Article Per Year (5 Year)
p-Index From 2020 - 2025
3.982
P-Index
This Author published in this journals
All Journal Bioscience Jurnal Produksi Tanaman Jurnal Penelitian Pendidikan IPA (JPPIPA) Jurnal Biologi Tropis Jurnal Ilmiah Ilmu Keperawatan Indonesia (Indonesian Nursing Scientific Journal) Bioedukasi: Jurnal Pendidikan Biologi Serambi Biologi Pelita Eksakta Jurnal Metaedukasi : Jurnal Ilmiah Pendidikan Natural Science: Jurnal Penelitian Bidang IPA dan Pendidikan IPA International Journal of Education and Literature (IJEL) Tropical Genetics Jurnal Serambi Biologi Literasi Bahasa dan Sastra Jurnal
Violita Violita
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Earth & Planetary Sciences Education Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Physics Transportation Veterinary Other

Published : 28 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 28 Documents
Search

 1   2   3 
Training of Halal Product Process Assistant for Alumni of the UNP Biology Department to Assist Micro and Middle Class Businessman in Self-Declare Halal Certification Afifatul Achyar; Violita Violita; Rijal Satria; Vauzia Vauzia; Yusni atifah
Pelita Eksakta Vol 6 No 2 (2023): Pelita Eksakta, Vol. 6, No. 2
Publisher : Fakultas MIPA Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/pelitaeksakta/vol6-iss2/228

Abstract

The Halal Product Guarantee Organizing Agency (BPJPH) of the Indonesian Ministry of Religion requires human resources as qualified Halal Product Process Assistants (PPH) to help accelerate the halal certification process for MSE products in Indonesia. On the other hand, there are not many alumni of the Biology Department, FMIPA UNP who got jobs in less than 6 months after graduating. Therefore, the solution offered to the problems faced by partners is to conduct halal product process assistance (PPH) training for alumni of the Biology Department, FMIPA UNP so that they have the capacity and competence to assist MSE business actors in halal certification of their products through a self-declaration scheme. Community service activities consist of two main activities, namely the delivery of material about the halal certification self-declaration scheme and the practice of halal product process assistance (PPH) simulations. The competency of PPH assistants is evaluated and used as an indicator of graduation.
Meta-Analysis Study: Correlation Study of the Influence of Motivation on Student Learning Outcomes Zulyusri; Ida Elfira; Violita Violita; Tomi Apra Santosa
International Journal of Education and Literature Vol. 1 No. 3 (2022): December : International Journal of Education and Literature
Publisher : Pusat Riset dan Inovasi Nasional

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55606/ijel.v1i3.43

Abstract

This study intends to investigate the relationship between motivation and student learning outcomes. Impact measures in several studies that examined the relationship between the influence of motivation on student learning outcomes were analyzed using a meta-analysis procedure. Empirical data were collected using electronic search engines such as Google Scholar, Garuda Portal, and national journal URLs. The effect size is used as a starting point for data analysis. A systematic review of research findings in Indonesia's national e-journal was used, with 18 articles selected as a sample that met the criteria. The results of calculating the combined effect size obtained a p-value of less than 0.001 and an estimated value of 0.825. A meta-analysis study found that motivation and learning outcomes had a significant relationship, with the strength of the relationship in the high category. The variance of the studies analyzed is also very high, with I2 test results far exceeding 50%, implying that this study is heterogeneous, with a significant estimate value in the SMK subgroup category (estimated value 1,031) with a p-value of 0.001 and the SMP subgroup (estimated value 1.186) with a p-value of 0.005.
Analysis of Genetic Variations in bHLH Protein (Rc) Gene Sequences in Rice (Oryza) NCBI PopSet 2496581476 Using In-Silico RFLP: Analisis Variasi Genetik Sekuen Gen Rc-bHLH Protein pada Padi (Oryza) NCBI PopSet 24596581476 Menggunakan RFLP secara In-Silico Hasanah, Nurul; Violita, Violita; Achyar, Afifatul
Tropical Genetics Vol. 3 No. 2 (2023): Genetics
Publisher : Genetikawan Muda Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/tg.v3i2.50

