Claim Missing Document
Check
Articles

Found 19 Documents
Search

Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province Pandarangga, Putri; Ticoalu, Abigail E.; Gelolodo, Maria A. E. G. A; Toha, Larry R. W.
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.13118

Abstract

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.
Gambaran Hematologi Darah Pasca Vaksinasi Porcine Reproductive and Respiratory Syndrome (PRRS) pada Ternak Babi di Kabupaten Kupang Sole, Marsyella Gloria; Simarmata, Yohanes T. R. M. R.; Gelolodo, Maria Aega
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.15129

Abstract

The potential for expanding pig farming, particularly with native pigs, in East Nusa Tenggara (NTT) Province is significant due to the predominant non-Muslim population in NTT who utilise pigs in traditional and religious ceremonies. However, the high number of pigs in Kupang Regency and conventional farming practices can elevate the likelihood of infections like Porcine Reproductive and Respiratory Syndrome, known as PRRS. Porcine reproductive and respiratory syndrome (PRRS), caused by the PRRS virus (PRRSV), is a significant disease in the pig farming sector. The porcine reproductive and respiratory syndrome virus is highly contagious within pig herds. It can spread through direct contact or contaminated aerosols. Vaccines have been used to limit the disease’s transmission, despite often being considered ineffective. This study analyses the variations in blood haematological parameters before and after PRRS immunisation, including RBC, HGB, PCV, MCV, MCH, MCHC, and WBC. Fifteen pigs were included in the sample. Sampling was conducted two times from the same pigs: before PRRS vaccination and one month post-immunization. SPSS was used for the data analysis. A statistical study using SPSS showed no significant difference in blood hematology following the PRRS vaccination.
SOSIALISASI RABIES SEBAGAI UPAYA PENINGKATAN KESADARAN MASYARAKAT DI DESA KUALIN DAN DESA ONI, KECAMATAN KUALIN KABUPATEN TIMOR TENGAH SELATAN Deta, Herlina Umbu; Tangkonda, Elisabet; Gelolodo, Maria AEGA; Loe, Fhady Risckhy
Jurnal Pengabdian Masyarakat Peternakan Vol 8, No 2 (2023): Jurnal Pengabdian Masyarakat Peternakan
Publisher : Jurusan Peternakan Politeknik Pertanian Negeri Kupang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35726/jpmp.v8i2.7192

Abstract

Mayoritas masyarakat Nusa Tenggara Timur memelihara anjing sebagai hewan kesayangan di rumahnya masing-masing dan menjadi kebiasaan dibawa saat bertani di ladang, serta daging anjing masih menjadi salah satu menu makanan yang selalu ada disetiap acara keluarga maupun ritual adat masyarakat setempat.  Masuknya virus rabies di Pulau Timor, khususnya di Kabupaten Timor Tengah Selatan, menjadi perhatian semua kalangan masyarakat. Salah hal yang menjadi perhatian bersama yaitu masyarakat masih kurang informasi akan penyakit rabies dan upaya pencegahan yang dapat dilakukan. Oleh karena itu, kegiatan sosialisasi penyakit rabies menjadi salah satu sarana yang tepat untuk langsung bertemu dan melakukan tanya jawab dengan masyarakat yang ada di Desa Kualin, Kecamatan Kualin, Kabupaten Timor Tengah Selatan, dan juga dibagikan leaflet dan pamflet terkait informasi penyakit rabies. Diharapkan masyarakat dapat membagikan dan menyebarluaskan informasi kepada anggota keluarga lainnya. Hasil kegiatan menunjukkan adanya peningkatan pengetahuan masyarakat peternak setelah dilakukan edukasi mengenai pencegahan rabies pada anjing.
Edukasi Pendekatan One Health dalam Pencegahan Penyakit Zoonosis Rabies pada Sekolah Dasar di Kota Kupang Gelolodo, Maria Aega; Maxs U. E Sana; Elisabet Tangkonda; Larry R.W Toha; Novalino H. G Kallau
International Journal of Community Service Learning Vol. 8 No. 2 (2024): May
Publisher : Universitas Pendidikan Ganesha

