Article Per Year (5 Year)
p-Index From 2021 - 2026
2.374
P-Index
This Author published in this journals
All Journal Archive of Community Health METAMORFOSA Journal of Biological Sciences Buletin Udayana Mengabdi Jurnal Farmasi Udayana E-Journal Of Animal Science Udayana University Jurnal Veteriner Agrointek Jurnal Peternakan Indonesia Media Ilmiah Teknologi Pangan (Scientific Journal of Food Technology) Bali Anatomy Journal Interdisciplinary Social Studies Public Health and Preventive Medicine Archive
I Nengah Sujaya
Program Studi Ilmu Kesehatan Masyarakat Fakultas Kedokteran Universitas Udayana
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Education Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Medicine & Pharmacology Public Health Social Sciences Veterinary

Published : 39 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 9 Documents
Search
Journal : Jurnal Veteriner

 1 
Isolasi dan Identifikasi Bakteri Asam Laktat dari Cairan Rumen Sapi Bali sebagai Kandidat Biopreservatif ISOLATION AND IDENTIFICATION OF ACID LACTIC BACTERIA FROM BALI CATTLE’S GASTRIC FLUID AS A POTENTIAL CANDIDATE OF BIOPRESERVATIVE I Wayan Suardana; I Nyoman Suarsana; I Nengah Sujaya; Komang Gede Wiryawan
Jurnal Veteriner Vol 8 No 4 (2007)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (192.088 KB)

Abstract

A study was conducted to isolate and identify of lactic acid bacteria originated from gastric fluid of bali cattle, and to determine their potential as the candidates of biopreservative. Lactic acid bacteria were isolated by culturing the gastric fluid of bali cattle in de Mann, Rogosa, Sharpe (MRS) medium; screening the bacteria, and identification of bacteria species by Analytical Profile Index (API) 50 CHL Kit. The results showed that, the new species of lactic acid bacteria were isolated and identified as Lactococcus lactis spp lactis 1 (SR21 isolate) and Lactobacillus brevis 1 (SR54 isolate) that have broad spectrum antimicrobial activities. It is clear from this study that a potential lactic acid bacteria producing antimicrobial agent can be isolated from the gastric fluid of bali cattle.
Eksopolisakarida dari Lactobacillus sp. Isolat Susu Kuda Sumbawa dan Potensinya sebagai Prebiotik (EXOPOLYSACCHARIDES FROM LACTOBACILLUS SP. ISOLATED FROM SUMBAWA MARE’S MILK AND ITS POTENTIAL APPLICATION AS PREBIOTICS) I Nengah Sujaya; Ni Putu Desy Aryantini; Ni Wayan Nursini; Cok. Istri Dewiyani Cakrawati; Ni Luh Made Ema Juliasari; Ni Made Utami Dwipayanti; Yan Ramona
Jurnal Veteriner Vol 13 No 2 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (186.958 KB)

Abstract

This research aimed to isolate exopolysaccharides (EPS) producing Lactobacilli isolated fromsumbawa mare’s milk and its potential as prebiotics for modulating the growth of Bifidobacteriumbreve. Nine strains of Lactobacillus sp. were screened for their capabilities to produce EPS usingmodified MRS medium containing sucrose. Prebiotics potential of the EPS was verified by culturingB. breve JCM1273 in TOS medium containing EPS. The results showed that all strains ofLactobacillus sp. produced EPS on MRS sucrose medium and two strains (Lactobacillus SK3.1 andLactobacillus SK4) produced more EPS compared to the other strains tested. Bifidobacteriumbreve JCM1273 showed weak activity while in direct metabolism of EPS produced by Lactobacillussp. SK4 and its growth was enhanced on acid hydrolyzed EPS. Since this phenomenon mighthappened when the EPS exposed by the low pH during gastric passage, hence the EPS might be apotential source to be developed as prebiotics. Nevertheless, further investigation is necessary toevaluate the bifidogenic affects of EPS in Lactobacillus sp. SK4.
Pemberian Gamal Tambahan dalam Ransum Meningkatkan Neraca Nitrogen dan Populasi Mikrob Proteolitik Rumen Sapi Bali (ENHANCEMENT PROVISION OF GLIRICIDIA SEPIUM IN DIET INCREASE NITROGEN BALANCE AND POPULATION OF RUMEN PROTEOLITIK MICROORGANISM OF BALI CATT Ni Nyoman Suryani; I Gede Mahardika; Sentana Putra; Nengah Sujaya
Jurnal Veteriner Vol 16 No 1 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (85.635 KB)

