Article Per Year (5 Year)
p-Index From 2021 - 2026
0.23
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Buletin Peternakan Jurnal Veteriner Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati Indonesian Journal of Tropical and Infectious Disease Jurnal Informatika dan Rekayasa Elektronik
Wayan Tunas Artama
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Computer Science & IT Earth & Planetary Sciences Health Professions Medicine & Pharmacology Public Health Veterinary Other

Published : 17 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 11 Documents
Search
Journal : Jurnal Veteriner

 1   2 
Identifikasi Escherichia coli O157:H7 serta Deteksi Gen Shiga Like Toxin 1 dan 2 Asal Feses Hewan, Daging, dan Feses Manusia I Wayan Suardana; Wayan Tunas Artama; Widya Asmara; Budi Setiadi Daryono
Jurnal Veteriner Vol 11 No 4 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (196.104 KB)

Abstract

Escherichia coli O157:H7 with the ability to produce shiga-like toxin was isolated from beef, cattle,chicken, and human feces. Due to its importance to human health, it is necessary to identify the genesencoding the production of shiga-like toxin, stx1 and stx2 respectively to further understand the pathogenesis.Isolation of E. coli was done on Eosin Methylene Blue Agar (EMBA), followed by identification on SorbitolMacConkey Agar (SMAC), latex agglutination test, and H7 antiserum test, respectivelly. The existence ofgenes stx1 and stx2 in E. coli O157:H7 was confirmed molecularly using PCR method with specific primersLP 30/31 and LP 43/44, Stx2 (F)/Stx2 (R) respectively. Escherichia coli O157:H7 was isolated from 22 outof 344 samples (6,4%). Some isolates showed gene stx1 and stx2 was detected in two isolates as indicatedby a 384 bp band (stx1 gene), 584 bp and 1588 bp bands (stx2 gene) respectivelly. The results indicatedthat local isolates E. coli O157:H7 are potential as a zoonoses agent.
Pelacakan Protein Wingless-Type MMTV Integration Site Family Member-4 pada Uterus Mencit (DETECTION WINGLESS-TYPE MMTV INTEGRATION SITE FAMILY MEMBER-4 PROTEIN OF MOUSE UTERUS) Agung Janika Sitasiwi; Wayan Tunas Artama; Agung Budiyanto; Edy Dharmana
Jurnal Veteriner Vol 17 No 1 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (136.168 KB)

Abstract

The aims of this study was to detect the expression of Wingless-type MMTV integration site familymember 4 (Wnt4) protein in the uterus of Swiss Webster mice. Laboratory animals that were used areadult Swiss Webster mice weighing 25-30 grams. Mice were kept and mated in a controlled laboratoryconditions. Pregnancy was determined by the presence of vaginal plug in female mice after breeding.Protein was isolated from the uterus at seven days of gestation. Immunoblotting was performed usingChemiluminescent Western Blot kit. The primary antibody used was anti Wnt-4 antibody with a 1: 1000dilution. The results showed protein bands with molecular weights ranging from 40 kDa showed a positivereaction to the primary antibody that were used so that it can be concluded that the protein is Wnt4protein.
Analisis Sekuen Probe Gena Shiga Like Toxin-2 dari Isolat Lokal Escherichia coli O157:H7 (PROBE SEQUANCE ANALYSIS OF SHIGA LIKE TOXIN-2 GEN FROM ESCHERICHIA COLI O157:H7 LOCAL ISOLATES) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (580.12 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 was detected in faecal samples of cattle, andhuman as well as in beef. The performance of agent indicated that it has been identified as harmful andoften life-threatening zoonotic agent. It is therefore important to analysed the genetic characteristic ofShiga toxin Escherichia coli (STEC) and to develop a diagnostic probe in order  to optimalized of diagnostictest  for the agent. The  study was started by amplifiying  stx2 gene, purifying of PCR product, sequencingof stx2 gene, analyzing  of phylogenetic tree, and finally  by analyzing   of  diagnostic  probe candidate.Homology study showed that the genetic sequence of the local isolate of  E. coli O157:H7 i.e SM25(1)isolated from cattle feces has  a genetic and fuctional similarity with  the control isolate i.e E. coli O157:H7ATCC 43894 originated from human.  Further study showed that a probe with  foreward primer  sequanceof 5’-AATTTATATGTGGCCGGGTTC-‘3 which were respectively designed as a PFS and PRS 176 bp product.Appeared to be potential candidate of diagnostic probe for the agent.
Virgin Coconut Oil Meningkatkan Aktivitas Fagositosis Makrofag Ayam Pedaging Pascavaksinasi Flu Burung (VIRGIN COCONUT OIL INCREASES THE PHAGOCYTOSIS ACTIVITY OF MACROPHAGE OF BROILER CHICKEN FOLLOWING AVIAN INFLUENZA VACCINATION) Enny Yusuf Wachidah Yuniwarti; Widya Asmara; Wayan Tunas Artama; Charles Rangga Tabbu
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (135.108 KB)

