Puspitasari Qilmia Fanani Rohman Dijaya Sari, Azizah Krismonita Sari, Fitri Kumala Segara, Bayu Siska Aprilia Siti Asriani Iknan Siti Cholifah Sitti Nur Qablyatin Syabandia Tis’iyyah , Siti Nur Maghfiroh Wa Ode Asma`Ul Husna Huesein Wardana, Aji Cakra Yanik Purwanti Zakaria, Rizal