Claim Missing Document
Check
Articles

IL-4 Level in Rifampicin-Sensitive and Rifampicin-Resistant Lung Tuberculosis Patients Joko Susanto; Jusak Nugraha; Soedarsono Soedarsono
INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY Vol. 27 No. 1 (2020)
Publisher : Indonesian Association of Clinical Pathologist and Medical laboratory

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24293/ijcpml.v27i1.1606

Abstract

Tuberculosis remains a global health burden. Mycobacterium tuberculosis infection causes humoral and cellular responses. Macrophages of patients with pulmonary tuberculosis evolve M1 polarization that blocks infection or immunosuppressive M2, promoting tissue repair mediated by IL-4, IL-10, and IL-13. Previous research showed a decrease of IL-4R and IL-10 expression in lung macrophages of anti-TB drug resistance. A molecular test can detect rifampicin- resistance. There has been no study, which showed the difference in serum IL-4 levels in rifampicin-sensitive and rifampicin-resistant tuberculosis patients. This study aimed to determine the difference between circulating IL-4 levels in rifampicin-sensitive and rifampicin-resistant pulmonary tuberculosis patients. This cross-sectional observational study consecutively recruited subjects based on positive molecular and acid-fast bacilli microscopic examination from MDR-TB Clinic of the Dr. Soetomo Hospital between December 2018 to March 2019. Subjects were classified into a rifampicin-sensitive and rifampicin-resistant group. On ELISA measurement, IL-4 data were analyzed with SPSS version 17. Mann-Whitney U test and ROC analysis tests were performed, and p < 0.05 was significant for α=0.05 (95% CI). There was significant difference between rifampicin-sensitive group (420±281 pg/mL) and rifampicin-resistant group (253±279 pg/mL) (p=0.014). Receiver operating characteristics analysis showed AUC 0.70, the sensitivity of 81.5%, the specificity of 63.6%, and the cut-off value of 235.6 pg/mL. There was a significantly higher level of circulating IL-4 in the rifampicin-sensitive group than the rifampicin-resistant group. IL-4 level in healthy subjects should be measured as the normal value in the population. Immunology and metabolic parameters should be performed to increase sample homogeneity. Further study was also needed to understand the IL-4 role in rifampicin resistance of lung tuberculosis patients in the Indonesia population.
Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates Titiek sulistyowati; Soedarsono; Ni Made Mertaniasih
Journal of Clinical Microbiology and Infectious Diseases Vol. 2 No. 1 (2022): Availabel Online: June 2022
Publisher : Indonesian Society for Clinical Microbiology (Perhimpunan Dokter Spesialis Mikrobiologi Klinik Indonesia)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.51559/jcmid.v2i1.18

Abstract

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.
Karakteristik Pasien Tuberkulosis Paru Dengan HIV di Rumah Sakit Umum Daerah Dr Harjono Ponorogo Periode Januari 2018 - Desember 2022 Anindya Zalfaa Kusuma Dewi; Ronald Pratama A.; Dody Taruna; Irmawati M. Dikman; Soedarsono Soedarsono; Yelvi Levani
Qanun Medika - Jurnal Kedokteran FK UMSurabaya Vol 8 No 02 (2024): Qanun Medika Vol 08 No 02 2024
Publisher : Universitas Muhammadiyah Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30651/jqm.v8i02.21666