Abstract

Rice is a plant from the Graminae Family that is spread almost throughout the region. In rice, there is an Rc gene that codes for the formation of the basic loop-helix-loop (bHLH) protein, the Rc gene (Rc-bHLH) functions as a transcription of color pigments in brown rice. This research was conducted computationally from several related sites. The study used restriction enzyme BstUI with a side recognition of 5'-CG'CG-3'. The purpose of this study was to analyze the genetic variation of the Rc gene sequence encoding the bHLH protein in NCBI PopSet rice 2496581476 using RFLP in silico. The results showed that there were genetic variations of the Rc-bHLH gene, 2 allele variations were present in 21 rice sequences using the restriction enzyme BstUI.
Application of Foot Massage Therapy Procedures Using Lavender Essential Oil on Clients With Hypertension in RT 001 RW 01 Baru Village, Pasar Rebo District, East Jakarta Resmiari, Resmiati; Handayani, Nurhayati Dwi; Violita, Violita; Suciyatiningrum, Risma
Jurnal Ilmiah Ilmu Keperawatan Indonesia Vol 11 No 03 (2021): Jurnal Ilmiah Ilmu Keperawatan Indonesia (JIIKI) Volume 11 Number 3 September 2
Publisher : UIMA Press

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (604.848 KB) | DOI: 10.33221/jiiki.v11i03.1372

Abstract

Background: Hypertension is one of the main problems in the world of health in Indonesia and the world. According to WHO (2011) there are 1 billion people in the world suffer from hypertension and 2/3 of them are in developing countries. This condition requires pharmacological and nonpharmacological treatment. One of them, giving foot massage therapy using lavender essential oil. Objective: This study aims to determine the effectiveness of applying foot massage procedures using lavender essential oil on hypertensive clients. Methods: This study uses a qualitative design to describe in-depth information about the application of foot massage therapy procedures using lavender essential oil on clients who have hypertension. Result: Foot massage is done using lavender essential oil for 15-20 minutes 2 x 1 day. Although the nursing problems are the same, the end result is different. After 3 days of intervention, there was a decrease in blood pressure in Mr D from 150/90 mmHg to 120/80 mmHg with a scale of pain from 4 to 0. While in Mr. S from 170/100 mmHg to 150/90 mmHg with a scale of pain from 5 to 1. Mr. D has decreased blood pressure more optimally than Mr. S because you do therapy regularly. Conclusion: of the study is that foot massage therapy using lavender essential oil can reduce the value of blood pressure and the scale of pain. This therapy is effective if done routinely and client can take advantage of health facilities.
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Putri, Isna Aryunita Putri; Achyar, Afifatul; Zulzusri, Zulzusri; Atifah, Yusni; Putri, Dwi Hilda; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i4.230

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Kontribusi Pupuk Organik Kotoran Sapi Terhadap Tinggi Tanaman Padi (Oryza sativa L.) Syahfitri, Aulia Insyani; Anhar, Azwir; Violita, Violita; Kardiman, Reki
Jurnal Serambi Biologi Vol. 9 No. 1 (2024): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v9i1.339

Abstract

Continuous use of inorganic fertilizers on rice plants has a negative impact on soil productivity and the environment so that plant growth is disrupted. Therefore, it can be used to reduce the impact of using inorganic fertilizers by using organic fertilizers. This research aims to determine the effect of the composition of organic cow dung fertilizer and inorganic fertilizer on the growth of rice plants which was carried out from July to November 2023 at the Plant Physiology and Wire House Laboratory, Department of Biology, Faculty of Mathematics and Natural Sciences, Padang State University. This research was structured using a Completely Randomized Design (CRD) consisting of 6 treatments and 4 replications. The treatment given consisted of A = 100% NPK Fertilizer + 0% Cow Manure, B = 80% NPK Fertilizer + 20% Cow Manure, C = 60% NPK Fertilizer + 40% Cow Manure, D = 40% NPK Fertilizer + 60% Cow Manure Fertilizer, E = 20% NPK Fertilizer + 80% Cow Manure Fertilizer, F = 0% NPK Fertilizer + 100% Cow Manure Fertilizer. The results showed that the influence of the composition of inorganic NPK fertilizer and organic cow dung fertilizer for rice plants had no significant effect on plant height at 15, 30, 45 and 60 HST.
Analisis Kualitas Butir Soal Ujian Tengah Semester (UTS) Ganjil Biologi Kelas XI SMAN 1 Pancung Soal Putri, Annisa Anike; Zulyuri, Zulyuri; Violita, Violita
Jurnal Metaedukasi: Jurnal Ilmiah Pendidikan Vol 4, No 2 (2022): Metaedukasi
Publisher : Universitas Siliwangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37058/metaedukasi.v4i2.4087

