cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Widodo
Contact Email
nst.journal.editor@gmail.com
Phone
+6282132116373
Journal Mail Official
nst.journal.editor@gmail.com
Editorial Address
Jalan Akasia Permai A.10, Malang, Jawa Timur, Indonesia
Location
Kab. malang,
Jawa timur
INDONESIA
Nusantara Science and Technology Proceedings
Published by Future Science
ISSN : -     EISSN : 26229692     DOI : -
Core Subject : Economy, Health, Science, Agriculture, Social, Engineering,
Agriculture, Biological Sciences & Forestry Chemical Engineering, Chemistry & Bioengineering Economics, Econometrics & Finance Engineering Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Medicine & Pharmacology
NST Proceeding supports regional research communities to globalise their findings in Science and Technology by providing an open access, online platform in line with international publishing standards and indexing scholarly conference proceedings. The current emphasis of the NST Proceeding includes (but is not limited to) the following areas: Life Science, Mathematics, Eductation, Social Science, Medicinal Science and etc. All conference papers published on the NST Proceeding are fully Open Access. Open Access publications are freely and permanently available online to any reader, anywhere in the world without subscription to the publications in which these articles are published. Unrestricted use, distribution, and reproduction in any medium are permitted, provided the author/editor is properly attributed. NST Proceeding will provide high-quality peer review by scientific comittee and proofreading service by native speaker to make sure the language quality. We are the best in rapid publication processes for the open access content, maximum visibility and all-time availability for the published articles, citation tracking and indexing in a variety of databases.
Arjuna Subject : Ilmu Ekonomi, Ekonometrika dan Keuangan (semua kategori) - Ilmu Ekonomi, Ekonometrika dan Keuangan (Lain-Lain)
Articles 1,542 Documents
 51   52   53   54   55 
Effect of Gamma Radiation on Genetic Diversity Shallots (Allium ascalonicum L.) M4 Bauji Variety For Varieties Improvement Irfan Satria Anpama; Ida Retno Moeljani; Juli Santoso
Nusantara Science and Technology Proceedings Seminar Nasional Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur 2021
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2012

Abstract

Shallots (Allium ascalonicum L.) is a horticultural commodity that has high economic value in Indonesia. Efforts to increase the productivity and quality of shallots will continue to be carried out through plant breeding programs. One of the efforts is through mutation breeding with the aim of improving the Bauji variety so that it has high yields, good quality and is resistant to major pests and diseases. One of the factors that play a role in increasing shallot production is superior varieties. For the assembly of superior varieties, it is necessary to expand genetic diversity, one of which can be done by radiation mutation. With radiation mutations, new genetic diversity is created so that it provides more opportunities for selection. This research was carried out using the single plant method and using the T-test, with the yield of shallots with radiation doses without radiation doses or 0 Gy, 1 Gy, 2 Gy, 3 Gy, 4 Gy, 5 Gy, 6 Gy. Observation parameters included plant length, number of leaves, number of tillers, tuber diameter, and tuber weight. This study aims to obtain the value of genetic diversity and heritability on the agronomic characters of shallots of bauji variety with 60Co gamma-ray radiation treatment. Gamma-ray irradiation of 60Co affects the growth and yield characteristics of the fourth generation Bauji variety of shallots. Irradiation treatment with a dose of 4 Gy (B4) had better results on the parameters of plant length, number of leaves, tuber diameter, and number of tillers than control plants or without irradiation.
Pest and Disease Control in Cavendish Banana Seedlings Resulting from Tissue Culture Indah Sari Dwi Agustin; Penta Suryaminarsih; Putranto Sasikirono; Yenny Wuryandari
Nusantara Science and Technology Proceedings Seminar Nasional Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur 2021
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2013

