Claim Missing Document
Check
Articles

Found 38 Documents
Search

Hubungan Peran Keluarga dan Kepatuhan Pasien TB MDR di RSUD Dr. Soetomo Surabaya : [The Role of Family in Improving Multidrug-Resistant Tuberculosis Patient Compliance] Safira Nur Ainiyah; Soedarsono Soedarsono; Pirlina Umiastuti
Jurnal Respirasi Vol. 5 No. 1 (2019): Januari 2019
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (435.832 KB) | DOI: 10.20473/jr.v5-I.1.2019.1-4

Abstract

Background: Multi Drug Resistant Tuberculosis (MDR TB) is an infection disease caused by Mycobacterium tuberculosis and has been resistant to isoniazid and rifampicin. Based on medical record of MDR TB Clinic RSUD Dr. Soetomo Surabaya, there is an increase of drop out rate which indicates that MDR TB patient’s adherence is low althouh there are some policies to improve their adherence. Therefore family role is needed for increasing MDR TB patients’ adherence and decreaseing drop out rate.Objective: to know the relationship between family role and MDR TB patient’s adherence on treatment in RSUD Dr. Soetomo Surabaya. Method: This analytical study in cross sectional approach is held on October 2017-June 2018 in MDR TB Clinic of RSUD Dr. Soetomo Surabaya and patients’ house. There are 24 patients and their family which are enrolled and interviewed in this study. Inferential statistic which was Fisher Exact Test used to find out and analyze the relationship between family role and MDR TB patient’s adherence on treatment in RSUD Dr. Soetomo Surabaya. Result: There is no difference frequencies of high and low family role. The MDR TB patients have high adherence. There is significant (p = 0,018) and moderate (c = 0,452) relationship of family role and MDR TB patients’ adherence on treatment in RSUD Dr. Soetomo Surabaya.Conclusion: To improve MDR TB patients’ adherence, family must have a significant role and give support. Health provider also should give education about importance of family role in MDR TB patients’ treatment.
Aspergilloma pada Tuberkulosis Paru: [Aspergilloma in Pulmonary Tuberculosis: A Case Report] Soedarsono Soedarsono; Elisabeth Tri Wahyuni Widoretno
Jurnal Respirasi Vol. 3 No. 2 (2017): Mei 2017
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1707.816 KB) | DOI: 10.20473/jr.v3-I.2.2017.58-65

Abstract

The incidence of lung aspergillosis increases year to year. Lung aspergilloma is the most recognizable form of aspergillosis. Since 1980, the most common condition for initiating aspergillosis is tuberculosis (TB). Untreated pulmonary TB can cause several complications, such as decreases of pulmonary function, persistent pulmonary symptoms and Chronic Pulmonary Aspergillosis (CPA). More than 90% Aspergillosis is caused by Aspergillus fumigatus, this type is also widely found in people with TB. This type of fungus has a simple biological cycle with high sporulation capacity, which causes the release of conidia into the atmosphere with high concentrations. Humans inhale hundreds of conidia each day. Immuno competent hosts are capable of destroying conidia with the pulmonary immune system. Aspergillus infections cause illness when the host response is too strong or weak to the aspergillus antigen. The CPA morbidity rate is quite large with systemic symptoms and respiratory symptoms due to progressive pulmonary fibrosis and diminished lung function. During treatment, the CPA has a fatality rate of 20-33% in the short term and more than 50% in the span of 5 years. The Research Committee of the British Tuberculosis Association found that patients with post-TB cavity had a high risk of fungal colonization. The cavity formed in pulmonary TB is a suitable place for the development of various organisms including the fungus because it contains enough oxygen and necrotic tissue. The most common form of CPA associated with TB is Aspergilloma. In this review we will focus on aspergilloma, its diagnosis and management.
Farmakogenomik Hepatotoksisitas Obat Anti Tuberkulosis: [Hepatotoxicity Pharmacogenomic of Anti Tuberculosis Drugs] Andri Dwi Wahyudi; Soedarsono Soedarsono
Jurnal Respirasi Vol. 1 No. 3 (2015): September 2015
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (260.573 KB) | DOI: 10.20473/jr.v1-I.3.2015.103-108

