Article Per Year (5 Year)
p-Index From 2021 - 2026
0.23
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Buletin Peternakan Buletin Veteriner Udayana Jurnal Veteriner Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati Indonesian Journal of Tropical and Infectious Disease Jurnal Informatika dan Rekayasa Elektronik
Wayan Tunas Artama
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemistry Computer Science & IT Earth & Planetary Sciences Health Professions Immunology & microbiology Medicine & Pharmacology Public Health Veterinary Other

Published : 18 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 18 Documents
Search

 1   2 
Diagnosis Molekuler Toxoplasma gondii Berdasar Gen Stage Spesifik Takizoit dan Bradizoit pada Ayam Kampung (MOLECULAR DIAGNOSIS OF TOXOPLASMA GONDII BASED ON THE TACHYZOITE AND BRADYZOITE STAGE SPECIFIC GENES IN FREE-RANGE CHICKEN) Ida Ayu Pasti Apsari; Wayan Tunas Artama; Sumartono .; I Made Damriyasa
Jurnal Veteriner Vol 13 No 1 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (144.171 KB)

Abstract

The aims of this study was to determine the presence of Toxoplasma gondii in free-rangechicken using Polymerase Chain Reaction (PCR) method based on the tachyzoite and bradyzoitestage specific genes. SAG1 and BAG1 are the tachyzoite and bradyzoite stage-specific gene respectively.The primers for SAG1 and BAG1 were designed using Web-base Program Primer 3. Genomic DNAfrom free-range chicken heart and brain was isolated using Pure-Link Genomic Isolation Kit.DNA amplification by PCR using primers for SAG1 and BAG1 genes was used for diagnosis ofT.gondii. The results showed that the DNA amplification using primers for SAG1 and BAG1 geneswas successfully applied to determine of Toxoplasma gondii in free-range chicken.
Respons Imunoglobulin-G dan Imunoglobulin-M Mencit yang Diberi Ekstrak Methanol Alga Biru Hijau dan Diinfeksi Dengan Takizoit Sorta Basar Ida Simanjuntak; Sukarti Moeljopawiro; Wayan Tunas Artama; Subagus Wahyuono
Jurnal Veteriner Vol 12 No 4 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (153.616 KB)

Abstract

Toxoplasmosis is an infectious disease caused by Toxoplasma gondii. This disease could severelyaffect humans and animals. Up to now there has been no simple treatment to fight toxoplasmosis. Aprospective alternative treatment to overcome this problem is by increasing immunity of the body using animmunostimulant such as Spirulina platensis. The aims of this research were to observe the potency of S.platensis as an immunostimulant and to find the most potential fraction of S. Platensis that can increasethe responses of IgG and IgM antibodies againts toxoplasma. The responses of these antibodies weremeasured using ELISA method. The isolation of compounds from S. platensis using Preparative ThinLayer Chromatography (PTLC) found three fractions which were a top fraction (I), a middle fraction (II),and a lower fraction (III). Forty-eight mice used in this research were divided into four different groupswith 12 mice in each group and treated differently. The top, middle, and lower fractions of S. platensis wereadministered orally to three groups of mice respectively at dose of 3mg/ml for each mouse while the micein the fourth group were kept as untreated controls. The treatment was conducted for 14 days consecutivelyand on the next day, all mice, including the controls, were challenged with tachizoit. The effect of S.platensisfractions on the responses of IgG and IgM antibodies were then measured at various time intervals, i.e. day0 (before infection) and day 1, 2, and 3 after infection. The results showed that IgG response increased inthe day 0 (2.504 OD) and the day 3 after infection (2.608 OD) while IgM response increased in day 1 afterinfection (2.898 OD). In conclusion, S. platensis was an immunostimulant and the middle fraction (II) of S.Platensis was the most potential fraction to increase immunity againts toxoplasma .
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
Keragaman Genetik Gen NADH Dehydrogenase Subunit 6 pada Monyet Hantu (Tarsius Sp.) (GENETIC DIVERSITY STUDY ON NADH DEHYDROGENASE SUBUNIT 6 GENE OF TARSIUS SP.) Rini Widayanti; Trini Susmiati; Wayan Tunas Artama
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (195.792 KB)