Abstract

Cavendis banana cultivation can use tissue culture as one of the developments of cultivation in the era of disruption. However, the results of tissue culture are very susceptible to attack by nuisance organisms during acclimatization to plant culture. The control carried out against the attack of plant-disturbing organisms in addition to using fungicides and insecticides, also applies preventive control. The purpose of this study was to determine an effective and smart way to control pests and diseases in tissue cultured Cavendish banana seedlings. Preventive control of pests and diseases using the method of thinning the seeds and soaking the seeds with fungicides. Data analysis was carried out using descriptive and parametric data. This study was conducted using a completely randomized design (CRD) with four control treatments. Each treatment was repeated 4 times. The control treatments carried out consist of: Control (A), preventive control (B), chemical control (C), and a combination of preventive and chemical control (D). The results of the control carried out showed that the combination of preventive and chemical control treatments gave significant results in inhibiting the attack of pests and diseases of Cavendish banana seedlings from tissue culture.
The Effect of Paitan (Tithonia diversifolia) dose on Growth and Yield of Potato (Solanum tuberosum L.) Granola Purple Flowered Variety F. Deru Dewanti; Yonny Koentjoro; Sugiarto; Puji Lestari Tarigan
Nusantara Science and Technology Proceedings Seminar Nasional Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur 2021
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2014

Abstract

Potato farming in Jawa Timur currently tends to be oriented towards high production. Increasing the yield of potato quality is by controlling fertilizers and the population. The use of paitan as an organic fertilizer to replace an organic fertilizer is easy and efficient. This study aims to determine the effect of organic fertilizer application on the yield of Granola potatoes (Solanum tuberosum L.). Treatment using a dose of paitan (D) consisted of: D0 = Control (without fertilization), D1 = 120 kg N ha-1 equivalent to 5882 t ha-1 fresh paitan, D2 = 175 kg N ha-1 equivalent to 8,578 t ha-1 fresh paitan, D3 = 230 kg N ha-1 equivalent to 11,273 t ha-1 fresh paitan, D4 = 175 kg N ha-1 equivalent to Urea 380 kg ha-1, P2O 149.76 kg ha-1, K2O 100 kg ha-1. The treatment is given once a week before planting. Parameters observed were plant height and the number of tubers. The results of the study showed that paitan organic fertilizer equivalent to 380 kg N ha-1 was able to produce plant growth and yields that were no different when compared to inorganic fertilizers. In addition, the use of organic fertilizers can preserve the environment for long-term agricultural activities.
In Silico Analysis of Sox2 Gene for Pluripotency Detection at Mouse Embryonic Fibroblast and induced Pluripotent Stem Cell (iPSC) Aroem Naroeni; Seprianto; Kevin Febrianus Moda
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2101

Abstract

Stem cells are cells that have not been specialized and have a specific characteristic compared to other cells. There are several transcription factors like Sox2, Oct4, c-Myc, and Nanog to maintain embryonic stem cells. In pluripotent stem cells, sex-determining region Y-box 2 (Sox2) is a critical transcriptional regulator, and for somatic cell reprogramming, which involves returning differentiated cells to a pluripotent embryonic state by reversing their epigenetic arrangement. This study aimed to design primers for detecting the Sox2 gene expressed in Mouse Embryonic Fibroblasts and induced Pluripotency Stem Cell as pluripotency detection in stem cell research. In silico analysis was carried out to detect ofx2gene by using several software such as BLAST to search sequence Sox2 gene from Homo sapiens and Mus musculus, Bioedit for sequence alignment, SnapGene for PCR in silico, and PrimerBlast for online primer design. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer (5'- CTACAGCATGTCCTACTCGCA -3') and reverse primer (5'- ACTTGACCACAGAGCCCA -3') were selected primers for M. musculus. Also, forward primer (5’-CTACAGCATGTCCTACTCGCA-3') and reverse primer (5'- ACTT-GACCACCGAACCCA-3') for Homo sapiens. Detection by PCR in silico using templates from H. sapiens and M. musculus sequences showed that the primers could specifically amplify the Sox2 gene in each species. Nevertheless, laboratory experiments need to be carried out for preliminary validation that has been designed. These primers will be used to measure the gene expression of Sox2 in qRT-PCR to detect the stemness characteristic of stem cells.
Effect Soursop (Annona muricata L.) Leaf Aqueous Extract (SLAE) on Remodeling of Ventricle Heart Tissue in Obesity Rats Model Hafidh Nur Haq; Aris Rosidah; Dini Sri Damayanti
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2102