Abstract

Anti-TB drugs (ATD) associated with hepatotoxicity is a serious medical problem in the world, especially for patients with TB. The production and expenditures toxic drug metabolites depends on the activity of some enzymes, such as N-acetyl transferase 2 (NAT2), Cytochrome P450 oxidase (CYP2E1) and Glutathione S-transferase (GSTM1). Variations from the DNA sequence or polymorphism at this locus (NAT2, CYP2E1 and GSTM1) can modulate enzyme activity and can affect the risk of hepatotoxicity. Hepatotoxicity is generally unpredictable and occur in a small number of patients even when the drug was given according to the recommended dosage. Among the ATD, the metabolism of INH, which is one of the ATD forefront, has been studied extensively, and said acetylation by NAT2, oxidation by cytochrome P450 oxidase (CYP2E1) and detoxified by GST play an important role in the INH-induced hepatotoxicity. Since the prevalence of polymorphisms is different in worldwide populations, the risk of ATD hepatotoxicity varies in the populations. Thus, the knowledge of polymorphisms at these loci, prior to medication, may be useful in evaluating risk and controlling ATD hepatotoxicity.
Hubungan antara Pola Resistensi OAT Lini Pertama dan Gradasi Gambaran Foto Toraks Penderita TB Paru MDR: [First-Line Antituberculosis Drugs Resistance and Chest X-Ray Pattern of Multidrug-Resistant Tuberculosis Patient] Pramanindyah Bekti Anjani; Soedarsono Soedarsono
Jurnal Respirasi Vol. 2 No. 1 (2016): Januari 2016
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (94.568 KB) | DOI: 10.20473/jr.v2-I.1.2016.1-5

Abstract

Background: Tuberculosis (TB) is a disease which has long been known and is still a cause of death in the world. The emergece of the drug resistance in TB treatment, particularly Multi drug-Resistance Tuberculosis (MDR TB) become a significant public health problem in many countries. The diagnosis of MDR TB based on culture results. In some cases radiographic feature with severe abnormalities consideres as MDR TB. From this phenomenon, there is no research that connects the resistance pattern of first line ATD with chest x-ray feature in patients with MDR TB. Methods: The research design are analytical observational with cross-sectional study conducted in outpatient clinic of MDR TB in Dr. Soetomo hospital. Subjects were patients who are following a theraphy program in outpatient clinic of MDR TB in Dr. Soetomo hospital from 2012 to 2014 who meet the inclusion and exclusion criteria. A total of 65 patients. Result: the result of this study showed that of all patterns of resistance, most of the MDR TB patients were classified as having severe chest radiograph. 27 patients with RH resistance patterns, there were 14(51.9%) who had a chest radiograph are classified as severe. 5 patients with RHS resistance patterns, 2(60%) vwho had a chest radiograph are classified as severe. 13 patients RHES resistance patterns, 8(61.5%) who had a chest radiograph are classified as severe. 20 patients with RHE resistance patterns, 14(70%) who had a chest radiograph are classified as severe. Conclusion: There were no significant association between resistance pattern of first line ATD and chest x-ray feature in patient with MDR TB.
Gambaran Radiografi Tuberkulosis Paru Multidrug-Resistant: Studi Retrospektif di Rumah Sakit Umum Dr. Soetomo Surabaya : [Chest Imaging in Multidrug-Resistant Pulmonary Tuberculosis: Retrospectif Study in Dr. Soetomo General Hospital Surabaya] Stephanie Christina Sulaiman; Lulus Handayani; Mohammad Yamin Sunaryo Suwandi; Soedarsono Soedarsono
Jurnal Respirasi Vol. 4 No. 3 (2018): September 2018
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (199.361 KB) | DOI: 10.20473/jr.v4-I.3.2018.71-75

