Garuda - Garba Rujukan Digital

Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples Amin, Hindah Sabrina; Mushlih, Miftahul
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

Analysis Of The Inhibitory Ability Of Spike Attachment Of The Delta Variant Of Sars Cov-2 With Ace2 By The Active Compound In Turmeric (Curcuma longa L.) In Silico Liyaajul, Pratasyah; Mushlih, Miftahul; Rini, Chylen Setiyo; Rohmah, Jamilatur
Medicra (Journal of Medical Laboratory Science/Technology) Vol 6 No 1 (2023): July
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v6i1.1703

Turmeric (Curcuma longa L.) is an herbal plant that has many benefits as a treatment, including during the COVID-19 pandemic, one of the mechanisms of inhibition of SARS CoV-2 is to inhibit the attachment of ACE2 with Spike. The binding of the spike protein to the ACE2 receptor will produce conformational changes in the S protein, this study was conducted using an in silico method (computational analysis) which aims to determine the potential efficacy of Turmeric and its effectiveness in inhibiting the Delta variant of SARS CoV-2. The active compound contained in Turmeric (Curcuma longa L. ) obtained from the KNApSAcK database To determine compounds that can have potential and have good effectiveness in inhibition of the Delta Variant of SARS CoV-2, an analysis was carried out by looking at the binding energy and conformation changes that occur at the sticky point in each compound. Three-dimensional structure of SARS CoV-2 Varian Delta downloaded from the Protein Data Bank with PDB code 7V8B. Based on the analysis carried out, it was found that the compound (E)-nuciferoll has the lowest binding energy value of -1212.59 kcal / mol and is located at the initial attachment but cannot change the conformation, but from the sticky point of the compound (E)-nuciferol lies in the initial attachment of RBD-ACE2.

Pendampingan Sekolah Dasar Negeri 4 Kupang, Jabon dalam Menghadapi New Normal Mushlih, Miftahul; Segara, Bayu; Hadie, Djauharoh A; Zakaria, Rizal; Aliviameita, Andika
Humanism : Jurnal Pengabdian Masyarakat Vol 1 No 2 (2020): Agustus
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/hm.v1i2.5565

Kejadian pandemi Corona menyebabkan perubahan seluruh aspek kehidupan di masyarakat termasuk di dunia pendidikan. Pemerintah telah memutuskan adanya kehidupan normal yang mengharuskan setiap orang terbiasa untuk hidup berdampingan dengan wabah virus Corona. Tujuan dari kegiatan ini adalah untuk memberikan bimbingan dan dukungan fasilitas di SDN 4 Kupang, Jabon, Sidoarjo dalam rangka menghadapi kehidupan dunia normal (new normal) akibat adanya pandemi covid 19. Metode yang digunakan adalah Pembimbingan dan pelatihan kepada guru dan siswa. Peserta dari kegiatan ini meliputi guru SDN 4 Kupang (6 Orang) dan seluruh siswa SD N dari kelas 1 sampai kelas 6 yang berjumlah 19 orang. Hasil dari kegiatan ini adalah ditemukan kendala pada sekolah guna menghadapi kehidupan baru diantaranya meliputi kesulitan menyediakan fasilitas pendukung wajib new normal serta kesadaran siswa yang masih rendah untuk berkegiatan sesuai dengan norma kehidupan baru. Luaran dari kegiatan ini adalah terselesaikannya kendala sekolah di dalam menghadapi kehidupan yang normal dan meningkatnya wawasan guru dan siswa wabah covid 19.