Abstract

This research aimed to study the effect of different forage composition in diet on nitrogen balance andmicrobial population of Bali cattle. Randomized Block Design consisted of four feed treatments with 3block of weight live as replicates were used in this study. Body weight of male bali cattle used rangedbetween 181-265 kg. These four treatments based on dry matter were: A (45% elephant grass + 0% ricestraw + 15% glyricidia + 10% calliandra + 30% concentrate); B (30% elephant grass +10% rice straw + 20%glyricidia + 10% calliandra+ 30% concentrate) ; C (15% elephant grass +20% rice straw + 25% glyricidia+10% calliandra + 30% concentrate) and D (0%elephant grass + 30% rice straw + 30% glyricidia + 10%calliandra+ 30% concentrate) . Variables measured were nitrogen balance and rumen microbial population.The collected data were analyzed by analysis of variance. The result showed that nitrogen intake in cattlefed with diet C was significantly (P<0.05) higher than these in other treatments and nitrogen retention(P<0.05) was significantly higher as compared to those fed with diet A. Amylolytic and cellulolytic bacterialpopulations were not significantly different (P>0.05) among all treatments, but the population of proteolyticbacteria was found the lowest (P<0.05) in cattle fed with diet A. It can be concluded that increasedglyricidia and rice straw in the diet could increased nitrogen intake, nitrogen retention and proteolyticbacterial population.
Analisis Sekuen Probe Gena Shiga Like Toxin-2 dari Isolat Lokal Escherichia coli O157:H7 (PROBE SEQUANCE ANALYSIS OF SHIGA LIKE TOXIN-2 GEN FROM ESCHERICHIA COLI O157:H7 LOCAL ISOLATES) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (580.12 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 was detected in faecal samples of cattle, andhuman as well as in beef. The performance of agent indicated that it has been identified as harmful andoften life-threatening zoonotic agent. It is therefore important to analysed the genetic characteristic ofShiga toxin Escherichia coli (STEC) and to develop a diagnostic probe in order  to optimalized of diagnostictest  for the agent. The  study was started by amplifiying  stx2 gene, purifying of PCR product, sequencingof stx2 gene, analyzing  of phylogenetic tree, and finally  by analyzing   of  diagnostic  probe candidate.Homology study showed that the genetic sequence of the local isolate of  E. coli O157:H7 i.e SM25(1)isolated from cattle feces has  a genetic and fuctional similarity with  the control isolate i.e E. coli O157:H7ATCC 43894 originated from human.  Further study showed that a probe with  foreward primer  sequanceof 5’-AATTTATATGTGGCCGGGTTC-‘3 which were respectively designed as a PFS and PRS 176 bp product.Appeared to be potential candidate of diagnostic probe for the agent.
Identifikasi dan Karakterisasi Bakteri Asam Laktat Isolat Susu Segar Sapi Bali (IDENTIFICATION AND CHARACTERIZATION OF LACTIC ACID BACTERIA ISOLATED FROM BALI CATTLE’S RAW MILK) I Nengah Sujaya; Komang Ayu Nocianitri; Ni Putu Desy Aryantini; Wayan Nursini; Yan Ramona; Yoshitake Orikasa; Fukuda Kenji; Tadashu Urashima; Yuji Oda
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (177.957 KB)