Abstract

Tuberculosis (TB) is the most common opportunistic infection in people living with HIV/AIDS in Indonesia, and HIV infection promotes Mycobacterium tuberculosis infection. In ODHIV, the probability of contracting TB is 10% per year. According to the Indonesian Ministry of Health, East Java is in second place with 71,909 cases and has the second highest number of AIDS patients and 824,000 TB cases in Indonesia. This study aims to determine the characteristics of pulmonary tuberculosis patients with HIV at DR Harjono Ponorogo Hospital for the period January 2018 - December 2022. This study applied descriptive research methodology with quantitative techniques with secondary data from medical records of pulmonary TB patients with HIV at Dr. Harjono Ponorogo Hospital for the period January 2018 - December 2022.  The results showed a total sample of 130 medical records, there were several characteristics of TB patients with HIV, namely the highest age group of 30-39 years by 29.2%, more in male gender 73%. More patients had last high school education 38.5%, more treatment duration in patients who did for 9 months 61.5% and the results showed more patients with poor prognosis 56%. In conclusion, the characteristics of TB patients with HIV with the highest group at the age of 3-39 years, having male gender, more high school education, with more treatment duration of 9 months, and the results showed a poor prognosis.
Predictive Positive Value Xpert MTB/RIF in Detecting Mycobacterium tuberculosis on Adult Pulmonary Tuberculosis Patients in Dr. Soetomo Referral Hospital Surabaya Indonesia Akirasena, Mayoori; Mertaniasih, Ni Made; Soedarsono; Permatasari, Ariani
Indonesian Journal of Tropical and Infectious Disease Vol. 12 No. 2 (2024)
Publisher : Institute of Topical Disease Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/ijtid.v12i2.52755

Abstract

Pulmonary tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (Mtb) and transmitted via droplets. Southeast Asia is the largest contributor of TB, and Indonesia itself has the second-highest number in the world with an incidence of approximately 824000 cases. The most common symptoms of active TB are cough, fever, weight loss, and night sweats. The diagnosis can be established upon the confirmation that one of the specimens contains M. tuberculosis. Xpert MTB/RIF provides results in less than 2 hours, whereas culture takes approximately 2-6 weeks. This research aims to evaluate the characteristics and determine the Predictive Positive Value (PPV) percentage of GeneXpert MTB/RIF, utilizing parameters derived from the gold standard examination results, namely culture. This research method is descriptive- analytic based on secondary data extracted from medical records of patients receiving care at the multi-drug resistant TB (MDR-TB) Outpatient Management at Dr. Soetomo Referral Hospital Surabaya from the period January 2019 – April 2022. The results showed that the PPV level of GeneXpert MTB/RIF in detecting the presence of M. tuberculosis is 90%. The diagnosis of pulmonary TB is also supported by the chest X-ray infiltrate's appearance and clinical symptoms of cough, weight loss, fever, and night sweats. Smoking and diabetes are the most common comorbid and risk factors in TB. The conclusion of this study is that the PPV for diagnosing adult pulmonary TB using the Xpert MTB/RIF is relatively high. This suggests the potential use of this method as a diagnosing tool for accurately diagnosing pulmonary tuberculosis.
RE-ENGINEERING PADA PROYEK KONSTRUKSI BANGUNAN GEDUNG (STUDI KASUS: PROYEK PEMBANGUNAN GEDUNG LABORATORIUM KLINIK PRODIA PALEMBANG) Farah Nurul Rakhima; Kartono Wibowo; Soedarsono
Journal of Scientech Research and Development Vol 6 No 2 (2024): JSRD, December 2024
Publisher : Ikatan Dosen Menulis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.56670/jsrd.v6i2.586

Abstract

Teknologi konstruksi di Indonesia terus berkembang, terutama dalam desain dan metode kerja. Pada Proyek Pembangunan Gedung Laboratorium Klinik Prodia Palembang, dilakukan re-engineering untuk mengatasi kendala waktu yang ketat dengan membandingkan dua metode pengecoran beton (ready mix dan ready mix dengan aditif Sika Viscocrete 8007) serta dua jenis bekisting (semi sistem dan sistem penuh). Hasil penelitian menunjukkan bahwa metode beton dengan Sika Viscocrete 8007 lebih efisien, menghemat waktu 28 hari, sementara bekisting sistem penuh mengurangi waktu pengerjaan hingga 24 hari meski biayanya lebih tinggi. Kombinasi beton dengan Sika Viscocrete 8007 dan bekisting semi sistem menjadi pilihan optimal, menghemat biaya Rp 45.608.342,48 dan waktu 28 hari. Temuan ini menegaskan pentingnya metode konstruksi yang tepat untuk efisiensi waktu dan biaya proyek.
Exploring Diabetes Mellitus' Impact on Tuberculosis Outcomes: A Comprehensive Comparative Study Diana, Adawiyah Putri; Adiwinoto, Ronald Pratama; Budiarti, Retno; Soedarsono; Prasetya, Hanung; Putra, Oki Nugraha
Journal of Epidemiology and Public Health Vol. 10 No. 2 (2025)
Publisher : Masters Program in Public Health, Universitas Sebelas Maret, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26911/jepublichealth.2025.10.02.03

