Claim Missing Document
Check
Articles

Found 18 Documents
Search

Peranan Pendekatan Molekular dalam Program Eradikasi Penyakit Mulut dan Kuku Maria Aega Gelolodo
JURNAL KAJIAN VETERINER Vol 5 No 1 (2017): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v5i1.1022

Abstract

Penyakit Mulut dan Kuku (PMK) adalah salah satu penyakit penting yang menginfeksi hewan sapi, kambing, domba dan babi serta beberapa jenis hewan liar. Penyakit ini penting secara ekonomi karena selain mengakibatkan angka mortalitas yang tinggi pada hewan muda, penurunan produksi susu maupun bahan asal hewan lainnya serta dapat mengakibatkan pembatasan perdagangan internasional bagi negara yang terinfeksi PMK. Selain dampak langsung dari penurunan produksi peternkan dan pembatasan perdagangan internasional, wabah PMK juga memberikan dampak yang serius bagi aspek sosial ekonomi dan industri pariwisata. Sampai saat ini, penyakit ini menyebar luas di Amerika selatan, Asia dan Africa. Mengingat arti pentingnya penyakit ini dan dampaknya secara global, maka penting untuk menyusun langkah strategis pencegahan dan eradikasi penyakit ini. Tulisan ini akan membahas beberapa langkah strategis penting yang dapat dimplementasikan dalam program eradikasi PMK khususnya melalui kegiatan-kegiatan yang berbasis teknologi molecular mulai dari penyiapan vaksin, tes diagnostic sampai kegiatan monitoring status penyakit.
UPAYA PENGUATAN KESEHATAN MASYARAKAT: EDUKASI TENTANG PENYAKIT KAKI GAJAH (FILARIASIS LIMFATIK) DI SMA NEGERI 1 AMANUBAN TENGAH, KABUPATEN TIMOR TENGAH SELATAN Maria Aega Gelolodo; Julianty Almet; Annytha I. R. Detha
Jurnal Media Tropika Vol 1 No 1 (2021): Jurnal Media Tropika
Publisher : Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/mediatropika.v1i1.3943

Abstract

Lymphatic Filariasis (LF) or known as elephantiasis is one of the most debilitating neglected tropical diseases. This parasitic disease is a leading cause of permanent disability worldwide and has affected over 120 million people in 83 countries throughout the tropics and sub-tropics areas. In Indonesia, the LF endemic in 28 provinces with the highest prevalent rate comes from the eastern part of Indonesia, especially East Nusa Tenggara that stood at first place in terms of total cases. A total of 23 regencies in East Nusa Tenggara are known as LF endemic areas. Though a prevention program has been implemented, there is still a lack of knowledge and awareness about LF in the community especially the rural community. Moreover, a misconception about the importance of the Mass Drug Administration (MDA) has jeopardized these communities. Poverty and health illiteracy are suspected as the major causes of lack of awareness. The aim of this one health program was to raising community awareness towards LF through school-based health education. This paper discusses the community outreach program conducted in SMAN 1 Amanuban Tengah. Serial presentations about the disease, the social stigma, its prevention, control, and medication programs had been applied in this program. Raising awareness about the disease, the importance of its prevention, control, and medication programs, and breaking the negative assumptions about the disease were several prominent results from the program.
Uji potensi ekstrak etanol daun nimba (Azadiractha indica) sebagai bahan pengawet pada ikan tongkol (Auxis thazard) Ade Lestrari Rambu Leba; Nemay A. Ndaong; Maria AEGA Gelolodo
Jurnal Veteriner Nusantara Vol 2 No 1 (2019)
Publisher : Program Studi Kedokteran Hewan, Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jvn.v2i1.1093

