Claim Missing Document
Check
Articles

Found 8 Documents
Search
Journal : AQUATIC SCIENCE

Community structure of seagrass beds in Arakan, South Minahasa Regency Merly, Sendy L; Wagey, Billy T; Gerung, Grevo S
AQUATIC SCIENCE & MANAGEMENT Vol 1, No 1 (2013): April
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.1.1.2013.1966

Abstract

Arakan waters is located in front of Arakan Wawontulap district as part of Bunaken National Park. This area has a vast seagrass meadow of 1943.45 ha. Seagrass-Watch method combined with line transect and quadrat methods were used to collected data. Four seagrass species were identified such as Halophila ovalis, Thalassia hemprichii, Enhalus acoroides and Syringodium isoetifolium. Diversity Index (H') was quite high at 1.2071 and was inversely correlated to the value of dominance (D) at 0.3366, and this was supported by the presence of a uniform species (J') of 0.8707. Important Index Value (INP) was highest at station I comprising E. acoroides species, and station II comprising E. acoroides and T. hemprichii, while the third station comprised T. hemprichii. Spatial distribution of the three stations ranged from random to contagious (aggregated)© Perairan Desa Arakan termasuk dalam kawasan Taman Nasional Bunaken wilayah Arakan Wawontulap yang memiliki luas area padang lamun sekitar 1.943,45 Ha. Data dikoleksi menggunakan metode seagrass-watch yang dikombinasikan dengan metoda transek garis dan kuadran. Empat spesies lamun berhasil diidentifikasi yaitu Halophila ovalis, Thalassia hemprichii, Enhalus acoroides dan Syringodium isoetifolium. Nilai Indeks Keanekaragaman (H’) cukup tinggi yakni 1,2071 berbanding terbalik dengan Nilai Dominansi (D) yang rendah yakni 0,3366 dan ditunjang dengan keberadaan spesies yang merata (J’) senilai 0,8707. Indeks Nilai Penting (INP) tertinggi pada Stasiun I diperlihatkan oleh E.acoroides, Stasiun II oleh E.acoroides dan T.hemprichii, dan sedangkan Stasiun III oleh T. hemprichii. Adapun pola penyebaran pada ketiga stasiun ini berkisar antara acak (random) dan mengelompok (contagious)©
DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency Hengkengbala, Irvan R; Gerung, Grevo S; Wullur, Stenly
AQUATIC SCIENCE & MANAGEMENT Vol 6, No 2 (2018): October
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.6.2.2018.24836

Abstract

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.
Community structure of seaweed beds in Mantehage Island, North Sulawesi, Indonesia Sormin, Hartarto; Gerung, Grevo S.; Rembet, Unstain N.W.J.
AQUATIC SCIENCE & MANAGEMENT Vol 3, No 2 (2015): Oktober
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.3.2.2015.14043

Abstract

Title (Bahasa Indonesia): Struktur komunitas rumput laut di Pulau Mantehage, Provinsi Sulawesi Utara Seaweeds are an important marine resource for coastal community. They are used as medicine, paper materials, biofuel and direct consumption as vegetable or in food industries. Data collection in Mantehage island used Seagrass Watch method combined with line transect method with quadrat. This study found 29 species of seaweeds consisting of 13 species of Chlorophyta, 4 species of Phaeophtya and 12 species of Rhodophyta. Water temperatures ranged from 28–30ºC and pH ranged from 8.14–8.69, while salinity ranged between 30.8–31.9 ppt. Mantehage island waters has 100 % visibility with the current speed range of 30–42 cm/sec. INP of Caulerpa racemosa has the highest value at all sites. Diversity index ranged from 0.799–1.093 considered as low and dominance index ranged between 0.635–0.697 categorized as normal. Eveness index ranged from 0.303–0.365 showing that the seaweed community was under pressures. Rumput laut pada saat ini menjadi komoditas penting bagi masyarakat pesisir. Manfaat rumput laut selain dikonsumsi juga dijadikan sebagai obat, bahan baku kertas dan biofuel. Data di pulau Mantehege dikumpulkan menggunakan metode Seagrass watch yang dikombinasikan dengan metode transek garis dan kuadran. Ditemukan 29 spesies rumput laut yang terdiri dari 13 alga hijau Clorophyta, 4 alga cokelat Phaeyophtya dan 12 alga merah Rhodophyta. Substrat pada lokasi penelitian berupa karang mati dan batu karang. Suhu di perairan Pulau Mantehage di lokasi penelitian berkisar 28–30ºC. pH di lokasi penelitian yaitu 8,14–8,69 dengan salinitas berkisar 30,8–31,9 ppt. Kecerahan di Pulau Mantehege yaitu 100% dan kecepatan arus di kisaran 30–42 cm/detik. Nilai INP Caulerpa racemosa mempunyai nilai tertinggi pada semua lokasi. Indeks Keanekaragaman (H’) pada semua lokasi didapat berkisar 0,799–1,093 yang dikategorikan rendah dan biasa. Nilai Indeks Dominasi (D) pada semua lokasi berkisar antara 0,635–0,697 yang dikategorikan sedang. Indeks Keseragaman (J’) berkisar 0,303–0,365 yang menggambarkan komunitas pada kondisi tertekan.
Analysis of growth and quality of seaweed carrageenan Kappaphycus alvarezii in different locations on the Banggai’s Waters, Central Sulawesi Sangkia, Frederik Dony; Gerung, Grevo S; Montolalu, Roike I
AQUATIC SCIENCE & MANAGEMENT Vol 6, No 1 (2018): April
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.6.1.2018.24812