Specific Primer Design of Leucine Rich Repeats and Guanylate Kinase Domain Containing (LRGUK) Genes in Type II Diabetes Mellitus Patients Mushlih, Miftahul; Tis’iyyah , Siti Nur Maghfiroh; Rini, Chylen Setiyo; Sari, Azizah Krismonita
TEKNOLOGI MEDIS DAN JURNAL KESEHATAN UMUM Vol 6 No 2 (2022): Medical Technology and Public Health Journal September 2022
Publisher : Universitas Nahdlatul Ulama Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33086/mtphj.v6i2.3476

Diabetes Mellitus type II (DT2) is a disorder of insulin function (insulin resistance) caused by 2 factors, i.e. environmental and genetic factors. Previous studies have identified the presence of specific alleles that differentiate between DT2 and non-DT2 sufferers. Identification of the allele indicated leucine rich repeats and guanylate kinase domain containing (LRGUK) gene. The aim of this research was to design a specific primer to amplify LRGUK gene. The primer design was based on a 576 bp nucleotide base and added 100 bp in the 5' and 100 bp in the 3' direction using NCBI-Primer BLAST. The primers produced were selected based on eight criteria’s. The results were validated with 6 samples of DT2 patients and visualized using agarose gel. The results of the analysis showed that the primers Forward 5'-TCCTACTCTGTGTCCTTCCTTG-3' and Reverse 5'-GTGGTGACAAGGAGG TTTGC-3' were able to amplify specifically with a length of 687 bp.

Kelelahan Tenaga Kesehatan: Penurunan Kualitas Layanan di Indonesia Imamah, Siti Aliyatul; Rini, Chylen Setiyo; Puspitasari, Puspitasari; Mushlih, Miftahul
Manajemen Pelayanan Kesehatan Vol. 1 No. 1 (2024): Januari
Publisher : Indonesian Journal Publisher

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.47134/mpk.v1i1.2923

Burnout merupakan sindrom stres yang berhubungan dengan pekerjaan, seperti kelelahan emosional, sinisme dan ketidakefektifan profesional. Tujuan penelitian ini untuk mengetahui pengaruh Burnout Tenaga Kesehatan Terhadap Kualitas Pelayanan Di Rumah Sakit Bhayangkara Pusdik Sabhara Sidoarjo. Desain penelitian ini dilakukan secara eksperimental dengan menggunakan metode cross sectional study. Hasil penelitian menunjukkan adanya pengaruh burnout tenaga kesehatan terhadap kualitas pelayanan di Rumah Sakit Bhayangkara Pusdik Sabhara Sidoarjo. Pada kategori burnout cukup dan burnout sedang terdapat pengaruh yang signifikan dengan kualitas pelayanan, namun pada kategori burnout tinggi tidak terdapat pengaruh dengan kualitas pelayanan.

Peningkatan Keterampilan Siswa Pada Pemeriksaan Mikrobiologi Air Minum Di SMK Muhammadiyah 1 Pandaan Rini, Chylen Setiyo; Mushlih, Miftahul; Efendi, Nur; Rohmah, Jamilatur
Jurnal Abdimas Kartika Wijayakusuma Vol 6 No 2 (2025): Jurnal Abdimas Kartika Wijayakusuma
Publisher : LPPM Universitas Jenderal Achmad Yani

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26874/jakw.v6i2.876

Air sangat penting bagi kelangsungan hidup manusia, karena manusia sebagai makhluk hidup sangat membutuhkannya. Air minum adalah air yang sudah mengalami atau tidak mengalami proses pengolahan, namun tetap memenuhi standar kesehatan dan aman untuk langsung dikonsumsi. Salah satu syarat kriteria yang untuk memenuhi standar air minum yang berkualitas yakni kriteria biologis yang terbebas dari kontaminasi bakteri, terutama yang bersifat patogen. Pemeriksaan mikrobiologi belum diajarkan pada sekolah SMK Muhammadiyah 1 Pandaan. Melihat kondisi tersebut, tim pengabdi masyarakat TLM UMSIDA bekerja sama dengan SMK Muhammadiyah 1 Pandaan memberikan pelatihan pemeriksaan mikrobiologi dari sampel air minum. Kegiatan pengabdian kepada masyarakat dilakukan pada Juli-Agustus 2024 yang diikuti 53 siswa/i.. Hasil analisis dari kegiatan ini yaitu meningkatnya pemahaman dari siswa/i mengenai pemeriksaan mikrobiologi dari sampel air minum.