Abstract

This study aimed to the capability of the ethanol leaf extract obtained from neem (Azadiractha indica) as preservatives for frigate mackerel (Auxis thazard). Analysis was carried out by looking at the storability of the fish with two parameters, which are pH and total plate count (TPC). The samples were treated with different treatments by using different extract concentrations. This study was an experimental laboratory research using completely randomized design method with three replications of factorial 5x4. There were 5 treatments, 10% formalin (positive control), ice (negative control), 5% concentration of ethanol extract of neem leaves (K1), 10% concentration of ethanol extract of neem leaves (K2), 15% concentration of ethanol extract of neem leaves (K3). The mackerel were soaked for two hours, then stored at room temperature. The measurement of pH and TPC were done at 0 hour, 2 hours, 7 hours, and 12 hours. The result of this study showed that pH and TPC values gradually increased along with the length of time of observation. The ethanol leaf extract of neem (Azadiractha indica) as preservatives on the mackerel had storability for 2-7 hours. It can be concluded that the higher concentration of ethanol leaf extract of neem, the higher inhibitory effect on bacterial growth will be.
Isolasi dan identifikasi terhadap bakteri penyebab mastitis pada sapi perah di Desa Benlutu Kecamatan Batu Putih Kabupaten Timor Tengah Selatan Kurnia Riwu Manu; Elisabet Tangkonda; Maria Aega Gelolodo
Jurnal Veteriner Nusantara Vol 2 No 2 (2019): Agustus 2019
Publisher : Program Studi Kedokteran Hewan, Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jvn.v2i2.1809

Abstract

Mastitis is the main problem in the dairy farm because it can lead to decline in the production of milk in the large amount. Mastitis caused by various types of microbes pathogen entering the nipple. The treatment completely difficult to implement and requires great expense so precautions can be done one is doing the early detection of mastitis. The research aim to detect mastitis subklinis in of dairy cows were maintained in the village Benlutu Kecamatan Batu Putih Kabupaten Timor Tengah Selatan and to identification bacteria cause mastitis subklinis. Sample used is milk of livestock dairy cattle as much as 12 samples of milk taken with aseptic. Furthermore do mastitis test using reagen IPB-1, from 12 sample all testes positive result mastitis subklinis. Furthemore identification bacteria cause mastitis based on the characteristic of bacteria, staining of Gram, biochemistry test, katalase test and koagulase test. From this research is known that the infection bacteria that cause mastitis subklinis Staphylococcus aureus 91,6 % (11/12) and Staphylococcus epidermidis 25 % (03/12).
EVALUASI EFEKTIFITAS VAKSINASI RABIES PRIMER PADA ANJING DI KECAMATAN MAGEPANDA KABUPATEN SIKKA Yoseph Klaudius; Maria A.W. Gelolodo; Aji Winarso
Jurnal Veteriner Nusantara Vol 3 No 1 (2020): Februari 2020
Publisher : Program Studi Kedokteran Hewan, Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jvn.v3i1.3219

Abstract

Rabies has been a serious public health threat in Flores Island, Indonesia since it was introduced by Buton Island fisherman in 1997. The first case of canine rabies was officially confirmed in 1998 in Tanjung Bunga, East Flores regency. The virus spread to other regencies in the island, including Sikka regency. To control the disease, a routine vaccination program has been applied since 2000, however, this program has not yet been successful in eliminating canine rabies from Flores. The aim of this study is to evaluate the effectiveness of canine rabies vaccination in Magepanda, Sikka. Total 32 dog’s serum samples with age range around 6-12 months were collected in the 14th day post rabies vaccination. Then, those serum samples were examined using ELISA test to measure its antibody titer. The test showed that 78,125% of the samples presented protective antibody titers. Chi-square analysis results show that, no significant relationship between age and the dog with the results of the rabies antibody titer (ELISA) in District Magepanda Sikka, it is probably caused by the uneven distribution of the dog's life.
REVIEW: RABIES VIRUS (RABV) DAN PATOGENESISNYA Maria Aega Gelolodo; Elisabet Tangkonda; Diana A. Wuri; Maxs U. E. Sanam
Partner Vol 28, No 2 (2023): Edisi November 2023
Publisher : Politeknik Pertanian Negeri Kupang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35726/jp.v28i2.7104