Abstract

Background: Tuberculosis (TB) remains among the top ten global causes of mortality, with approximately 1.3 million deaths annually. Diabetes elevates the risk of active TB and treatment failure, potentially increasing drug-resistant TB (DR-TB). This study aimed to compare treatment success rates between TB patients with and without diabetes mellitus (DM) at Dr. Ramelan Central Naval Hospital, Surabaya.Subjects and Method: This cross-sectional study was conducted from January 2019 to December 2023 at Dr. Ramelan Central Naval Hospital Surabaya. A total of 158 patients with TB-DM and TB-NonDM were selected using total sampling. The independent variables were the Presence of Diabetes Mellitus in TB patients (TB-DM vs. Non-TB-DM). The dependent variable was the treatment success rate. The data were collected from patient medical records and analyzed using a chi-square test to compare treatment outcomes between TB-DM and TB-Non-DM patients.Results: The analysis included 158 medical records. Predominantly affecting those over 45 years, both TB-DM and TB-Non-DM patients commonly underwent six months of treatment, with success rates of 78% in TB-DM and 82.4% in TB-Non-DM cases. The chi-square test yielded a p-value of 0.511, indicating no significant difference in treatment success between the groups. However, older age and HIV-positive status were associated with lower odds of treatment success.Conclusion: Success rates were similar between the groups, showing no significant difference based on DM status. Despite similar success rates, older age and HIV-positive status were associated with lower odds of treatment success.
Efek Teripang Terung (Phyllophorus Sp.) Terhadap Kadar HDL Dan LDL Tikus Dengan Diet Tinggi Lemak ANAK AGUNG ISTRI AGUNG, SRILA NATASWARI; LESTARI DEWI; SOEDARSONO; INDRI NGESTI RAHAYU
Hang Tuah Medical Journal Vol 22 No 2 (2025): Hang Tuah Medical Journal
Publisher : Universitas Hang Tuah

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30649/htmj.v22i2.576

Abstract

Cholesterol is divided into two different forms, including HDL (high-density lipoprotein, also referred to as "good fat". LDL (low-density lipoprotein), sometimes known as "bad fat". A buildup of cholesterol levels in the blood that can lead to cardiovascular disease. Sea cucumbers contain flavonoids which are a class of phenolic compounds. Flavonoids have properties as antioxidants. This study was conducted to determine the effect of ethanol extract of sea cucumber (Phyllophorus sp.) on HDL and LDL levels in wistar strain white rats induced by high fat diet. This study was conducted in the biochemistry laboratory of the Faculty of Medicine, Hang Tuah University using 30 white rats (Rattus norvegicus) male wistar strain. The rats were divided into 5 groups, namely, groups of animals that did not receive treatment, groups of animals fed a high-fat diet, groups of animals fed a high-fat diet and sea cucumber ethanol extract 8.5mg/kgBB, groups of animals fed a high-fat diet and sea cucumber ethanol extract at a dose of 17mg/kgBB, groups of animals fed a high-fat diet and simvastatin. On the 35th day, HDL and LDL levels were examined in all groups. The conclusion of the results of this study is that the administration of sea cucumber ethanol extract can increase HDL levels even though it is not significant, and can significantly reduce LDL levels. Keywords: Sea cucumber ethanol extract (Phyllophorus sp.), HDL, LDL, Wistar white rat, high fat diet
Penerapan Sistem Manajemen Keselamatan Dan Kesehatan Kerja (SMK3)  Pada Proyek Pembangunan Jalan Shelly Puspita Ayu Wardhani; Kartono Wibowo; Soedarsono
Jurnal Kesmas Asclepius Vol. 7 No. 2 (2025): Jurnal Kesmas Asclepius
Publisher : Institut Penelitian Matematika, Komputer, Keperawatan, Pendidikan dan Ekonomi (IPM2KPE)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31539/21ffpv62