Optimasi Kecepatan Sentrifugasi Sampel Darah untuk Pemeriksaan Diabetes Melitus Tipe 2 (T2D) Berbasis Molekuler Miftahul Mushlih; Fitrian Desi Prameswari; Jamilatur Rohmah; Andika Aliviameita; Mushlih, Miftahul
Journal of Health Vol. 12 No. 2 (2025): Journal of Health (JoH) - July
Publisher : LPPM STIKES Guna Bangsa Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30590/joh.v12n2.5

Type 2 Diabetes Mellitus (T2D) is a metabolic disorder caused by dysfunction of insulin secretion by pancreatic beta cells and the inability of insulin tissue to respond appropriately to insulin. Molecular-based examination can make it easier to determine appropriate diagnostic biomarkers and the biology of this disease appears long before clinical symptoms develop. Blood isolation samples from the buffy coat contained higher levels of DNA than whole blood samples. The aim of this research is to determine whether there are differences in the results of the centrifugation speed of blood samples for molecular-based examination of Type 2 Diabetes Mellitus (T2D). Optimal centrifugation speed can produce high-quality DNA required for molecular analysis, thereby improving the accuracy of diagnosis and effectiveness of T2D treatment. DNA contaminated by cellular debris can result in small amounts of DNA obtained for further analysis. The research was carried out qualitatively using descriptive experimental research using purposive sampling techniques. The total samples used were 25 samples, taken from 5 patients and then divided into 5 treatment groups (no centrifugation, centrifugation speed 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes). Test testing is carried out qualitatively (electrophoresis). The results showed that there was no significant difference in DNA visualization in molecular examination of T2D disease between blood samples that were not centrifuged and those that were centrifuged at speeds of 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes. However, centrifugation speeds between 1500 rpm and 4500 rpm showed thicker and clearer DNA bands.

Optimasi Kecepatan Sentrifugasi Sampel Darah untuk Pemeriksaan Diabetes Melitus Tipe 2 (T2D) Berbasis Molekuler Miftahul Mushlih; Fitrian Desi Prameswari; Jamilatur Rohmah; Andika Aliviameita; Mushlih, Miftahul
Journal of Health Vol. 12 No. 2 (2025): Journal of Health (JoH) - July
Publisher : LPPM STIKES Guna Bangsa Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30590/joh.v12n2.5

Type 2 Diabetes Mellitus (T2D) is a metabolic disorder caused by dysfunction of insulin secretion by pancreatic beta cells and the inability of insulin tissue to respond appropriately to insulin. Molecular-based examination can make it easier to determine appropriate diagnostic biomarkers and the biology of this disease appears long before clinical symptoms develop. Blood isolation samples from the buffy coat contained higher levels of DNA than whole blood samples. The aim of this research is to determine whether there are differences in the results of the centrifugation speed of blood samples for molecular-based examination of Type 2 Diabetes Mellitus (T2D). Optimal centrifugation speed can produce high-quality DNA required for molecular analysis, thereby improving the accuracy of diagnosis and effectiveness of T2D treatment. DNA contaminated by cellular debris can result in small amounts of DNA obtained for further analysis. The research was carried out qualitatively using descriptive experimental research using purposive sampling techniques. The total samples used were 25 samples, taken from 5 patients and then divided into 5 treatment groups (no centrifugation, centrifugation speed 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes). Test testing is carried out qualitatively (electrophoresis). The results showed that there was no significant difference in DNA visualization in molecular examination of T2D disease between blood samples that were not centrifuged and those that were centrifuged at speeds of 500 rpm, 1500 rpm, 3000 rpm and 4500 rpm for 5 minutes. However, centrifugation speeds between 1500 rpm and 4500 rpm showed thicker and clearer DNA bands.