Abstract

Rabies, caused by the rabies virus, is a zoonotic infection with a potentially deadly consequence. Both humans and animals are susceptible to this neurotropic virus. The rabies virus is typically present in infected animals' saliva and cerebral tissue, primarily canines, and transmits via bite wounds. Dogs are responsible for most human rabies transmissions, accounting for up to 99% of cases and consequently serving as the predominant contributor to human rabies mortality. This global threat kills approximately 59,000 people a year, with a death rate of nearly 100% in humans and animals. Fever, vomiting, anorexia, and lethargy are some of the non-specific early signs of rabies. Within days, symptoms escalate to deviant behaviour, brain dysfunction, paralysis, convulsions, hypersalivation, respiratory distress, and impaired swallowing. According to its immunological response, it proves that RABV can evade the initial immune defence. Hence, investigating the pathogenesis of RABV infection presents an intriguing study area. Key Words: Rabies, rabies virus, RABV, canine rabies, dog, pathogenesis, immunopathogenesis
PENYULUHAN KESEHATAN HEWAN DI DESA CAMPLONG II, KECAMATAN FATULEU, KABUPATEN KUPANG, PROVINSI NUSA TENGGARA TIMUR Tangkonda, Elisabet; Kallau, Novalino Harold Geoffrey; Gelolodo, Maria Aega; Loe, Fhady Risckhy; Jampur, Sesarius Wahyu Pagung
Jurnal Media Tropika Vol 3 No 2 (2023): Jurnal Media Tropika
Publisher : Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/mediatropika.v3i2.13274

Abstract

The outbreak of Foot and Mouth Disease (FMD) and African Swine Fever (ASF) in Indonesia needs to be counteracted by providing education and increasing awareness to the farming community about the importance of animal health and its impact on the economy and human health. Apart from that, the public also needs to be educated about the transmission and prevention of FMD, which is still free in NTT, and ASF disease, which is currently being eradicated. Members of the Telekomunit Farmers Group, the Sanam Tuan Farmers Group, the Sabu Bani Farmers Group, and the Setetes Madu Farmers Group in Camplong II Village, Fatuleu District, Kupang Regency, Nusa Province East Southeast are being helped through communication and education as part of this service activity. The goal is to make them more aware of the threat of PMK and ASF. In this activity, the community was also educated about rabies, which has become an epidemic in TTS, one of the areas on the island of Timor, and has been designated as an extraordinary rabies event.
PEMBERDAYAAN KELOMPOK TANI TERNAK FATUKOA I DI KELURAHAN FATUKOA DENGAN PEMANFAATAN FERMENTASI BATANG POHON PISANG SEBAGAI PAKAN HEWAN Tangkonda, Elisabet; Maha, Inggrid Trinidad; Gaina, Cynthia Dewi; Deta, Herlina Umbu; Wea, Redempta; Ngasi, Bernadete Dwiyuni; Puspita, Anggi; Joesoef, Jayusman Arsiyanti; Selan, Yulfia Nelymalik; Widi, Antin Yeftanti Anggraeni; Gelolodo, Maria Aega
Jurnal Media Tropika Vol 4 No 1 (2024): Jurnal Media Tropika
Publisher : Universitas Nusa Cendana

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/mediatropika.v4i1.17075

Abstract

Tinjauan Vibrio Vulnificus sebagai Ancaman Emerging Foodborne Disease pada Makanan Laut Segar Sanam, Maxs U. E.; Gelolodo, Maria Aega; Tangkonda, Elisabet; Loe, Fhady R.
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.12259

Abstract

Vibrio vulnificus is a crucial foodborne opportunistic pathogen that can cause wound infections, septicemia, and gastroenteritis with a 50% fatality rate. This bacteria occurs in estuaries and coastal waters and is found in large quantities in oysters and other mollusc shells. The increasing number of foodborne diseases worldwide is suspected to have occurred due to the expansion of the international food trade. Consumption of raw seafood, especially oysters containing Vibrio vulnificus bacteria, can result in acute, severe systemic infections and is responsible for 95% of deaths from seafood consumption in the United States. The diagnosis of Vibrio vulnificus infection is confirmed by the growth of the bacteria in culture media from wounds, feces or blood. This article discusses the characteristics of the bacteria, host, environment, transmission, pathogenesis, clinical symptoms, diagnostic techniques and geographical distribution of V. vulnificus.
Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province Pandarangga, Putri; Ticoalu, Abigail E.; Gelolodo, Maria A. E. G. A; Toha, Larry R. W.
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.13118

Abstract

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.