Abstract

This study aims to evaluate the implementation and success rate of the Occupational Safety and Health Management System “SMK3” in construction projects, referring to Government Regulation (PP) Number 50 of 2012. The method used is descriptive qualitative. The results of the analysis show that the level of implementation of “SMK3” reached 90.96% with the predicate “Satisfactory”. This indicates that the contractor has carried out the duties and functions of “SMK3” well and in accordance with regulations. The implementation of “SMK3” in this project includes several regulations, such as the use of Personal Protective Equipment (PPE) according to the type of work, calls to obey signs, maintain cleanliness, and report emergencies. In addition, this regulation also regulates hazard identification and risk assessment. Overall, it can be concluded that the implementation of “SMK3” in this project is in accordance with PP No. 50 of 2012. The satisfactory implementation of “SMK3” is able to create a safe and productive work environment. Keywords: Identification, Implementation of “SMK3”, PP No. 50 of 2012, Success Rate of SMK3.
Pengaruh Aspek Sanitasi Terhadap Kualitas Kenyamanan Tinggal di Rusunawa Kraton Kota Tegal Tejowati, Rr Putri Tejowati; M. Faiqun Ni'am; Soedarsono
Aptek Jurnal Apliksai Teknologi (APTEK): Volume 16, No. 02, Juni 2024
Publisher : Fakultas Teknik Universitas Pasir Pengaraian

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30606/aptek.v16i2.2413

Abstract

Pembangunan rumah susun sederhana sewa di perkotaan berperanan untuk meminimalisir penggunaan lahan di perkotaan, menyediakan hunian masyarakat tidak mampu dengan lingkungan yang bersih dan sehat. Sanitasi bangunan rusunawa meliputi ketersediaan air bersih, pengolahan air limbah, pengelolaan sampah penting disediakan agar bangunan dan lingkungan bersih, sehat, nyaman sehingga kesehatan penghuni terjamin serta terhindar dari penyakit. Permasalahan timbul berkaitan dengan ketersediaan sarana dan sistem sanitansi semakin dirasakan kurang nyaman oleh penghuni. Tujuan penelitian mengidentifikasi, menganalisis kondisi eksisting sanitasi serta pengaruhnya terhadap penurunan kualitas bangunan dan lingkungan. Analisis dilakukan supaya mendapat rekomendasi perbaikan untuk kenyamanan penghuni. Metode penelitian survey kondisi eksisting, wawancara, kuesioner, analisis deskriptif kuantitatif. Obyek penelitian kondisi sanitasi bangunan dan lingkungan serta hasil kuesioner terhadap penghuni dan pengelola. Hasil penelitian sistim air bersih sangat layak, sistim air limbah sangat tidak layak, sistim sampah layak. Terdapat pengaruh secara silmultan sistim air bersih, air kotor dan air limbah terhadap kualitas bangunan dan lingkungan.
Exploring Diabetes Mellitus' Impact on Tuberculosis Outcomes: A Comprehensive Comparative Study Diana, Adawiyah Putri; Adiwinoto, Ronald Pratama; Budiarti, Retno; Soedarsono; Prasetya, Hanung; Putra, Oki Nugraha
Journal of Epidemiology and Public Health Vol. 10 No. 2 (2025)
Publisher : Masters Program in Public Health, Universitas Sebelas Maret, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26911/jepublichealth.2025.10.02.03