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23887/ijcsl.v8i2.66385

Abstract

Rabies adalah penyakit zoonosis penting yang menyebabkan kematian setiap tahunnya terutama pada anak-anak. Penyakit fatal ini pada umumnya menyebakan kematian pada populasi rentan yang erat berhubungan dengan tingkat edukasi yang rendah dan kemiskinan yang tinggi. Oleh karena signifikasi penyakit ini bagi kesehatan masyarakat maka berbagai program telah dilakukan untuk mengeradikasi penyakit ini. Pendekatan One Health adalah pendekatan multisektoral yang sudah banyak diaplikasikan untuk mengatasi penyakit ini. Salah satu pendekatan One Health yang dilakukan adalah dengan adanya edukasi pada masyarakat khususnya anak-anak usia sekolah dasar. Kegiatan edukasi yang dilakukan di sekolah dasar di Kota Kupang ini menerapkan bentuk edukasi berupa penyuluhan dan diskusi interaktif. Dari kegiatan ini diketahui bahwa partisipan sudah mengetahui tentang rabies namun belum semuanya mengetahui bahaya rabies serta tindakan pencegahan yang dapat dilakukan untuk mencegah penyakit ini. Oleh sebab itulah kegiatan Komunikasi, Informasi dan Edukasi (KIE) tentang rabies harus rutin dilakukan untuk menjangkau berbagai golongan masyarakat. Dengan meningkatnya tingkat pengetahuan dan kesadaran masyarakat khususnya anak-anak tentang bahaya rabies maka diharapkan risiko gigitan anjing pada manusia dan penyebaran rabies di NTT dapat dikontrol.
Gambaran Hematologi 3 Bulan Pasca Vaksinisasi Porcine Reproductive and Respiratory Syndrome (PRRS) pada Ternak Babi di Kabupaten Kupang Simarmata, Yohanes T. R. M. R.; Gelolodo, Maria A.; Sitompul, Yeremia Y.; Sole, Marsyella G.
JURNAL KAJIAN VETERINER Vol 12 No 2 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i2.15132

Abstract

Pigs are the most commonly raised livestock in Kupang Regency, offering various advantages over other animals. However, the growing pig population poses a higher risk of diseases such PRRS, which affects both respiratory and reproductive health. Vaccination remains a crucial method for preventing PRRS. Post-vaccination haematological examinations are essential for assessing immune responses, utilizing parameters like leukocyte and lymphocyte counts to evaluate vaccine efficacy and safety. This study investigates haematological parameters as indicators of physiological responses to PRRS vaccination, a relatively less explored area compared to other immunological assessments. The research analysed haematological parameters such as RBC, HGB, PCV, MCV, MCH, MCHC, and WBC both before and three months after vaccination. Blood samples were collected from 15 pigs one day prior to and three months following vaccination. SPSS software was used to analyse the data. The results indicated that haematological parameters remained within normal ranges. RBC, HGB, PCV, and MCHC did not significantly differ, however MCH, MCV, and WBC levels did indicate statistically significant variations. These results support the safety and efficacy of PRRS immunization by indicating that it causes detectable haematological alterations. This study underscores the importance of using haematological parameters as reliable indicators for assessing vaccine pigs reaction.
IDENTIFIKASI DAN UJI RESISTENSI Pseudomonas sp. TERHADAP ANTIBIOTIK GENTAMISIN, KLORAMFENIKOL DAN SIPROFLOKSASIN PADA DAGING SAPI DI PASAR TRADISIONAL KOTA KUPANG Orolaleng, Katarina Keleka; Sanam, Maxs U. E; Gelolodo, Maria Aega
Partner Vol 29, No 2 (2024): Edisi November 2024
Publisher : Politeknik Pertanian Negeri Kupang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35726/jp.v29i2.7312

Abstract

ABSTRAKDaging sapi merupakan bahan pangan asal hewan yang mengandung banyak nutrisi penting bagi manusia. Kandungan nutrisi dan kadar air yang tinggi menjadikannya medium yang baik bagi pertumbuhan bakteri seperti Pseudomonas sp. Penelitian ini bertujuan untuk mengidentifikasi keberadaan Pseudomonas sp. dan status resistensinya terhadap antibiotik gentamisin, kloramfenikol dan siprofloksasin. Total 12 sampel daging sapi dari 3 pasar di Kota Kupang dikoleksi secara purposive sampling untuk selanjutnya dilakukan isolasi, identifikasi serta uji resistensi antibiotik. Hasil penelitian menemukan adanya bakteri Pseudomonas sp. dari sampel daging yang berasal dari ketiga pasar tersebut. Hasil uji resistensi antibiotik menunjukkan bahwa sebesar 16,66% bakteri Pseudomonas sp. bersifat sensitif terhadap antibiotik gentamisin, intermediet sebesar 83,3%, sebesar 33,33% sensitif terhadap antibiotik kloramfenikol dan intermediet sebesar 66,66%, sedangkan terhadap antibiotik siprofloksasin bersifat intermediet sebesar 100%. Hasil penelitian ini diharapkan dapat menjadi dasar penentuan kebijakan dalam tatalaksana penyediaan pangan yang memenuhi prinsip Aman, Sehat, Utuh dan Halal di wilayah Kota Kupang. Kata kunci: Daging sapi, Pseudomonas sp., antibiotik, resistensi, Kupang. ABSTRACTBeef is a food source that contains essential nutrients for humans. The high nutrient and water content provide a favorable environment for bacteria like Pseudomonas sp. This study purpose is to detect the existence of Pseudomonas sp. and determine its resistance to gentamicin, chloramphenicol, and ciprofloxacin. Purposive sampling used to collect 12 beef samples from three Kupang City marketplaces, which were then isolated, identified, and tested for antibiotic resistance. The study's results revealed the presence of Pseudomonas sp. bacteria in meat samples from these marketplaces. The antibiotic resistance test findings showed that 16.66% of Pseudomonas sp. bacteria were sensitive to gentamicin, 83.3% were intermediate, 33.33% were sensitive to chloramphenicol, 66.66% were intermediate, and 100% were intermediate to ciprofloxacin. The study's findings are projected to serve as the foundation for policy decisions about food supply management in the Kupang City area that adhere to the Safe, Healthy, Whole, and Halal standards. Keywords: Beef, Pseudomonas sp., antibiotics, resistance, Kupang.
Isolasi dan Identifikasi Bakteri Salmonella sp. pada Ayam Broiler Loe, Fhady Risckhy; Putra Nugroho, Mega Perkasa; Tangkonda, Elisabet; Gelolodo, Maria Aega; Sanam, Maxs Urias Ebenhaizar
Jurnal Veteriner dan Biomedis Vol. 3 No. 1 (2025): Maret
Publisher : Sekolah Kedokteran Hewan dan Biomedis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jvetbiomed.3.1.9-15.