Abstract

Background: Multidrug-resistant pulmonary tuberculosis (MDR-TB) is a major health problem worldwide. Prompt diagnosis is necessary for insuring appropriate therapy to lower morbidity and mortality, as well as to prevent disease transmission. Determination of drug-resistance patterns through microbiological examination is sometimes challenging, especially when the sputum acid-fast bacilli smear is negative. Therefore, it is worthwhile to investigate whether there may be radiographic patterns suggesting MDR-TB infection. The objective of this study was to evaluate the radiographic features of MDR-TB. Methods: From September 2015 to March 2018, 167 patients with microbiologically proven MDR-TB were enrolled in the study. All radiographs were obtained before the patients received MDR-TB chemotherapy regimen. Posterior-anterior chest radiography was performed using digital radiography system (Hitachi Radnext50 500mAs) and retrospectively reviewed as digital raw data. Results: Based on severity category, 60% had severe lesion, 31% had moderate lesion, and only 9% had mild lesion. The most frequently observed findings were ground glass opacity or consolidation, noted in 96% patients, with bilateral lung involvement in 81% patients; fibrosis (95%), cavity (78%; 87% of which were multiple), interstitial opacities (53%), pleural thickening and mediastinal shift (59%). Other radiological findings were calcification (16%), emphysema (13%), lung destruction (12%), atelectasis (10%), nodule (8%), bullae (8%), bronchiectasis (5%), miliary pattern (1%), pleural effusion (25%), pneumothorax (1%), and hilar lymphadenopathy (14%) which predominantly unilateral. Conclusion: The presence of severe pulmonary lesion, ground glass opacity or consolidation with bilateral lung involvement, fibrosis, multiple cavities, interstitial opacities, pleural thickening, and mediastinal shift are the main features of MDR-TB.
Lobektomi Life Saving pada Hemoptisis Berulang pada Tuberkulosis Paru : [Hemoptysis in Aspergiloma Patient: A Case Report] Soedarsono Soedarsono; Tri Puji Astuti
Jurnal Respirasi Vol. 5 No. 3 (2019): September 2019
Publisher : Faculty of Medicine Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (280.194 KB) | DOI: 10.20473/jr.v5-I.3.2019.79-84

Abstract

Background. Hemoptysis is the most common complication of lung tuberculosis (TB). Its can occur repeated and massive. Reccurent massive hemoptysis resolved with conservative therapy but if conservative therapy fails, definitive therapies such as lobectomy surgery are used as alternative treatments especially life-threatening. Case. A 38-year-old man with chief complaint hemoptysis since 4 months pior to admission hospital. Hemoptysis 4-5 times daily with volume 200-600 cc per day and make him shortness of breath and anemia. Initial AFB (Acid Fast Bacilli) was positive and GeneXpert MTB (+) sensitive rifampisin. He got Anti Tuberculosis Drug (ATD) therapy 1st category since 3 months ago. He has been given conservative therapy for hemoptysis but failed. Discussion. Surgery is one of alternative therapy for reccurent massive hemoptysis. Surgery only if source of bleeding already known certainty. In this case patient were suggest for lobectomy superior right lung lobe, not a segmentectomy because there was adhesions on intrathoracic. After lobectomy he getting better and hemoptysis stops. He has continued ATD until 6 months without hemoptysis. Conclusion. Reccurent massive hemoptysis and life-threatening with failure of conservative therapy may given definitive therapy such as lobectomy.
Cost-Effectiveness Analysis of Budesonide/Formoterol and Fluticasone/Salmeterol for Stable Chronic Obstructive Lung Disease Amelia Lorensia; Monica Dyah Puspitasari; Soedarsono Soedarsono; Rivan Virlando Suryadinata
Jurnal Respirologi Indonesia Vol 42, No 4 (2022)
Publisher : Perhimpunan Dokter Paru Indonesia (PDPI)/The Indonesian Society of Respirology (ISR)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36497/jri.v42i4.378