Abstract

Background: Tuberculosis (TB) remains among the top ten global causes of mortality, with approximately 1.3 million deaths annually. Diabetes elevates the risk of active TB and treatment failure, potentially increasing drug-resistant TB (DR-TB). This study aimed to compare treatment success rates between TB patients with and without diabetes mellitus (DM) at Dr. Ramelan Central Naval Hospital, Surabaya.Subjects and Method: This cross-sectional study was conducted from January 2019 to December 2023 at Dr. Ramelan Central Naval Hospital Surabaya. A total of 158 patients with TB-DM and TB-NonDM were selected using total sampling. The independent variables were the Presence of Diabetes Mellitus in TB patients (TB-DM vs. Non-TB-DM). The dependent variable was the treatment success rate. The data were collected from patient medical records and analyzed using a chi-square test to compare treatment outcomes between TB-DM and TB-Non-DM patients.Results: The analysis included 158 medical records. Predominantly affecting those over 45 years, both TB-DM and TB-Non-DM patients commonly underwent six months of treatment, with success rates of 78% in TB-DM and 82.4% in TB-Non-DM cases. The chi-square test yielded a p-value of 0.511, indicating no significant difference in treatment success between the groups. However, older age and HIV-positive status were associated with lower odds of treatment success.Conclusion: Success rates were similar between the groups, showing no significant difference based on DM status. Despite similar success rates, older age and HIV-positive status were associated with lower odds of treatment success.
Co-Authors Abdul Rahman Bahmid Agnes Dwi Sis Perwitasari, Agnes Dwi Sis Agung Dewi Sekar Agustinus Rizki Wirawan Riadi Akirasena, Mayoori Alvin Hartanto Kurniawan, Alvin Hartanto Amelia Lorensia ANAK AGUNG ISTRI AGUNG, SRILA NATASWARI Andri Dwi Wahyudi Andy Sulaiman Siregar Anindya Zalfaa Kusuma Dewi Anita Dewi Anggraini Anita Widyoningroem Bendrong Moediarso Budi Suprapti Budiono Budiono D. Sunarti Deby Kusumaningrum Diana, Adawiyah Putri Dody Taruna Eko Budi Koendhori, Eko Budi Elisabeth Tri Wahyuni Widoretno Farah Nurul Rakhima H. Haryono Indri Ngesti Rahayu Irmawati M. Dikman Isa Ansori Jusak Nugraha Kartono Wibowo Kuntaman Kuntaman Kusmiati, Tutik Laily Hidayati Lestari Dewi Lulus Handayani M. Faiqun Ni'am M. Yamin S. S Makhfudli Makhfudli ManikRetno Wahyunitisari Mohammad Yamin Sunaryo Suwandi Monica Dyah Puspitasari Muhammad Bagus Fidiandra Ni Made Mertaniasih Ni Putu Anggita Medyantari Nurul Wiqoyah, Nurul Nuswantoro, Djohar Pepy Dwi Endraswari, Pepy Dwi Permatasari, Ariani Pramanindyah Bekti Anjani Prasetya, Hanung Purwoko, Agus Putra, Oki Nugraha Putranto, J.Nugroho Eko Rachmat Mudiyono Retno Budiarti Ricky Septafianty Rivan Virlando Suryadinata Ronald Pratama A. Ronald Pratama Adiwinoto Rosantia Sarassari Rudi Hariyono Safira Nur Ainiyah Setiawati, Rosy Sheila Gerhana Darmayanti Shelly Puspita Ayu Wardhani Siti Ermawati Sondang Kuncoro Stephanie Christina Sulaiman Tejowati, Rr Putri Tejowati Titiek sulistyowati Tri Puji Astuti Umiastuti, Pirlina Wahyu Agung Purnomo Wahyu Setiani Wibowo Wahyu Setiani Wibowo Wayan Tunas Artama Yelvi Levani