Abstract

A high-fat and high-fructose diet can lead to obesity which contributes to an increased risk of heart failure complications. Soursop leaves are known to have the potential of antioxidant, but research about the effects of soursop leaf on complications of heart failure has never been studied. This study evaluated whether soursop leaf aqueous extract can inhibit the total of cardiomyocyte necrosis, cardiomyocyte diameter, and density of cardiac collagen in obese rats. The heart organs of obese rats that have been paraffin, which randomly divided into normal group, obesity group, and soursop leaf aqueous extract (SLAE) group with dose I (100 mg/kgbw), II (200 mg/kgbw), and III (400 mg/kgbw) (n=6 rats). The rats were induced by high-fat high-fructose and SLI diets for 10 weeks. The number of necrosis and diameter cardiomyocytes were measured by using Hematoxylin Eosin staining, while the density of cardiac collagen was measured by Masson's Trichrome staining and then observed with a trinocular and dot side microscope at 200x and 400x magnification. Statistical analysis using One Way ANOVA and continued by LSD test. We found that group SLAE with doses I, II, and III significantly reduced the number of cardiomyocyte necrosis and cardiac collagen density compared to the obesity group. The SLI group with doses II and III significantly reduced the diameter of cardiomyocytes compared to the obesity group, while the SLAE group with the dose I was unable to reduce the diameter of cardiomyocytes. In conclusion, Soursop leaf aqueous extract can inhibit the increase of cardiac collagen density, number necrosis and diameter cardiomyocyte.
Compounds Profile of Polar Subfraction of Ethyl Acetate Fraction of Soft Coral Nepthea sp., Antioxidant and Cytotoxic Properties Baru Sadarun; Adryan Fristiohady; Nur Syifa Rahmatika; Agung Wibawa Mahatva Yodha; Muhammad Hajrul Malaka; Andini Sundowo; I. Sahidin
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2103

Abstract

Nepthea sp., a soft coral In Indonesia's South-East Sulawesi, it thrives. The chemical and pharmacological properties of this genus have not been studied in this location. As a result, the goal of this page is to offer a broad overview of both properties of Nepthea sp. The sample was taken from Hoga Island. Methanol was used to extract the material, which was then fractionated with hexane and ethyl acetate to produce n-hexane, ethyl acetate, and methanol fractions. Vacuum liquid chromatography was also used to fractionate the ethyl acetate fraction. Phytochemical screening, LC-MS/MS, Total Phenolics Content (TPC), and Total Flavonoids Content (TFC) were used to determine the chemical contents. DPPH radicals and ABTS were used to assess antioxidant activity and MTT assays for cytotoxicity. Six subfractions are produced by fractioning the ethyl acetate fraction (160 g), with the most polar subfraction (F) weighing 15.4 g. The phenolics and flavonoids constituents in Subfraction F have IC50 values of 68.77±4.8 mg GAE/g extract and 0.22±0.1 mgQE/g extract, respectively. The presence of phenolics, flavonoids, and alkaloids in the subfraction F is supported by the LC-MS/MS data, Subfraction F has 3-ter-butyl-4-methoxyphenol (terpenoids or phenolics compound), isosalsoline (alkaloids), valine (amin acid), and several unidentified chemicals with molecular formulas C15H23NO3, C33H47NO4, C29H49NO3 (alkaloids or amino acid) and C8H18O3 (phenolic compound).The IC50 values (mg/L) of 101.1 ± 8.8 (DPPH) and 89.76 ± 7.5 (ABTS) indicate that F has antioxidant capacity, and it is also cytotoxic against breast cancer cell lines (MCF-7) with an IC50 of 170.72±6.5mg/mL.
Utilization of Waste Frying Oil as A Source of Carbon in The Production of Biosurfactant using Exiguobacterium profundum Irma Mardiah; Kartika Puspitaningrum; Syarif Hamdani; Nur Asni Setiani
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2104