Dermatophyte Fungi Causing Tinea Unguium in Toenails of Builders in Bangkalan: Jamur Dermatophyte Penyebab Tinea Unguium pada Kuku Jari Kaki Pekerja Konstruksi di Bangkalan Aini, Aqiliyanti Nur; Rini, Chylen Setiyo; Mushlih, Miftahul; Puspitasari
Indonesian Journal on Health Science and Medicine Vol. 2 No. 2 (2025): Oktober
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/ijhsm.v2i2.219

General Background: Tinea unguium is a nail plate infection commonly caused by dermatophyte fungi, frequently affecting individuals exposed to moist and contaminated environments. Specific Background: Builders are one of the occupational groups at high risk due to their constant contact with damp, dirty, and unhygienic surroundings. Knowledge Gap: Despite its prevalence, limited studies have focused on identifying specific dermatophyte species responsible for toenail infections among construction workers in Bangkalan, Madura. Aims: This study aimed to identify dermatophyte fungi causing Tinea unguium in the toenails of builders in Bangkalan. Results: Using a descriptive cross-sectional design with 28 purposively selected nail samples, findings revealed infections in 18 participants by Trichophyton rubrum, Trichophyton mentagrophytes, and Epidermatophyton floccosum, while 10 samples showed non-dermatophyte fungi (Aspergillus sp. and Scopulariopsis). Novelty: This research provides the first documentation of both dermatophyte and non-dermatophyte fungi associated with toenail infections among builders in this region. Implications: The findings underscore the need for occupational health awareness and preventive strategies targeting fungal nail infections among construction workers. Highlights: First identification of toenail dermatophytes in builders of Bangkalan. Found both dermatophyte and non-dermatophyte fungi species. Supports occupational health awareness for fungal infections. Keywords: Tinea Unguium, Dermatophyta, Toenails, Builders, Bangkalan

Body Mass Index and Cholesterol and Uric Acid Levels in Diabetes: Indeks Massa Tubuh dan Kadar Kolesterol serta Asam Urat pada Penderita Diabetes Aulia, Faradila Nur; Mushlih, Miftahul
Indonesian Journal on Health Science and Medicine Vol. 2 No. 2 (2025): Oktober
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/ijhsm.v2i2.221

General Background: Diabetes mellitus (DM) is a chronic metabolic disorder affecting millions worldwide, often linked to impaired insulin secretion or function. Specific Background: Dyslipidemia and hyperuricemia are frequent metabolic disturbances in DM, and body mass index (BMI) is commonly used to assess nutritional status, yet its role in predicting cholesterol and uric acid levels among DM patients remains unclear. Knowledge Gap: While previous studies suggest possible associations, evidence on whether BMI significantly correlates with cholesterol and uric acid in DM is inconsistent. Aim: This study investigated the relationship between BMI and cholesterol and uric acid levels in DM patients. Results: A cross-sectional study of 30 respondents at Anna Medika Madura General Hospital used CHOD-PAP and Uricase-PAP methods, showing cholesterol levels ranging 136–278 mg/dl, uric acid 3.4–12.1 mg/dl, and BMI 18.0–34.5 kg/m². Statistical analysis (Chi-square, p > 0.05) indicated no significant association between BMI and cholesterol or uric acid. Novelty: This study emphasizes that BMI alone is insufficient to predict lipid and uric acid abnormalities in DM patients. Implications: Findings highlight the need for comprehensive metabolic assessment beyond BMI for effective DM management. Highlights: No significant link between BMI and cholesterol or uric acid in DM. BMI values ranged from normal to obese, but metabolic changes varied. Clinical monitoring of DM requires broader parameters beyond BMI. Keywords: Diabetes Mellitus, Body Mass Index, Cholesterol, Uric Acid, Cross-Sectional Study

Title

Found 30 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 30 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 30 Documents
Search