Claim Missing Document
Check
Articles

Training of Halal Product Process Assistant for Alumni of the UNP Biology Department to Assist Micro and Middle Class Businessman in Self-Declare Halal Certification Afifatul Achyar; Violita Violita; Rijal Satria; Vauzia Vauzia; Yusni atifah
Pelita Eksakta Vol 6 No 2 (2023): Pelita Eksakta, Vol. 6, No. 2
Publisher : Fakultas MIPA Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/pelitaeksakta/vol6-iss2/228

Abstract

The Halal Product Guarantee Organizing Agency (BPJPH) of the Indonesian Ministry of Religion requires human resources as qualified Halal Product Process Assistants (PPH) to help accelerate the halal certification process for MSE products in Indonesia. On the other hand, there are not many alumni of the Biology Department, FMIPA UNP who got jobs in less than 6 months after graduating. Therefore, the solution offered to the problems faced by partners is to conduct halal product process assistance (PPH) training for alumni of the Biology Department, FMIPA UNP so that they have the capacity and competence to assist MSE business actors in halal certification of their products through a self-declaration scheme. Community service activities consist of two main activities, namely the delivery of material about the halal certification self-declaration scheme and the practice of halal product process assistance (PPH) simulations. The competency of PPH assistants is evaluated and used as an indicator of graduation.
Analysis of Genetic Variations in bHLH Protein (Rc) Gene Sequences in Rice (Oryza) NCBI PopSet 2496581476 Using In-Silico RFLP: Analisis Variasi Genetik Sekuen Gen Rc-bHLH Protein pada Padi (Oryza) NCBI PopSet 24596581476 Menggunakan RFLP secara In-Silico Hasanah, Nurul; Violita, Violita; Achyar, Afifatul
Tropical Genetics Vol. 3 No. 2 (2023): Genetics
Publisher : Genetikawan Muda Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/tg.v3i2.50

Abstract

Rice is a plant from the Graminae Family that is spread almost throughout the region. In rice, there is an Rc gene that codes for the formation of the basic loop-helix-loop (bHLH) protein, the Rc gene (Rc-bHLH) functions as a transcription of color pigments in brown rice. This research was conducted computationally from several related sites. The study used restriction enzyme BstUI with a side recognition of 5'-CG'CG-3'. The purpose of this study was to analyze the genetic variation of the Rc gene sequence encoding the bHLH protein in NCBI PopSet rice 2496581476 using RFLP in silico. The results showed that there were genetic variations of the Rc-bHLH gene, 2 allele variations were present in 21 rice sequences using the restriction enzyme BstUI.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Kontribusi Pupuk Organik Kotoran Sapi Terhadap Tinggi Tanaman Padi (Oryza sativa L.) Syahfitri, Aulia Insyani; Anhar, Azwir; Violita, Violita; Kardiman, Reki
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.339

Abstract

Continuous use of inorganic fertilizers on rice plants has a negative impact on soil productivity and the environment so that plant growth is disrupted. Therefore, it can be used to reduce the impact of using inorganic fertilizers by using organic fertilizers. This research aims to determine the effect of the composition of organic cow dung fertilizer and inorganic fertilizer on the growth of rice plants which was carried out from July to November 2023 at the Plant Physiology and Wire House Laboratory, Department of Biology, Faculty of Mathematics and Natural Sciences, Padang State University. This research was structured using a Completely Randomized Design (CRD) consisting of 6 treatments and 4 replications. The treatment given consisted of A = 100% NPK Fertilizer + 0% Cow Manure, B = 80% NPK Fertilizer + 20% Cow Manure, C = 60% NPK Fertilizer + 40% Cow Manure, D = 40% NPK Fertilizer + 60% Cow Manure Fertilizer, E = 20% NPK Fertilizer + 80% Cow Manure Fertilizer, F = 0% NPK Fertilizer + 100% Cow Manure Fertilizer. The results showed that the influence of the composition of inorganic NPK fertilizer and organic cow dung fertilizer for rice plants had no significant effect on plant height at 15, 30, 45 and 60 HST.
Analisis Kualitas Butir Soal Ujian Tengah Semester (UTS) Ganjil Biologi Kelas XI SMAN 1 Pancung Soal Putri, Annisa Anike; Zulyuri, Zulyuri; Violita, Violita
Jurnal Metaedukasi: Jurnal Ilmiah Pendidikan Vol 4, No 2 (2022): Metaedukasi
Publisher : Universitas Siliwangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37058/metaedukasi.v4i2.4087