Abstract

Background: Chronic Obstructive Pulmonary Disease (COPD) is one of the four largest types of non-communicable diseases in the world, requiring long-term and routine treatment. Treatment with the inhalation route is in the form of a dry-powder inhaler (DPI) which is easy to use and carry. Combination of corticosteroid and long-acting beta-2 agonist (LABA) in the form of DPI available in Indonesia are budesonide/formoterol and salmeterol/fluticasone. The purpose was to identify therapy was more cost-effective between budesonide/formoterol than fluticasone/salmeterol in clinical symptoms using COPD assessment test (CAT) value and lung function in FEV1/FVC (Forced Expiratory Volume in First Seconds/Forced Vital Capacity) ratio.Methods: This research study was pre-post design with cost-effectiveness analysis, in outpatient COPD patients in a hospital in Gresik Regency, from October 2019 to January 2020. There were two outcomes of respondents in this study, namely lung function seen from the value of FEV1, and clinical symptoms seen from the value of CAT. The study used hospital perspective.Results: There were 38 respondents involved. Fluticasone/salmeterol therapy was more effective than the budesonide/formoterol group in improving FEV1/FVC ratio, while budesonide/formoterol was more effective than the fluticasone/salmeterol group in improving clinical symptoms by CAT assessment. The average cost effectiveness ratio (ACER) value of lung function between the fluticasone/salmeterol group (IDR.176.465/Liter) was lower than that of budesonide/formoterol (IDR.296.832/Liter). The ACER clinical symptoms value between the fluticasone/salmeterol group (IDR.16,283/score) was smaller than that of budesonide/formoterol (IDR.17,340/score). Conclusion: Fluticasone/salmeterol was more cost-effective than budesonide/formoterol in improving lung function. Meanwhile, for clinical symptoms, fluticasone/salmeterol was trade-off with budesonide/formoterol.
DIFFERENCES OF PLASMA INTERLEUKIN-6 AND TUMOR NECROSIS FACTOR-α LEVELS IN HEALTHY PEOPLE, RIFAMPICIN RESISTANT AND SENSITIVE PULMONARY TUBERCULOSIS PATIENTS Wahyu Setiani Wibowo; Jusak Nugraha; Soedarsono Soedarsono
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol. 25 No. 2 (2019)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v25i2.1452

Abstract

Increased tuberculosis in the world is caused by increased HIV-infected and antituberculous drugs (rifampicin) resistant individuals. IL-6 and TNF-α play an essential role in explaining the different degrees of inflammation in Rifampicin Resistant (RR) and Rifampicin Sensitive (RS) pulmonary tuberculosis patients, and healthy people. The research aimed to analyze the differences in plasma IL-6 and TNF-α levels in healthy people, Rifampicin Resistant (RR), and Rifampicin Sensitive (RS) pulmonary tuberculosis patients. A cross-sectional study was conducted from July-September 2017. Thirty-nine subjects were classified into RR pulmonary tuberculosis (n=15), RS pulmonary tuberculosis (n=12) based on GeneXpert examination and treated by antituberculous drugs ≤ 1 month, and healthy people (n=12) based on AFB results, Thorax X-ray, and tuberculin tests. IL-6 and TNF-α were done in all subjects using ELISA U-CyTech®(Biosciences, Inc.). Anova analyzed differences of IL-6 and TNF-α levels between groups. The mean IL-6 levels (pg/mL) in RR and RS pulmonary tuberculosis patients, and healthy people were 54.56±59.13, 27.05±37.04, 4.42±2.83, respectively. The mean TNF-α levels (pg/mL) in RR and RS pulmonary tuberculosis patients, and healthy people were 263.54±327.58, 250.25±314.20, 9.04±5.89, respectively. The mean differences between  IL-6 and TNF-α levels (pg/mL) between RR pulmonary tuberculosis patients and healthy people were 50.14±15.29 (p<0.05) and 254.59±8460 (p<0.05). Significant differences of mean IL-6 and TNF-α levels were found between RR pulmonary tuberculosis patients and healthy people.
IL-4 Level in Rifampicin-Sensitive and Rifampicin-Resistant Lung Tuberculosis Patients Joko Susanto; Jusak Nugraha; Soedarsono Soedarsono
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol. 27 No. 1 (2020)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v27i1.1606