Abstract

Bali cattle is an indigenous spesies in Bali, which pay great attention due to its uniqueness. Numerousarticles have been published on Bali cattle especially related to its disease, nutritional requirement forgrowth and domestication. Nevertherless, it was no any report has been published on the lactic acidbacteria (LAB) assosiated with the cattles raw milk and its potential used as probiotic. This work isaimed to identify LAB isolated from bali cattle raw milk and its resistance to secondary bile acid (sodiumdeoxy cholic), a prequisite in development of probiotic for human. The results revealed that based upon thehomology studies of the variable region I, II, and III sequences of the 16S rDNA showed that 44 out of 62isolates were closely related to Pediococcus acidilactici; 11 out of 62 isolats were closely related to Enterococusgallinarum, five out of 62 isolates were closely related to Lactococcus garvieae, while only one isolate was closely related to Lactobacillus plantarum and Weisella confusa. Some isolates showed resistant to 0.2-0.6mM deoxy cholic acid, which might be also resist in human gastrointestinal tract conditions. Based onthose finding, it can be concluded that the LAB associated with raw bali cattle milk were closey related toP. acidilactici, E. gallinarum, Lac. garvieae, Lb. plantarum and W. confusa, which different from thosecommonly LAB found in others cattle raw milk. Somes isolates were potential to be developed as probioticfrom human helath.
CHARACTERIZATION OF LACTIC ACID BACTERIA ISOLATED FROM SUMBAWA MARE MILK Nengah Sujaya; Yan Ramona; Ni Putu Widarini; Ni Putu Suariani; Ni Made Utama Dwipayanti; Komang Ayu Nocianitri; Ni Wayan Nursini
Jurnal Veteriner Vol 9 No 2 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (233.662 KB)

Abstract

A study was carried out to isolate and characterize lactic acid bacteria (LAB) from the Sumbawa mares milk The Isolation of LAB was conducted in Man Rogosa Sharpe (MRS) agar. The isolates were characterized by standard methods, such as Gram staining, cell morphology study and fermentation activities. The ability of the isolates to inhibit some pathogenic bacteria was studied by dual culture assay. Isolates showing the widest spectrum of inhibiting pathogenic bacteria were further identified using API 50 CHL. The results showed that Sumbawa mare milk was dominated by lactobacilli and weisella/leuconostoc. As many as 26 out 36 isolates belong to homofermentative lactobacilli and another 10 isolates belong to both heterofermentative lactobacilli and weissella or leuconostoc. Twenty four isolates inhibited the growth of Escherichia coli 25922, Shigela flexneri, Salmonella typhimurium, and Staphylococcus aureus 29213. Two promising isolates with the widest spectrum of inhibiting pathogenic bacteria, Lactobacillus sp. SKG34 and Lactobacillus sp. SKG49, were identified respectively as Lactobacillus rhamnosus SKG34 and Lactobacillus ramnosus SKG49. These two isolates were specific strains of the sumbawa mare milk and are very potential to be developed as probiotic for human.
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
PROBIOTIC POTENCY OF LACTOBACILLUS SPP. ISOLATED FROM SUMBAWA MARE MILK I Nengah Sujaya; I Made Utami Dwipayanti; Ni Luh Putu Suariani; Ni Putu Widarini; Komang Ayu Nocianitri; Ni Wayan Nursini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (479.163 KB)