Abstract

Penelitian ini bertujuan untuk mengetahui kualitas butir soal UTS Ganjil Biologi Kelas XI SMAN 1 Pancung Soal. Metode penelitian yang digunakan adalah penelitian deskriptif kuantitatif. Adapun sampel dalam penelitian ini yaitu siswa Biologi kelas XI SMAN 1 Pancung Soal tahun ajaran 2021/2022 dengan jumlah 16 siswa. Teknik pengumpulan data yang digunakan berupa dokumentasi. Instrumen penelitian ini meliputi 25 soal pilihan ganda, kunci jawaban, dan lembar jawaban hasil pekerjaan siswa. Hasil penelitian dianalisis validitas, reliabilitas, tingkat kesukaran, daya pembeda, dan efektivitas pengecoh menggunakan bantuan software Anates 4.0.9. Hasil penelitian menunjukkan bahwa dari aspek validitasnya yaitu terdapat 1 (4%) butir soal dengan kategori tinggi, 4 (16%) butir soal dengan kategori cukup, 14 (56%) butir soal dengan kategori sangat rendah, 3 (12%) butir soal  dengan kategori rendah serta juga ada 3 (12%) butir soal yang tidak terbaca tingkat kevalidannya. Aspek reliabilitasnya yaitu memiliki kriteria sangat rendah dengan harga r statistik sebesar -2,88. Aspek tingkat kesukarannya yaitu tidak diperoleh butir soal dengan kriteria mudah, hanya kriteria sedang dengan jumlah 9 (36%) butir soal dan kriteria sukar dengan jumlah 16 (64%) butir soal. Aspek daya pembedanya yaitu terdapat 5 (20%) dengan kriteria sangat baik (diterima), 6 (24%) butir soal dengan kriteria sedang (diterima dan revisi), 8 (31%) butir soal dengan kriteria jelek (direvisi), dan 5 (24%) butir soal dengan kriteria sangat jelek (harus dibuang/diganti). Kemudian aspek kualitas pengecoh (distractor) yaitu dari 25 butir soal hanya terdapat 3 (12%) butir soal yang semua distraktornya berfungsi dengan baik dan 22 (88%) butir soal yang distraktornya ada yang berfungsi dan ada yang tidak berfungsi sama sekali. Hasil analisis ini mengindikasikan bahwa secara keseluruhan soal tes tersebut harus direvisi kembali sehingga dapat digunakan lagi dalam tes hasil belajar yang akan datang.
Analisis Kualitas Butir Soal Ujian Tengah Semester Mata Pelajaran Biologi Kelas X di MAN 1 Solok Selatan Alti, Rizka Putri; Zulyuri, Zulyuri; Violita, Violita
Jurnal Metaedukasi: Jurnal Ilmiah Pendidikan Vol 4, No 2 (2022): Metaedukasi
Publisher : Universitas Siliwangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37058/metaedukasi.v4i2.4089