Abstract

Tuberculosis remains a global health burden. Mycobacterium tuberculosis infection causes humoral and cellular responses. Macrophages of patients with pulmonary tuberculosis evolve M1 polarization that blocks infection or immunosuppressive M2, promoting tissue repair mediated by IL-4, IL-10, and IL-13. Previous research showed a decrease of IL-4R and IL-10 expression in lung macrophages of anti-TB drug resistance. A molecular test can detect rifampicin- resistance. There has been no study, which showed the difference in serum IL-4 levels in rifampicin-sensitive and rifampicin-resistant tuberculosis patients. This study aimed to determine the difference between circulating IL-4 levels in rifampicin-sensitive and rifampicin-resistant pulmonary tuberculosis patients. This cross-sectional observational study consecutively recruited subjects based on positive molecular and acid-fast bacilli microscopic examination from MDR-TB Clinic of the Dr. Soetomo Hospital between December 2018 to March 2019. Subjects were classified into a rifampicin-sensitive and rifampicin-resistant group. On ELISA measurement, IL-4 data were analyzed with SPSS version 17. Mann-Whitney U test and ROC analysis tests were performed, and p < 0.05 was significant for α=0.05 (95% CI). There was significant difference between rifampicin-sensitive group (420±281 pg/mL) and rifampicin-resistant group (253±279 pg/mL) (p=0.014). Receiver operating characteristics analysis showed AUC 0.70, the sensitivity of 81.5%, the specificity of 63.6%, and the cut-off value of 235.6 pg/mL. There was a significantly higher level of circulating IL-4 in the rifampicin-sensitive group than the rifampicin-resistant group. IL-4 level in healthy subjects should be measured as the normal value in the population. Immunology and metabolic parameters should be performed to increase sample homogeneity. Further study was also needed to understand the IL-4 role in rifampicin resistance of lung tuberculosis patients in the Indonesia population.
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
Co-Authors Abdul Rahman Bahmid Agnes Dwi Sis Perwitasari, Agnes Dwi Sis Agung Dewi Sekar Agustinus Rizki Wirawan Riadi Akirasena, Mayoori Alvin Hartanto Kurniawan, Alvin Hartanto Amelia Lorensia ANAK AGUNG ISTRI AGUNG, SRILA NATASWARI Andri Dwi Wahyudi Andy Sulaiman Siregar Anindya Zalfaa Kusuma Dewi Anita Dewi Anggraini Anita Widyoningroem Bendrong Moediarso Budi Suprapti Budiono Budiono D. Sunarti Deby Kusumaningrum Diana, Adawiyah Putri Dody Taruna Eko Budi Koendhori, Eko Budi Elisabeth Tri Wahyuni Widoretno Farah Nurul Rakhima H. Haryono Indri Ngesti Rahayu Irmawati M. Dikman Isa Ansori Jusak Nugraha Kartono Wibowo Kuntaman Kuntaman Kusmiati, Tutik Laily Hidayati Lestari Dewi Lulus Handayani M. Faiqun Ni'am M. Yamin S. S Makhfudli Makhfudli ManikRetno Wahyunitisari Mohammad Yamin Sunaryo Suwandi Monica Dyah Puspitasari Muhammad Bagus Fidiandra Ni Made Mertaniasih Ni Putu Anggita Medyantari Nurul Wiqoyah, Nurul Nuswantoro, Djohar Pepy Dwi Endraswari, Pepy Dwi Permatasari, Ariani Pramanindyah Bekti Anjani Prasetya, Hanung Purwoko, Agus Putra, Oki Nugraha Putranto, J.Nugroho Eko Rachmat Mudiyono Retno Budiarti Ricky Septafianty Rivan Virlando Suryadinata Ronald Pratama A. Ronald Pratama Adiwinoto Rosantia Sarassari Rudi Hariyono Safira Nur Ainiyah Setiawati, Rosy Sheila Gerhana Darmayanti Shelly Puspita Ayu Wardhani Siti Ermawati Sondang Kuncoro Stephanie Christina Sulaiman Tejowati, Rr Putri Tejowati Titiek sulistyowati Tri Puji Astuti Umiastuti, Pirlina Wahyu Agung Purnomo Wahyu Setiani Wibowo Wahyu Setiani Wibowo Wayan Tunas Artama Yelvi Levani