Abstract

This research was deigned to elucidate the potency of Lactobacillus spp. isolated from sumbawa mare milk to be developed as a probiotic. Sixteen lacobacilli were screened based on their resitancy to a model of gastric juice at pH 2, 3, and 4, then followed by their resistncy to small intestional fluid model containing deoxycholic. Three lactobacilli i.e. Lactobacillus sp. SKA13, Lactobacillus rhamnosus SKG34 and Lactobacillus rhamnosus SKG49 were found to be resistentent to gastric juice at pH 3 and 4. However, there were no lactobacilli resisted to pH 2. Lactobacillus rhamnosus SKG34 and Lactobacillus rhamnosus SKG49 were able to reach the colon even after being expossed to a model of intestinal fluid containing 0,4 mM deoxycholate and pancreatine. Therefore, these isolates have a potency to be developed as probiotic lactobacilli. Nevertherless, these lactobcailli could probably transform cholic acid into secondary bile acids, which were not expected to be found in the probiotic, and this capability is not appropriate for probiotic. This character is worthly to be studied since it has never been reported in lactobacilli.
Karakterisasi Lactobacillus spp. yang Diisolasi dari Susu Kambing Etawa untuk Pengembangan Probiotik (CHARACTERIZATION OF LACTOBACILLUS SPP., ISOLATED FROM MILK OF ETAWA GOATS FOR LOCAL PROBIOTIC DEVELOPMENT) Putu Rima Sintyadewi; Yan Ramona; I Nengah Sujaya
Jurnal Veteriner Vol 16 No 2 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (370.683 KB)

Abstract

The objective of this research was to characterize Lactobacillus spp., isolated from milk of Etawagoats for local probiotic development. Total of 23 isolates Lactobacillus spp. were tested for resistance tolow pH conditions, high levels of natrium deoxy cholate, and modified gastric juice conditions. Besidesthat, those isolates were also tested to convert cholic acid (CA) into deoxycholic acid (DCA). Isolate thatshowed the most potential properties for local probiotic development was identified by 16S rDNA analysisusing following amplification of this sequence with primers of 27F and 520R). The results showed that 12isolates were found to be resistant to low pH conditions and to high level of NaDC (0.6 mM). Three of them(Lactobacillus spp. GMA46, Lactobacillus spp. GMA47 and Lactobacillus spp. GMA50) did not convertcholic acid into deoxy cholic acid, indicating that they are safe for human use. Lactobacillus spp. GMA46showed better performance in the gastric juice (a model of gastic and intestinal juice containing pepsin andpancreatin enzymes at pH 2, 3 and 4) simulation test. This GMA46 isolate was identified as L. caseiATCC 334 and L. paracasei subsp. tolerans strain NBRC 15906 with 100% similarity, in term of its 16srDNA nucleotide sequence. The results of this research indicate that Lactobacillus sp. GMA46 is anIndonesian potential probiotic strain, isolated from milk of etawa goats
Co-Authors Cahyawati, Putu Nita Cok. Istri Dewiyani Cakrawati Dwijastuti, Ni Made Sri Exposto, Levi Anatolia S.M. Fukuda Kenji I D.P. Kartika Pratiwi I Dewa Made Sukrama I g. H. Purnama I Gede Mahardika I Gusti Ayu Kusuma Dewi I Gusti Ngurah Agung Dewantara Putra I Komang Gede Wiryawan I Made Agus Gelgel Wirasuta I MADE SUTARGA I Nyoman Suarsana I Wayan Gede Artawan Eka Putra I Wayan Suardana I.D.P.K. Pratiwi Ida Ayu Sri Sinca Maha Uni Kadek Tresna Adhi KOMANG AYU NOCIANITRI Luh Aris Aryandeni Utami Luh Putu Lila Wulandari Made Ayu Hita Pretiwi Suryadhi N T. Suryadhi N. N. Suryani N. T. Suryadhi N.P. Desy Aryantini N.W. Nursini N.W.A. Utami Ni Ketut Sutiari Ni Luh Made Ema Juliasari Ni Luh Putu Suariani Ni Made Utami Dwipayanti Ni Nengah Dwi Fatmawati Ni Nyoman Suryani Ni Putu Desy Aryantini Ni Putu Eka Trisdayanti Ni Putu Suariani Ni Putu Wiastari Ni Putu Widarini Ni Wayan Nursini Putu Rima Sintyadewi S. G. Purnama S. PUTRA S. Putra sang gede purnama Sawitri, Anak Agung Sagung Sentana Putra Tadashu Urashima Wayan Redi Aryanta Wayan Tunas Artama Wulandari, Kristina Yan Ramona Yoshitake Orikasa Yuji Oda