Abstract

In conservation, identification of tarsier species based on morphological and molecular characters isrequired. However, to date the identification of animals is simply based on their morphological characterand vocalizations, while in fact it is difficult to identify each species of Tarsius sp morphologicaly.  Thepurpose of this study is to obtain genetic markers that can be used to identify Tarsius sp on ND6 mitochondrialgenes and reveal affiliations and phylogenetic relationships Tarsius sp. with other members of primates.Samples were obtained from several original habitats of Tarsius sp. Three samples were taken from NorthSulawesi, one sample was collected from Central Sulawesi, three samples from Kalimantan  and threesamples from South Sumatra. The isolated DNA is then used as a template for amplification of DNAfragments by PCR. Amplicon (PCR product) obtained 566 bp and 629 bp. Nucleotide sequencing resultsshows 513 nucleotides, the smallest genetic distances of 0%, the highest of 30.2% and average of 16.3%.Nucleotide and amino acid sequences of ND6 can be used as genetic markers to differenciate T. spectrum,T. dianae and  T. bancanus but they fail to function as genetic markers to distinguish  T. bancanus ofKalimantan and Sumatra origin.
Sekuen Gen Surface Antigen-1 dan Bradizoit Antigen-1 Takizoit Toxoplasma gondii sebagai Kandidat Pemindai DNA (SAG1 AND BAG1 GENE SEQUENCES ANALYSIS OF TOXOPLASMA GONDII TACHYZOITE AS PROBE CANDIDATE) Ida Ayu Pasti Apsari; Wayan Tunas Artama; Sumartono .; I Made Damriyasa
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (344.34 KB)

Abstract

Sag1 and bag1 is a gene specific-stage for Toxoplasma gondii tachyzoite and bradyzoite. The purposeof this study was analyze the sequences of sag1 and bag1 tachyzoite genes of local of Toxoplasma gondiiisolate as deoxyribonucleic acid probe candidate. Tachyzoite of local of Toxoplasma gondii isolate used onthis study. Gene sag1 and bag1 gene of Toxoplasma gondii were amplified by PCR, and then sequenced. Theresults showed sag1 fragment gene contained 612 bp and bag 1 contained 470 bp in length. BLAST analysisof sag1 and bag1 gene fragments as probe candidate showed that high specific for Toxoplasma gondii andno significant cross-reaction fragment with host and other parasites. The sequences 136 bp and 98 bpfragments as DNA probe candidate of Toxoplasma gondii sag1 and bag1 respectively.
Seroprevalensi yang Tinggi dan Faktor-Faktor Risiko Toksoplasmosis pada Darah Donor dan Wanita di Bali (HIGH SEROPREVALENCE AND RISK FACTORS OF TOKSOPLASMOSIS AMONG BLOOD DONORS AND WOMEN IN BALI) Dewa Ayu Agus Sri Laksemi; Wayan Tunas Artama; Mahardika Agus Wijayanti
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (124.775 KB)

Abstract

Toxoplasmosis is an important public health problem because of its worldwide distribution, economicand social impact due to high sequele that may cause such as mental retardation and blindness in children.The aims of this study were to asses serological prevalence of toxoplasmosis in donors and women in Baliand get an overview of association between risk factors and toxoplasmosis infection, i.e.: comprising catownership, food pattern, occupation related to contact with raw meat and activities related to contact withsoil. Serum samples were collected from donors consecutively, while simple cluster design was used forsampling woman. Data on demographics and risk factors for toxoplasmosis were obtained usingquestionnaire. Serological prevalence of toxoplasmosis in donors was 35,9%, while in women was 63.9%.Serological prevalence of toxoplasmosis  in donors at District Badung was 29,2%, Tabanan 36.8%, Gianyar25.0%, Denpasar 41.1%, Klungkung 25.0%, and Bangli 8.3%. Serological prevalence of toxoplasmosis  inwomen at District Badung was 33.3%, Tabanan 66.5%, Gianyar 82.5%, Denpasar 71.1%, Klungkung 81.5%and Bangli 16.7%. Risk factor that play a role in toxoplasmosis infection were food pattern and occupationrelated to contact with soil. The seroprevalence of toxoplasmosis in voluntary blood donors and child-bearing age is relatively high due to local habbit of Balinese society that consume raw meat called lawarand sate
Pengaruh Pemberian Ekstrak Spirulina platensis terhadap Respon Imun Humoral Mencit setelah Uji Tantang Dengan Takizoit Sorta Basar Ida Simanjuntak; Sukarti Moeljopawiro; Wayan Tunas Artama; Subagus Wahyuono
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 16, No 1 (2011): February 2011
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v16i1.61