Abstract

Analisis butir soal adalah proses mengkaji kualitas soal pada setiap butirnya. Hal ini bertujuan untuk melihat apakah soal yang digunakan dalam tes penilaian terhadap peserta didik sudah dapat mengukur sesuai dengan tujuan pembelajaran di sekolah atau belum. Pada penilitian ini dilakukan analisis terhadap Soal Ujian Tengah Semester Mata Pelajaran Biologi Kelas X di MAN 1 Solok Selatan terhadap validitas, reliabilitas, daya pembeda dan tingkat kesukaran soal. Jenis penelitian ini adalah penelitian kuantitatif dengan pendekatan deskriptif. Subjek dalam penelitian sebanyak 30 orang peserta didik kelas X MAN 1 Solok Selatan pada semester ganjil tahun pelajaran 2021/2022. Teknik pengumpulan data yang digunakan yaitu melalui instrumen tes berupa soal-soal pilihan ganda ujian tengah semester sebanyak 25 butir soal, lembar jawaban peserta didik, dan kunci jawaban. Analisis data penelitian menggunakan Anates versi 4.0.9 yang dikembangkan oleh Drs. Karno, M.Pd dan Yusuf Wibisono, ST. Adapun hasil analisis kualitas butir soal dilihat dari tingkat validitas empiris diperoleh 5 soal dengan kategori signifikan, reliabilitas 0.37 (rendah), daya pembeda soal kategori dibuang (12%), jelek (28%), cukup (48%), baik (8%) dan baik sekali (4%), dari segi tingkat kesukaran soal sudah bervariasi, kategori Sangat Mudah (16%), Mudah (8%), Sedang (64%), Sukar (8%) dan Sangat Sukar (4%). Soal ujian tengah semester yang dikembangkan guru belum memenuhi kriteria alat evaluasi pembelajaran dan belum dapat digunakan untuk mengukur ketercapaian pembelajaran di sekolah karena tergolong belum baik.
The Effect of Gibberellin Hormone Concentration dan Soaking Duration on The Vigor Indeks of Black Glutinous Rice Seeds (Oryza sativa Linn Var. glutinousa) Expired Christy, Arifah; Noficandra, Habibullah; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.243

Abstract

This study aims to determine the best concentration of gibberellin hormone and soaking duration for increasing the viability of expired black glutinous rice seeds. The study was conducted using a complete randomized design (RAL) with a two-factor treatment. The first factor related to variations in the concentration of gibberellin hormone is 0%, 1.5%, 2%, 2.5%, and 3%. The second factor is related to the length of soaking with variations of 12 hours, 24 hours, and 48 hours. Each treatment is carried out in 4 repetitions with parameters of vigor index. The results of this study showed that the treatment of varying concentrations of gibberellin hormone and variations in soaking time showed a significant effect on the control group (p <0.05) germination of expired black glutinous rice seeds Key words : Rice seeds, Expiration, Gibberellin hormone, Germination, Vigor Index
Pengaruh Ecoenzyme Teknologi Nano Terhadap Pertumbuhan Pakcoy (Brassica rapa L.) yang Dibudidayakan Secara Hidroponik Rizka Meisy Evis Putri; Fevria, Resti; M, Des; Violita, Violita
Produksi Tanaman Vol. 11 No. 6 (2023): Juni
Publisher : Jurusan Budidaya Pertanian Fakultas Pertanian Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.protan.2023.011.06.01