Abstract

Salmonella sp. is one of the dangerous pathogens that causes salmonellosis in humans and animals. Salmonella sp. bacteria. usually inhabit the intestines of most animal species, but are also found in the environment. Salmonella sp. can survive for long periods of time, allowing bacteria to move from one place to another through equipment, including contaminated feed. This case report aims to determine the technique and interpretation of the results of each laboratory test in identifying Salmonella sp. Which is obtained through swabbing the chicken's cloaca. The testing stages include sampling, laboratory testing, and identification of test results. Sampling was carried out at the Naikoten I Inpres Market, Kupang City and laboratory testing was carried out at the Bacteriology Laboratory of the Veterinary Medicine Study Program, Nusa Cendana University. The isolation results found Salmonella sp. SSA media is black, because Salmonella produces hydrogen sulfide (H2S). The results of gram staining showed that the bacteria were in the form of cocobacillus and were gram negative. Biochemical testing of Salmonella sp. is negative in the Indol test, produces H2S, is non-motile, and catalase positive.
Studi Kasus: Identifikasi Kasus Penyakit pada Ayam Broiler di Pasar Naikoten, Kota Kupang Ola, Elisa Albertine Rahmita Deran; Gelolodo, Maria Aega
Jurnal Veteriner Nusantara Vol 8 No 1 (2025): Februari, 2025
Publisher : Program Studi Kedokteran Hewan, Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jvn.v8i1.22638

Abstract

Diverse diseases can impede the development of the poultry industry; therefore, it is essential to identify and analyze the causes of these diseases through thorough examinations. Laboratory examinations of parasites, viruses, and bacteria are essential for the diagnosis of diseases in poultry. This procedure allows an improved diagnosis, enabling appropriate treatment administration and the design of preventative strategies to mitigate disease transmission risk. A white broiler chicken with a body condition score of 3/5 that was purchased at Pasar Naikoten in Kota Kupang is the case animal. The chicken has exhibited illness for five days, presenting symptoms including footpad wounds and swelling, lethargy, reduced appetite, weight loss, dull plumage, limping, and occasional neck deformity. A series of virology and bacteriology laboratory tests confirmed a positive diagnosis of Bumblefoot caused by Staphylococcus aureus infection, with a differential diagnosis of Newcastle disease based on clinical symptoms. Therapy was not conducted as the case chicken had already been sold by the trader; therefore, only educational efforts for sellers concerning the risk factors for disease occurrence were implemented.
PROGRAM PELATIHAN INVESTIGASI PENYAKIT HEWAN MENULAR BAGI MAHASISWA PENDIDIKAN PROFESI DOKTER HEWAN DI KUPANG Gelolodo, Maria Aega; Simarmata, Yohanes Timbun Raja Mangiut Ronael; Kallau, Novalino Harold Geoffrey; Tabali, Zulkifli; Sitompul, Yeremia Yobelanno; Loe, Fhady Risckhy; Wuhan, Yustinus Oswin Primajuni
Jurnal Media Tropika Vol 5 No 1 (2025): Jurnal Media Tropika
Publisher : Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/mediatropika.v5i1.20572

Abstract

Infectious animal diseases, particularly zoonoses, pose a significant problem to the inhabitants of East Nusa Tenggara (NTT) Province because of the high animal population, especially livestock, and the close interaction between humans, animals, and the environment. The Faculty of Medicine and Veterinary Medicine, Universitas Nusa Cendana, Kupang, held the Animal Disease Investigation Training Program for Veterinary Professional Education Students (PPDH) to overcome this significant challenge. This one-day workshop had been attended by 80 participants, consisting of 26 men (32.5%) and 54 women (67.5%). This training aims to improve students' understanding and skills in zoonotic disease investigation through theoretical and practical approaches. Theoretical sessions were conducted by giving presentations to provide a foundation of knowledge. At the same time, interactive approaches in the form of group discussions and field practice were designed to improve the ability to analyze and handle cases in the field. The results of this training are expected to equip participants with the ability to investigate, identify risks, and implement disease prevention and control measures. The expected implication of this activity is to improve the ability of prospective veterinarians to face the challenges of animal diseases in NTT, especially in infectious disease detection. This training provides relevant theoretical and practical experience in protecting animal and public health in the region.