Abstract

Toksoplasmosis adalah penyakit yang disebabkan oleh infeksi Toxoplasma gondii. Penyakit ini sangat berbahaya pada hewan maupun manusia. Toksoplasmosis sampai sekarang masih sulit ditanggulangi. Untuk itu, dicari akternatif dengan cara pemberian imunostimulator, seperti Spirulina platensis. Tujuan penelitian ini adalah untuk mengetahui ekstrak Spirulina platensis yang paling potensial meningkatkan respon imun humoral dan mengetahui dosis Spirulina platensis yang efektif dalam meningkatkan respons imun humoral. Rancangan penelitian adalah Rancangan Acak Lengkap pola Faktorial. Faktor pertama adalah jenis ekstrak (ekstrak etil asetat, ekstrak air dan Spirulina platensis murni). Faktor kedua adalah dosis ekstrak (0, 5, 10, 15 mg/ekor mencit). Hasil penelitian menunjukkan bahwa ekstrak etil asetat dengan dosis 5 mg/ekor mencit adalah yang terbaik meningkatkan respon imun humoral. Uji lanjut dengan Latin Square Design (LSD) menunjukkan bahwa terdapat interaksi antara jenis ekstrak dan dosis ekstrak.
Novel Potential Immune Response Biomarkers to Multidrug-Resistant Tuberculosis in the Last Five Years Unicha, Mutiara Shinta Noviar; Wayan Tunas Artama; Niken Irfa Nastiti
Indonesian Journal of Tropical and Infectious Disease Vol. 10 No. 1 (2022)
Publisher : Institute of Topical Disease Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/ijtid.v10i1.32119

Abstract

Rapid and accurate detection performs an important role in the control of raising MDR-TB. Currently, studies on biomarkers as targets for TB diagnostic tests using immune response products to indicate the presence, mycobacterial load, early markers, and activity, diff erentiation, and progression markers of TB infection are rapidly available. This systematic review aims to summarize the last fi ve years of potential biomarkers studies from the immune response for MDR-TB rapid diagnostic development. The authors performed a literature search on four databases as ProQuest, EBSCO Academic Search, Universitas Gadjah Mada Online Library Journal Database, and Google Scholar, retrieved from January 2016 to December 2021. In total, 18,288 articles were identifi ed and three tudies met the inclusion criteria. Several promising biomarkers were found for MDR-TB diagnosis purposes, such as sCD14, PGLYRP2, FGA, Indoleamine 2, 3- dioxygenase (IDO), and Complement Receptor 2 (CR2). A combination of sCD14, PGLYRP2, and FGA were bringing a diagnostic design with a higher sensitivity (94.7%) and specifi city (80%) than the design of a single protein. Higher IDO activity towards the MDR-TB group than in the DS-TB group with a sensitivity of 87.50 %, specifi city of 72.22 %. CR2 was the main focus due to its association with IL-6. After induction of CR2 peptide in a dose-dependent manner, the expression level of IL-6 was decreased signifi cantly. It might because of CR2 peptide regulating the macrophages proinfl ammatory cytokines secretion to decrease the local infl ammation of the immune response. These biomarkers are strong candidates for MDR-TB diagnosis due to their important role as the pathogenesis marker of MDR-TB. There is a need of further research to investigate those immune response products and their role to eliminate infection of Mycobacterium tuberculosis directly.
Co-Authors Agung Budiyanto Agung Janika Sitasiwi Aris Haryanto BUDI SETIADI DARYONO Charles Rangga Tabbu Dewa Ayu Agus Sri Laksmi Edy Dharmana Enny Yusuf Wachidah Yuniwarti I Made Damriyasa I Nengah Sujaya I Wayan Suardana Ida Ayu Pasti Apsari Ida Bagus Made Oka Ida Bagus Ngurah Swacita Izzati Muhimmah Lalu Mutawalli Lantip Rujito Mahardika Agus Wijayanti Maria Astuti Moh Reza Syaifur Rizal Niken Irfa Nastiti Rini Widayanti Rini Widayanti Rohmatul Fajriyah Sorta Basar Ida Simanjuntak Sorta Basar Ida Simanjuntak Subagus Wahyuono Sukarti Moeljopawiro Sumartono - Sumartono . Trini Susmiati Unicha, Mutiara Shinta Noviar Widya Asmara Yuriadi . Yustina Yuni Surandiyah