Abstract

Title (Bahasa Indonesia): Analisis pertumbuhan dan kualitas karagenan rumput laut Kappaphycus alvarezii pada lokasi berbeda di Wilayah Perairan Banggai ProvinsiSulawesi Tengah Seaweed is a potential of coastal resources. Carrageenan is a polysaccharide extracted from seaweed or some species of red algae (Rhodophyceae). Seaweed growth is strongly influenced by two factors: internal and external factors. But twthat determine the success of the seaweed growth is the management carried out by people working on it. Banggai Regency is one of the largest seaweed production centers in Central Sulawesi. The main objective of this studyis toexamine the potential of seaweed cultivation (Kappaphycus avarezii) by looking at the growth and the carrageenan, inBanggai waters, Central SulawesiProvince. The temperature range obtained during this study r25to 31ºC. The results of carrageenananaliysis wasvery different due to differences inlocation, showed by content.  The highest and lowest ashcontentwere obtained from two locations, 1,8% (Jayabakti) and 2.8% (Liang), respectively.Rumput laut merupakan sumberdaya pesisir yang sangat potensial. Karagenan merupakan polisakarida yang diekstraksi dari beberapa spesies rumput laut atau alga merah (rhodophyceae). Pertumbuhan rumput laut sangat dipengaruhi oleh dua faktor yaitu faktor internal dan faktor eksternal. Namun yang sangat menentukan keberhasilan pertumbuhan rumput laut yaitu pengelolaan yang dilakukan oleh manusia. Kabupaten Banggai merupakan salah satu sentral produksi rumput laut terbesar di Sulawesi Tengah. Tujuan utama penelitian ini mengkaji tentang potensi budidaya rumput laut (Kappaphycus alvarezii) yang dikembangkan dengan melihat pertumbuhan dan analisis karaginannya di perairan Kabupaten Banggai Provinsi Sulawesi Tengah. Kisaran suhu yang didapat selama penelitian ini adalah berkisar 25–31ºC. Hasil analisa rendemen karagenan ini sangat berbeda yang disebabkan oleh perbedaan lokasi memberikan pengaruh nyata terhadap kandungannya. Nilai kadar abu tertinggi dan terendah berturut-turut yang di peroleh dari kedua lokasi ini adalah 1,8% (Jaya Bakti) dan 2,8% (Liang).
A study on bioecology of macroalgae, genus Caulerpa in northern Minahasa Waters, North Sulawesi Province Pulukadan, Irma; Keppel, Rene Ch; Gerung, Grevo S
AQUATIC SCIENCE & MANAGEMENT Vol 1, No 1 (2013): April
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.1.1.2013.1965