Abstract

Peningkatan produksi pakcoy pada lahan yang sempit dapat menggunakan budidaya hidroponik. Hidroponik adalah budidaya tanaman menggunakan air dan membutuhkan larutan nutrisi untuk pertumbuhan tanaman. Upaya mengurangi penggunaan nutrisi AB Mix yang tidak ramah terhadap lingkungan, digunakan pupuk organik dari ecoenzyme. Solusi mengatasi pengendapan nutrisi adalah teknologi nano yang sifatnya slow release dan meningkatkan penyerapan unsur hara. Penelitian ini bertujuan mengetahui pengaruh ecoenzyme teknologi nano terhadap pertumbuhan pakcoy (Brassica rapa L.) yang dibudayakan secara hidroponik. Penelitian dilaksanakan bulan Juli-Desember 2022 di Laboratorium Penelitian dan rumah kawat Departemen Biologi, Universitas Negeri Padang. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) 6 perlakuan dan 5 ulangan : Kontrol (Air sumur+AB Mix), P1 (Air Nano+100% AB Mix), P2 (Air Nano+25% Ecoenzyme Nano+75% AB Mix), P3 (Air Nano+50% Ecoenzyme Nano+50% AB Mix), P4 (Air Nano+75% Ecoenzyme Nano+25% AB Mix), P5 (Air Nano+100% Ecoenzyme Nano). Data dianalisis dengan ANOVA dan dilanjutkan uji DNMRT pada taraf 5%. Hasil penelitian menunjukkan bahwa pertumbuhan tinggi tanaman, jumlah daun, berat basah dan berat kering tanaman tertinggi terdapat pada perlakuan P2 (Air Nano+75% AB Mix+25% Ecoenzyme Nano), sedangkan luas daun tertinggi pada P3 (Air Nano+50% AB Mix+50% Ecoenzyme Nano). Pengunaan ecoenzyme teknologi nano berpengaruh terhadap pertumbuhan pakcoy yang dibudidayakan secara hidroponik. Kata Kunci: AB Mix, ecoenzyme, hidroponik, pakcoy, tekologi nano
Effect of Ecoenzyme Addition on Corn-Based Trichoderma asperellum Formula on Spore Count Tarigan, Siti Nadiah Zahra Br; Anhar, Azwir; Farma, Sisca Alicia; Violita, Violita
Jurnal Biologi Tropis Vol. 25 No. 2 (2025): April-Juni
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i2.8607

Abstract

Trichoderma asperellum is recognized as an effective biocontrol agent and plant growth promoter, playing a vital role in sustainable agriculture. To enhance the efficacy of Trichoderma formulations, ecoenzyme supplementation has been proposed as a promising approach. This study investigated the effect of ecoenzyme supplementation on the spore count of corn-based Trichoderma asperellum formulations. A Completely Randomized Design (CRD) was employed with five treatments and five replicates, and spore counts were assessed under varying concentrations of ecoenzyme (0%, 20%, 40%, 60%, and 80%). The results indicated that a 60% ecoenzyme concentration significantly increased the spore count, reaching a maximum of 252.32 × 10⁶ spores. However, higher concentrations (80%) resulted in a decreased spore count (174.88 × 10⁶), which was similar to that of the control (172.6 × 10⁶), likely due to toxic effects or nutrient imbalances. These findings highlight the importance of selecting the optimal ecoenzyme concentration to maximize the spore count of Trichoderma asperellum, thereby contributing to more effective biocontrol and biofertilizer applications in sustainable agricultural practices.
Betasianin Analysis of Dragon Fruit (Hyolecerus polyrhizus) West Sumatra as A Natural Colorant Putri, Amaliani; Yuniarti, Elsa; Violita, Violita; Chatri, Moralita
Jurnal Biologi Tropis Vol. 25 No. 2 (2025): April-Juni
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i2.8866

Abstract

The growing demand for natural food colorants, driven by consumer awareness of the health risks associated with synthetic additives, has increased the exploration of plant-based pigments. Betacyanin, a red-violet pigment in the betalain group, has drawn attention for its color stability and antioxidant properties. This study aimed to analyze the betacyanin content in the peel of red dragon fruit (Hylocereus polyrhizus) from two cultivation areas in West Sumatra (Tanah Datar and Bukittinggi) as a potential natural food colorant. The dragon fruit peels were dried, ground into powder, and extracted using 10% citric acid solution. The extract was concentrated and analyzed using UV-Vis spectrophotometry. Results showed a significant difference in betacyanin levels between the two sources: Tanah Datar samples had an average of 28.48±0.19 mg/100g, while Bukittinggi samples had 3.52±0.07 mg/100g. These findings suggest that geographical and environmental factors significantly affect pigment accumulation. It is recommended that Tanah Datar dragon fruit peel be further developed as a natural colorant due to its high betacyanin content, supporting sustainable practices and waste reduction in food processing.