Abstract

Penelitian ini bertujuan untuk mengetahui kualitas butir soal UTS Ganjil Biologi Kelas XI SMAN 1 Pancung Soal. Metode penelitian yang digunakan adalah penelitian deskriptif kuantitatif. Adapun sampel dalam penelitian ini yaitu siswa Biologi kelas XI SMAN 1 Pancung Soal tahun ajaran 2021/2022 dengan jumlah 16 siswa. Teknik pengumpulan data yang digunakan berupa dokumentasi. Instrumen penelitian ini meliputi 25 soal pilihan ganda, kunci jawaban, dan lembar jawaban hasil pekerjaan siswa. Hasil penelitian dianalisis validitas, reliabilitas, tingkat kesukaran, daya pembeda, dan efektivitas pengecoh menggunakan bantuan software Anates 4.0.9. Hasil penelitian menunjukkan bahwa dari aspek validitasnya yaitu terdapat 1 (4%) butir soal dengan kategori tinggi, 4 (16%) butir soal dengan kategori cukup, 14 (56%) butir soal dengan kategori sangat rendah, 3 (12%) butir soal  dengan kategori rendah serta juga ada 3 (12%) butir soal yang tidak terbaca tingkat kevalidannya. Aspek reliabilitasnya yaitu memiliki kriteria sangat rendah dengan harga r statistik sebesar -2,88. Aspek tingkat kesukarannya yaitu tidak diperoleh butir soal dengan kriteria mudah, hanya kriteria sedang dengan jumlah 9 (36%) butir soal dan kriteria sukar dengan jumlah 16 (64%) butir soal. Aspek daya pembedanya yaitu terdapat 5 (20%) dengan kriteria sangat baik (diterima), 6 (24%) butir soal dengan kriteria sedang (diterima dan revisi), 8 (31%) butir soal dengan kriteria jelek (direvisi), dan 5 (24%) butir soal dengan kriteria sangat jelek (harus dibuang/diganti). Kemudian aspek kualitas pengecoh (distractor) yaitu dari 25 butir soal hanya terdapat 3 (12%) butir soal yang semua distraktornya berfungsi dengan baik dan 22 (88%) butir soal yang distraktornya ada yang berfungsi dan ada yang tidak berfungsi sama sekali. Hasil analisis ini mengindikasikan bahwa secara keseluruhan soal tes tersebut harus direvisi kembali sehingga dapat digunakan lagi dalam tes hasil belajar yang akan datang.
Analisis Kualitas Butir Soal Ujian Tengah Semester Mata Pelajaran Biologi Kelas X di MAN 1 Solok Selatan Alti, Rizka Putri; Zulyuri, Zulyuri; Violita, Violita
Jurnal Metaedukasi: Jurnal Ilmiah Pendidikan Vol 4, No 2 (2022): Metaedukasi
Publisher : Universitas Siliwangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.37058/metaedukasi.v4i2.4089

Abstract

Analisis butir soal adalah proses mengkaji kualitas soal pada setiap butirnya. Hal ini bertujuan untuk melihat apakah soal yang digunakan dalam tes penilaian terhadap peserta didik sudah dapat mengukur sesuai dengan tujuan pembelajaran di sekolah atau belum. Pada penilitian ini dilakukan analisis terhadap Soal Ujian Tengah Semester Mata Pelajaran Biologi Kelas X di MAN 1 Solok Selatan terhadap validitas, reliabilitas, daya pembeda dan tingkat kesukaran soal. Jenis penelitian ini adalah penelitian kuantitatif dengan pendekatan deskriptif. Subjek dalam penelitian sebanyak 30 orang peserta didik kelas X MAN 1 Solok Selatan pada semester ganjil tahun pelajaran 2021/2022. Teknik pengumpulan data yang digunakan yaitu melalui instrumen tes berupa soal-soal pilihan ganda ujian tengah semester sebanyak 25 butir soal, lembar jawaban peserta didik, dan kunci jawaban. Analisis data penelitian menggunakan Anates versi 4.0.9 yang dikembangkan oleh Drs. Karno, M.Pd dan Yusuf Wibisono, ST. Adapun hasil analisis kualitas butir soal dilihat dari tingkat validitas empiris diperoleh 5 soal dengan kategori signifikan, reliabilitas 0.37 (rendah), daya pembeda soal kategori dibuang (12%), jelek (28%), cukup (48%), baik (8%) dan baik sekali (4%), dari segi tingkat kesukaran soal sudah bervariasi, kategori Sangat Mudah (16%), Mudah (8%), Sedang (64%), Sukar (8%) dan Sangat Sukar (4%). Soal ujian tengah semester yang dikembangkan guru belum memenuhi kriteria alat evaluasi pembelajaran dan belum dapat digunakan untuk mengukur ketercapaian pembelajaran di sekolah karena tergolong belum baik.
The Effect of Gibberellin Hormone Concentration dan Soaking Duration on The Vigor Indeks of Black Glutinous Rice Seeds (Oryza sativa Linn Var. glutinousa) Expired Christy, Arifah; Noficandra, Habibullah; Violita, Violita
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24036/srmb.v8i3.243