Abstract

Alga is a marine resource of potential to fisheries and marine sector. It has an important economic value to promote the economy in Indonesia. Nowdays, algae have been used as a relatively high value fisheries commodity since it has been used for food, industrial, pharmaceutical and cosmetic raw materials. This important potential needs to be supported with understanding of its biology and ecology, so that its utilization could increase the livelihood of the coastal villagers. This study was aimed at inventorying and identifying the members of genus Caulerpa found in North Minahasa Regency waters and studying some biological and ecological aspects of the algae in the area. Resuls showed that there were 7 species recorded, Caulerpa racemosa, C. racemosa var. macrophysa, C. sertularioides, C. taxifolia, C. serrulata,C. lentillifera and C. peltata. Ecologically, the environmental parameters, such as water temperature, salinity, pH, dissolved oxygen, turbidity, were in tolerable ranges for algal growth. Bottom substrate supported the growth of genus Caulerpa as well© Saat ini alga dijadikan sebagai komoditas hasil perikanan dengan nilai ekonomis yang relatif tinggi karena manfaatnya sebagai bahan makanan serta bahan baku industri, farmasi, dan kosmetik. Potensi yang cukup penting ini harus ditunjang dengan ilmu pengetahuan tentang biologi dan ekologi dari alga laut, sehingga pemanfaatannya dapat meningkatkan taraf hidup masyarakat pesisir. Penelitian tentang kajian bioekologi alga makro genus Caulerpa di perairan Minahasa Utara ini dilaksanakan dan diharapkan dapat memberikan informasi ilmiah tentang bioekologi alga makro genus Caulerpa, sehingga dapat dimanfaatkan untuk pengembangan pemanfaatan bagi kepentingan masyarakat pesisir khususnya dan industri alga makro umumnya. Penelitian ini bertujuan untuk menginventarisasi dan mengidentifikasi alga makro genus Caulerpa di perairan Kabupaten Minahasa Utara, dan mengkaji aspek bioekologinya. Hasil penelitian menunjukkan bahwa ditemukan 7 spesies, yaitu Caulerpa racemosa, C. racemosa var. macrophysa, C. sertularioides, C. taxifolia, C. serrulata, C. lentillifera dan C. peltata. Parameter lingkungan seperti suhu, salinitas, pH, oksigen terlarut, tingkat kecerahan air berada pada kisaran yang dapat ditolerir untuk pertumbuhan alga makro, sedangkan substrat juga mendukung pertumbuhan alga makro ini©
The effects of stimulant growth hormones on tissue culture of seaweed Kappaphycus alvarezii in vitro Fadel, Ariyati H; Gerung, Grevo S; Suryati, Emma; Rumengan, Inneke F.M
AQUATIC SCIENCE & MANAGEMENT Edisi Khusus 1 (2013): Mei
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.0.0.2013.2282

Abstract

In order to anticipate the qualified and sustainable seed requirement for seaweed culture, it is necessary to conduct tissue culture for vegetative cultivation of isolated leaves, bud, and stemin an artificial medium enriched with nutrient and growth regulator. The purpose of this study is to obtain newly grown plant in a big quantity in relatively short period of time, with physiological and morphological properties similar to the stocks. Culture media used were Grund Medium and PES with an addition of a growth regulator, IAA (Indol acetic acid) and BAP (Benzil amino purin). The buds produced were buds with similar properties as the parent. The longest bud (1,851 mm) was obtained in Grund Medium with IAA treatment, while the length of bud in PES medium was only 0.612 mm. The number of buds was highest (10,6)  in Grund media with IAA+BAP (1:1) treatment, and 6,82 with IAA treatment in PES media. The survival rate of explants was highest in media enriched with 0.5 mg/L IAA (indol acetic acid). The best media for growing seaweed Kappaphycus alvarezii was Grund Medium© Untuk mengantisipasi kebutuhan bibit yang berkualitas dan tersedia  secara kontinyu, diperlukan suatu upaya kultur jaringan untuk perbanyakan tanaman secara vegetatif dengan mengisolasi bagian tanaman seperti daun, mata tunas, serta batang dalam media buatan secara aseptik yang diperkaya dengan nutrien dan zat perangsang tumbuh. Tujuannya untuk mendapatkan tanaman baru dalam jumlah banyak dalam waktu yang relatif singkat, yang mempunyai sifat fisiologi dan morfologis sama dengan tanaman induknya. Media kultur yang digunakan adalah media Grund Medium dan PES dengan penambahan zat perangsang tumbuh yaitu IAA (Indol acetic acid) dan BAP (Benzil amino purin). Tunas yang dihasilkan merupakan anakan yang mempunyai sifat yang sama dengan induknya.  Panjang tunas tertinggi dicapai pada media Grund Medium dengan perlakuan IAA (1,851 mm) dan media PES sebesar 0,612 mm. Sedangkan jumlah tunas tertinggi dicapai perlakuan IAA+BAP (1:1) sebesar 10,6 pada media Grund dan perlakuan IAA sebesar 6,82 pada media PES. Untuk tingkat kelangsungan hidup (sintasan) eksplan yang paling baik pada media yang diberikan pupuk IAA (indol acetic acit) dengan kosentrasi 0,5 mg/L. sedangkan media yang baik untuk pertumbuhan rumput laut Kappaphycus alvarezii adalah media Grund Medium©
Study on carrageenan content and growth of seaweed, Kappaphycus alvarezii, infected by white spot disease using different doses of NPK in Banggai Islands Poke, Aounorofiq M; Gerung, Grevo S; Montolalu, Roike I
AQUATIC SCIENCE & MANAGEMENT Edisi Khusus 2 (2014): Oktober
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.0.0.2014.7303