Abstract

The research objective was to find an alternative avian influenza prevention in broilers by increasinganimal’s antibody titer and macrophages phagocytic  activity.  Virgin coconut oil (VCO) is a food supplementthat is proven safe for human consumption therefore it is assumed to be safe for the animal’s (chickens).Factorial design  2 vaccinated: unvaccinated) x 4 (dose of VCO: 0, 5, 10 and 15 mL/kg feed) were applied inthis study.  A total of 40 day day old chick were allocated in the eight treatments groups.  Feed and drinkingwater were available  ad libitum.  Antibody titers of the animals were detected using ELISA, whereasphagocytic activity of the macrophages were detected from spleen.  The result showed that the highestphagocytic activity and antibody titers were seen in chickens which were given VCO at 10 mL/kg feed.  It isconcluded that the VCO could increased the phagocytic activity of macrophages.
Studi Epidemiologi Agen Zoonosis Escherichia coli O157:H7 melalui Analisis Random Amplification of Polymorphic DNA (RAPD) I Wayan Suardana; Wayan Tunas Artama; Widya Asmara; Budi Setiadi Daryono
Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (264.692 KB)

Abstract

Epidemiological studies of zoonotic agent Escherichia coli O157:H7 have been analyzed pheneticallyand or phylogenetically. In a phenetic classification, micoorganisms are arranged into groups (phena) onthe basis of high overall similarity using both phenotypic and genotypic methods without judgementaspect of its ancestry or evolutionary. Due to its importance to epidemiological aspect, the study of geneticvariation of isolates origin from some sources need to be conducted in order to trace the routes of infection.A total of 20 samples obtained from some sources i.e clinically human feces, non-clinically human feces,cattle feces, chicken feces, and beef feces were used in this study. The study was started by confirming allof the isolates using O157 latex agglutination test and H7 antiserum test, followed by genomic DNAanalysis by random amplification of polymorphic DNA /RAPD methods. RAPD results were analyzed using a simple matching coeficient (Ssm) and alogorhythm unweighted pair group method using arithmeticaverages (UPGMA) programe. Results showed there were range of genetic DNA from local isolates (75.1–99,6%) which was almost similar to ATCC 43894 control isolate. The highest similarity (99.6%) to ATCC43894 control was showed by SM-7(1) isolate obtained from cattle fecal and KL-68(1), isolate obtainedfrom clinically human fecal. In addition, KL-52(7) obtained from clinically human fecal had high similarity(99.6%) to MK-35 isolate obtained from chicken fecal. On the other hand, DS-21(4) and DS-16(2) isolatesthat were obtained from beef had high similarity (84.9%) to other isolates including ATCC 43894 controlisolate. The highest similarity of E. coli O157:H7 isolates that were obtained from cattle feces, beef, andchicken feces to human feces isolate indicated that there were both cattle and chicken were potentialreservoirs of the zoonotic agen which can be transmitted to human.
Diagnosis Molekuler Toxoplasma gondii Berdasar Gen Stage Spesifik Takizoit dan Bradizoit pada Ayam Kampung (MOLECULAR DIAGNOSIS OF TOXOPLASMA GONDII BASED ON THE TACHYZOITE AND BRADYZOITE STAGE SPECIFIC GENES IN FREE-RANGE CHICKEN) Ida Ayu Pasti Apsari; Wayan Tunas Artama; Sumartono .; I Made Damriyasa
Jurnal Veteriner Vol 13 No 1 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (144.171 KB)

Abstract

The aims of this study was to determine the presence of Toxoplasma gondii in free-rangechicken using Polymerase Chain Reaction (PCR) method based on the tachyzoite and bradyzoitestage specific genes. SAG1 and BAG1 are the tachyzoite and bradyzoite stage-specific gene respectively.The primers for SAG1 and BAG1 were designed using Web-base Program Primer 3. Genomic DNAfrom free-range chicken heart and brain was isolated using Pure-Link Genomic Isolation Kit.DNA amplification by PCR using primers for SAG1 and BAG1 genes was used for diagnosis ofT.gondii. The results showed that the DNA amplification using primers for SAG1 and BAG1 geneswas successfully applied to determine of Toxoplasma gondii in free-range chicken.
Respons Imunoglobulin-G dan Imunoglobulin-M Mencit yang Diberi Ekstrak Methanol Alga Biru Hijau dan Diinfeksi Dengan Takizoit Sorta Basar Ida Simanjuntak; Sukarti Moeljopawiro; Wayan Tunas Artama; Subagus Wahyuono
Jurnal Veteriner Vol 12 No 4 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (153.616 KB)