Abstract

Biosurfactant is a secondary metabolite produced by microorganisms that can be used as an alternative to environmentally friendly surfactants. Exiguobacterium profundum is one of the biosurfactants producers that potentially to be used in the pharmaceutical field. The use of waste frying oil as a carbon source can be used as a solution in overcoming the high cost of producing biosurfactants. The purpose of this study was to obtain optimum conditions in the production of biosurfactants by utilizing waste frying oil as a carbon source. In this study, variations in the optimized production conditions included the concentration of waste frying oil, labeled 2%, 3%, 4%, and 5%, and the medium pH at 6, 7, and 8. The study was using Mineral Salt Medium as production medium, the amount of inoculum concentration was 10% v/v, agitation speed 160 rpm, and incubation at room temperature. The optimum conditions for biosurfactant production were determined based on the best emulsification index. The biosurfactant extraction was carried out using a combination of chloroform and methanol (2:1) solvents. The best concentrations of waste frying oil for Exiguobacterium profundum was 5%, and the best medium pH was 7. Biosurfactants produced from Exiguobacterium profundum amounted to 8,2 g/L with an emulsification index 63,2%.
Processing of Red Dahlia Tubers in Produce Inulin Extract and Material Proximate Testing Sunarti Sunarti; Chrismis Novalinda Ginting; Sahna Ferdinand Ginting
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2105

Abstract

Dahlia tubers from Berastagi, North Sumatra, are plants that contain carbohydrates and contain high levels of inulin. Inulin is very good as a dietary fiber and has other physiological functions such as lowering blood sugar and blood fat, anticancer, regulating intestinal microbial flora, increasing absorption of minerals and vitamins. Currently, the utilization of dahlia tubers is not optimal in the community and is considered as agricultural waste, therefore it is necessary to manage dahlia tubers in producing inulin extract and study the proximate material, considering that previous studies still obtained varying results. This study aimed to obtain inulin extract and its yield value and to measure the proximate material of red dahlia tuber. The extraction method used is based on the solubility of inulin in water at a temperature of 800 C. And precipitation are carried out with 70% ethanol. Proximate examination of the material consisted of water content using the heating method, ash content using the gravimetric method, fat and crude fiber content using the Soxhlet method, determination of protein content using the Macro Kjedhal method, and carbohydrate content using the proximate method using the carbohydrate percentage formula. The results obtained were 48,25% Inulin Flour yield, the proximate results obtained 80,8% water content, 0,36% ash content, 0,33% total fat content, 1,29% crude fiber content, protein content 1,15%, Carbohydrate content 14.6%. From this study, it can be concluded that dahlia tubers contain high carbohydrates and low-fat content, have crude fiber and protein that can be used as low-calorie foodstuffs.
Typhonium flagelliforme as a Cancer Prevention Plant-Based on In Vitro, In Vivo and Bioinformatics Research Method: A Systematic Literature Review Teddy Siswanto; Ratna Shofiati; Ismi Hasnatul Afifah
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2106

Abstract

The development of cancer-preventing plant research develops along with the development of science and information technology. The purpose of this study was to collect research related to the Typhonium flagelliforme plant so that it can be used to add to the research literature that synergizes with multi-scientific disciplines. This research method uses a Study Literature Review from the journals Proquest, ScienceDirect, NCBI, and other journals since 2012 with the keywords Typhonium flagelliforme or Rodent Tuber or Keladi-tikus to identify the type of research In Vitro, In Vivo and Bioinformatics and search by journal publisher category. The results of the Systematic Literature Review research obtained a total of 194 papers and after being traced from the abstract, then 51 papers were selected consisting of 42 In Vitro research papers, 1 In Vivo paper and 6 Bioinformatics papers, and a combination of In Vitro and In Vivo papers totaling 2 papers. Meanwhile, based on scientific fields the most are from Natural Science, Medicine, Bioinformatics, and Pharmacy. Based on the results of research identification, further research is proposed for Typhonium flagelliforme as a plant that has the potential to prevent cancer, can involve researchers from different scientific families so that it is suitable for multi-disciplinary research by synergizing the three methods of In Vitro, In Vivo and Bioinformatics through the involvement of researchers from Biology, Chemistry, Medicine, Pharmacy and Informatics to get further research depth.
Indonesian Economic Recovery after COVID-19 Pandemic: Qur'anic Paradigm in Community Economic Development M. Fauzan Zenrif; M. Lutfi Mustofa
Nusantara Science and Technology Proceedings Federation of Islamic Medical Associations
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2201