Abstract

This study aims to determine the best concentration of gibberellin hormone and soaking duration for increasing the viability of expired black glutinous rice seeds. The study was conducted using a complete randomized design (RAL) with a two-factor treatment. The first factor related to variations in the concentration of gibberellin hormone is 0%, 1.5%, 2%, 2.5%, and 3%. The second factor is related to the length of soaking with variations of 12 hours, 24 hours, and 48 hours. Each treatment is carried out in 4 repetitions with parameters of vigor index. The results of this study showed that the treatment of varying concentrations of gibberellin hormone and variations in soaking time showed a significant effect on the control group (p <0.05) germination of expired black glutinous rice seeds Key words : Rice seeds, Expiration, Gibberellin hormone, Germination, Vigor Index
An Analysis of VIII Grade Students' Science Literacy Skills in Junior High School in PadangAnalysis of VIII Grade Students' Science Literacy Skills in Junior High School in Padang Devinda Devinda; Violita Violita
Literasi Bahasa dan Sastra Jurnal Vol. 1 No. 1 (2024): LIBAS Vol. 1 No.1 March 2024
Publisher : Yayasan Tri Edukasi Ilmiah

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.63462/xnz15r78

Abstract

Purpose of the research was to describe the result of VIII Grade Students' Science Literacy Skills analysis in Junior High School in Padang. It was a descriptive research. Samples were taken by using purposive sampling technique. Techniques of data collection used valid and reliable science literacy test and interview with students and teachers. Technique of data analysis was by calculating average score of students' science literacy test. To test data validity, it used triangulation technique. The finding shows that VIII grade students' science literacy skill in SMPN 1 Padang based on total score, basic competence and science competence has the highest average score with low category. Then, it is followed by VIII grade students' science literacy skill in SMPN Ar-risalah Padang and SMP Manjushri Padang with low category. In conclusion, VIII grade students' science literacy skill in Junior High School in Padang is in low category.
Co-Authors Abdul Razak Achyar, Afifatul Alti, Rizka Putri Annisa Khaira Atifah, Yusni Azwir Anhar Christy, Arifah Claudia Ayesha Des M Desmayanti, Resti Devinda Devinda Dezi Handayani Dwi Hilda Putri Elsa Yuniarti Elya, Mardoni Farma, Sisca Alicia Fevria, Resti Fietri, Winda Ayu Handayani, Nurhayati Dwi Ida Elfira Irni Furnawanthi Hindaningrum Kardiman, Reki Kartiman, Roni Linda Advinda Linda Novita Monica, Della Trya Moralita Chatri Noficandra, Habibullah Nofitria, Atika Sari Nurul Hasanah Oktaviani, Mutia Putri, Amaliani Putri, Annisa Anike Putri, Isna Aryunita Putri Putri, Lidya Eka Resmiari, Resmiati Rezi Nabilah Rijal Satria Rizka Meisy Evis Putri Safira Nurul Fadila Sakinah Azhari Selva Dena Nusima Subari, Ahmad Suciyatiningrum, Risma Syahfitri, Aulia Insyani Syaifullah, Annisa syauli mardita Tarigan, Siti Nadiah Zahra Br Tazri, Mufidah Insani Tomi Apra Santosa Vauzia Vauzia Vauzia, Vauzia Wulandari, Tesya Zuhratul Mardiyah Amir Amir Zulyuri, Zulyuri Zulyusri Zulyusri Zulyusri Zulzusri, Zulzusri