Abstract

Toxoplasmosis is an infectious disease caused by Toxoplasma gondii. This disease could severelyaffect humans and animals. Up to now there has been no simple treatment to fight toxoplasmosis. Aprospective alternative treatment to overcome this problem is by increasing immunity of the body using animmunostimulant such as Spirulina platensis. The aims of this research were to observe the potency of S.platensis as an immunostimulant and to find the most potential fraction of S. Platensis that can increasethe responses of IgG and IgM antibodies againts toxoplasma. The responses of these antibodies weremeasured using ELISA method. The isolation of compounds from S. platensis using Preparative ThinLayer Chromatography (PTLC) found three fractions which were a top fraction (I), a middle fraction (II),and a lower fraction (III). Forty-eight mice used in this research were divided into four different groupswith 12 mice in each group and treated differently. The top, middle, and lower fractions of S. platensis wereadministered orally to three groups of mice respectively at dose of 3mg/ml for each mouse while the micein the fourth group were kept as untreated controls. The treatment was conducted for 14 days consecutivelyand on the next day, all mice, including the controls, were challenged with tachizoit. The effect of S.platensisfractions on the responses of IgG and IgM antibodies were then measured at various time intervals, i.e. day0 (before infection) and day 1, 2, and 3 after infection. The results showed that IgG response increased inthe day 0 (2.504 OD) and the day 3 after infection (2.608 OD) while IgM response increased in day 1 afterinfection (2.898 OD). In conclusion, S. platensis was an immunostimulant and the middle fraction (II) of S.Platensis was the most potential fraction to increase immunity againts toxoplasma .
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
Keragaman Genetik Gen NADH Dehydrogenase Subunit 6 pada Monyet Hantu (Tarsius Sp.) (GENETIC DIVERSITY STUDY ON NADH DEHYDROGENASE SUBUNIT 6 GENE OF TARSIUS SP.) Rini Widayanti; Trini Susmiati; Wayan Tunas Artama
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (195.792 KB)

Abstract

In conservation, identification of tarsier species based on morphological and molecular characters isrequired. However, to date the identification of animals is simply based on their morphological characterand vocalizations, while in fact it is difficult to identify each species of Tarsius sp morphologicaly.  Thepurpose of this study is to obtain genetic markers that can be used to identify Tarsius sp on ND6 mitochondrialgenes and reveal affiliations and phylogenetic relationships Tarsius sp. with other members of primates.Samples were obtained from several original habitats of Tarsius sp. Three samples were taken from NorthSulawesi, one sample was collected from Central Sulawesi, three samples from Kalimantan  and threesamples from South Sumatra. The isolated DNA is then used as a template for amplification of DNAfragments by PCR. Amplicon (PCR product) obtained 566 bp and 629 bp. Nucleotide sequencing resultsshows 513 nucleotides, the smallest genetic distances of 0%, the highest of 30.2% and average of 16.3%.Nucleotide and amino acid sequences of ND6 can be used as genetic markers to differenciate T. spectrum,T. dianae and  T. bancanus but they fail to function as genetic markers to distinguish  T. bancanus ofKalimantan and Sumatra origin.
Sekuen Gen Surface Antigen-1 dan Bradizoit Antigen-1 Takizoit Toxoplasma gondii sebagai Kandidat Pemindai DNA (SAG1 AND BAG1 GENE SEQUENCES ANALYSIS OF TOXOPLASMA GONDII TACHYZOITE AS PROBE CANDIDATE) Ida Ayu Pasti Apsari; Wayan Tunas Artama; Sumartono .; I Made Damriyasa
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (344.34 KB)

Abstract

Sag1 and bag1 is a gene specific-stage for Toxoplasma gondii tachyzoite and bradyzoite. The purposeof this study was analyze the sequences of sag1 and bag1 tachyzoite genes of local of Toxoplasma gondiiisolate as deoxyribonucleic acid probe candidate. Tachyzoite of local of Toxoplasma gondii isolate used onthis study. Gene sag1 and bag1 gene of Toxoplasma gondii were amplified by PCR, and then sequenced. Theresults showed sag1 fragment gene contained 612 bp and bag 1 contained 470 bp in length. BLAST analysisof sag1 and bag1 gene fragments as probe candidate showed that high specific for Toxoplasma gondii andno significant cross-reaction fragment with host and other parasites. The sequences 136 bp and 98 bpfragments as DNA probe candidate of Toxoplasma gondii sag1 and bag1 respectively.
Co-Authors Agung Budiyanto Agung Janika Sitasiwi Aris Haryanto BUDI SETIADI DARYONO Charles Rangga Tabbu Dewa Ayu Agus Sri Laksmi Edy Dharmana Enny Yusuf Wachidah Yuniwarti I Made Damriyasa I Nengah Sujaya I Wayan Suardana Ida Ayu Pasti Apsari Ida Bagus Made Oka Ida Bagus Ngurah Swacita Izzati Muhimmah Lalu Mutawalli Lantip Rujito Mahardika Agus Wijayanti Maria Astuti Moh Reza Syaifur Rizal Niken Irfa Nastiti Rini Widayanti Rini Widayanti Rohmatul Fajriyah Sorta Basar Ida Simanjuntak Sorta Basar Ida Simanjuntak Subagus Wahyuono Sukarti Moeljopawiro Sumartono - Sumartono . Trini Susmiati Unicha, Mutiara Shinta Noviar Widya Asmara Yuriadi . Yustina Yuni Surandiyah