Abstract

My academic concern is that so far, some studies tend to look at economic recovery, during the COVID-19 period, focusing on planning, economic and social, economic and health, economic and political, economic and distribution, economic and monetary transmission. No researcher focused on the problems: how is the performance of the individual approach used by the government in solving economic problems? What constraints are experienced in problem-solving? and how is the community approach of the Quran as a solution to the economic recovery model? By using participatory action qualitative research and content analysis of the Quranic text, the result shows that community-based, using the qur’anic paradigm, can be a monetary recovery system based on religious, social spirit. This, at the same time, confirms the significance of the community-based development approach, combined with the values of the Qur'an, in solving community economic problems, due to the COVID-19 pandemic. The findings of the study term the pattern of economic recovery with the community approach have advantages, compared to the individual approach used by the government. The study also finds that the community's policy in economic recovery opens up more opportunities for the financial independence of the community. By using the community Passing-Loos Management System (CP-LMS), the concept of the Qur'an charity values, as the basis of the religious majority of Indonesian society, the community-based approach can be the foundation of Pancasila's economic development. Thus, the results of this study indicate that the pattern of integration, between the values of the Qur'an and the Pancasila economic system, as the SDGs authorized, can present an independent community economic system.

Page 53 of 155 | Total Record : 1542

 51   52   53   54   55 

Filter by Year

2020 2025


Reset
Filter By Issues
All Issue The 1st International Conference of Health Institut Kesehatan Mitra Bunda 2024 The 14th Annual International Symposium of Foreign Language Learning 5th International Conference Eco-Innovation in Science, Engineering, and Technology The 4th International Conference on Community Medicine and Medical Sciences The 1st International Conference Muhammadiyah Yogyakarta – Hospital & Healthcare Management Multi-Conference Proceeding Series F 8th International Seminar of Research Month 2023 The 4th International Conference on Agriculture and Environmental Sciences (ICAES) 2023 Seminar Nasional Agroteknologi 2023 4th International Conference Eco-Innovation in Science, Engineering, and Technology 1st International Conference on Health and Medicine Multi-Conference Proceeding Series D Multi-Conference Proceeding Series E 7st International Seminar of Research Month 2022 4th International Conference on Vocational Innovation and Applied Science 2022 4th Riau Medical Scientific and Expo 2022 2nd Basic and Applied Science Conference (BASC) 2022 Seminar Nasional Magister Agroteknologi 2022 Seminar Nasional Agroteknologi 2022 International Relations on Indonesian Foreign Policy Conference 2022 3rd International Conference Eco-Innovation in Science, Engineering, and Technology Multi-Conference Proceeding Series C 4th Economics, Business, and Government Challenges 2021 The 3rd International Conference on Vocational Innovation and Applied Sciences (ICVIAS) 2021 Join Proceeding "Basic and Applied Science Conference (BASC) 2021 & 1st Education Research and Appli Seminar Nasional Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur 2021 International Seminar of Research Month 2021 International Conference of Social Research with Multidisiplinary Approach (ICSRMA) 2021 Sains dan Teknologi Pertanian Modern 5th International Seminar of Research Month 2020 3rd Economics, Business, and Government Challenges 2020 1st ICEMAC 2020: International Conference on Economics, Management, and Accounting 4th International Seminar of Research Month 2nd International Conference Eco-Innovation in Science, Engineering, and Technology 2nd Bioinformatics and Biodiversity Conference 1st International Conference Eco-Innovation in Science, Engineering, and Technology International Conference on Life Sciences and Biotechnology (ICOLIB) Multi-Conference Proceeding Series A Seminar Nasional Magister Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur Federation of Islamic Medical Associations International Seminar of Research Month Science and Technology for People Empowerment. Internationale Konferenz des Indonesischen Germanistenverbandes (iKoniG) Bioinformatics and Biodiversity Conferences (BBC) International Seminar of Research Month Science and Technology in Publication, Implementation and Co Multi-Conference Proceeding Series B International Conference on Global Resource Conservation (ICGRC) More Issue