Abstract

This study was aimed at assessing the carrageenan content and the growth of seaweed K. alvarezii in white spot disease infection conditions with different doses of NPK in Banggai waters. Results showed that all doses could increase the carrageenan content of the white spot-infected seaweed, with the highest content in treatment D (25 g of NPK/ 10 liters of water), 43.862 ± 19.546, followed by  C (20 g of NPK /10 liters of water) 35.685 ± 14.693, B (15 g of NPK/10 liters of water), 23.208 ± 5.992, A (10 g of NPK/10 liters of water),19.132 ± 4.405, and K (without dose), 10.225 ± 2.782, respectively. The highest growth was recorded in treatment D, 401.333 ± 3.215 g, followed by treatment C, 310.000 ± 6.000 g, B, 7.211 g ± 298.000+ 7.211 g, A,  256. 667 ± 11.547 g, and the lowest in control treatment, 218.000 ± 9.849 g, respectively. Penelitian ini bertujuan untuk mengkaji kandungan karaginan dan pertumbuhan dari rumput laut K. alvarezii pada kondisi terkena penyakit white spot dengan dosis NPK yang berbeda di Perairan Kabupaten Banggai. Hasil percobaan menunjukkan bahwa semua dosis mampu meningkatkan kandungan karaginan pada rumput laut yang terinfeksi white spot. Kandungan tertinggi terdapat pada perlakuan D (dosis NPK 25 g/10 liter air) yaitu 43.862±19.546, diikuti perlakuan C (dosis NPK 20 g/10 liter air) 35.685±14.693, B (dosis NPK 15 g/10 liter air) 23.208±5.992, A (dosis NPK 10 g/10 liter air) 19.132±4.405 dan K (tanpa dosis) 10.225±2.782. Pertumbuhan tertinggi terdapat pada perlakuan D yaitu sebesar 401.333 ± 3.215 gram, kemudian diikuti oleh perlakuan C 310.000 ± 6.000 gram, B 298.000 ± 7.211 gram, A sebesar 256.667 ± 11.547 gram, dan terendah pada perlakuan kontrol  yaitu sebesar  218.000 ± 9.849 gram.
Anatomical characteristics of macroalgal species from Bombuyanoi Island, East Bolaang Mongondow Regency, North Sulawesi Patra, Frian; Kepel, Rene Ch.; Lumingas, Lawrence J.L.; Gerung, Grevo S.; Kondoy, Khristin F.; Sumilat, Deiske A.; Undap, Suzanne L.
AQUATIC SCIENCE & MANAGEMENT Vol 9, No 2 (2021): OCTOBER
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/jasm.v9i2.35229

Abstract

This research aims to study the anatomical structure of macroalgae. Sample of macroalga was collected by using Line Intercept Transect (LIT) method with sampling quadrat. Macroalgae samples were dried and separated from the roots, stems, leaves and receptacles (if present). Samples were cut transversely and longitudinally at each section and observed under binoculared microscope of Olympus CX with monitor. Based on the histology, anatomical structure of macroalgae species can be divided into two tissues from outside to inside, namely cortex and medullary cells. The cortex is composed of one layer or more. The cortex is the area between the epidermis and the central column. The medulla cells only have one layer which is the largest layer. Based on the observation result of cells type from observed spesies Eucheuma denticilatum, Gracilaria arcuata, Hydropuntia edulis, G. salicornia, Hypnea valentiae, Turbinaria deccurens, and T. ornata, it shows that cells of medulla become small toward cortex.Indonesian title:  Karakteristik anatomi jenis makroalga dari Pulau Bombuyanoi, Kabupaten Bolaang Mongondow Timur, Sulawesi Utara