cover
Contact Name
Brigitta Laksmi Paramita
Contact Email
brigitta.laksmi@uajy.ac.id
Phone
+6282329549978
Journal Mail Official
journal.biota@gmail.com
Editorial Address
Fakultas Teknobiologi, Universitas Atma Jaya Yogyakarta, Jalan Babarsari No. 44, Sleman, Yogyakarta 55281, Indonesia
Location
Kota yogyakarta,
Daerah istimewa yogyakarta
INDONESIA
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati
ISSN : 25273221     EISSN : 2527323X     DOI : doi.org/10.24002/biota
Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati merupakan jurnal ilmiah yang memuat hasil-hasil penelitian, kajian-kajian pustaka dan berita-berita terbaru tentang ilmu dan teknologi kehayatian (biologi, bioteknologi dan bidang ilmu yang terkait). Biota terbit pertama kali bulan Juli 1995 dengan ISSN 0853-8670. Biota terbit tiga nomor dalam satu tahun (Februari, Juni, dan Oktober).
Articles 1,193 Documents
Uji Patogenisitas Isolat Bakteri Indigenous (Bacillus thuringiensis) terhadap Serangga Hama Kubis (Crocidolomia binotalis Zell) Christina L. Salaki; Jesmandt Situmorang; Langkah Sembiring; Niken Handayani
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 14, No 3 (2009): October 2009
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v14i3.2582

Abstract

Pathogenicity of 34 indigenous B. thuringiensis isolates against C. binotalis were determined. The pathogenicity test was conducted by using leaf dipped method with various spore concentrations. Third instar larvae of C. binotalis were used as insect test. Mortality data of test larvae were used to determine the pathogenicity of the isolates in terms of 72 hours LC50 by using probit analysis. The results of experiments showed YPPA 1. was the most pathogenic isolate, producing 72 hours LC50 = 9.5 x 103 spore.ml-1 with LT50 (1.5 x 107 spore.ml-1) of 24.6 hours while the ACH 2.3 was found to be the least pathogenic isolate with 72 hours LC50 = 2.3 x 106 spore.ml-1 and LT50 (1.5 x 107 spoore.ml-1) of 40.7 hours. The shortest LT50 (1.5 x 107 spore.ml-1 was found to be 18.2 hours produced by TUS.1 with 72 hours LC50 = 3.9 x 105 spore.ml-1 whereas the longest LT50 (1.5 x 107 spore.ml-1) was found tobe 83.2 hours produced by the SLK 4.1 with 72 hours LC50 = 3.1 x 104 spore.ml-1. Therefore, it can be concluded that both YPPA.1 and TUS.1 isolates are potential candidate to be developed for biological control agent.
High Prevalence Level of Avian Malaria in the Wild Population of the Java Sparrow Pramana Yuda
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 14, No 3 (2009): October 2009
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v14i3.2583

Abstract

Java sparrow (Padda oryzativa) is anendemic bird to Java and Bali. It used to be avery common bird, but due to over exploitationthe bird has declined and been classified asVulnerable (BirdLife International, 2001). InIndonesia bird-keeping is a popular pastime,with deep cultural roots (Jepson and Ladle,2005). It is widely assumed that the hobbynegatively affects wild populations of commonas well as threatened birds (Jepson and Ladle,2005; Nash, 1994), such as Java sparrow.
Keragaman Genetik Kultivar Pisang Diploid (AA) Koleksi Cibinong Science Center Berdasarkan Marka RAPD dan ISSR Yuyu Suryasari Poerba; Fajarudin Ahmad
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2584

Abstract

The banana (Musa acuminata Colla) is considered as an important crop plant due to its high economic value which also has good dietary source. Here, the genetic variation of 20 diploid (AA) banana cultivars from Cibinong Science Center collection were analyzed. Random amplified polymorphic DNAs (RAPDs) and Inter Simple Sequence Repeats fingerprinting of these banana cultivars were carried out by four primers of RPDSs and two primers of inter simple sequence repeats (ISSRs) led to DNA amplification. The amplification products of RPADs and ISSRs were polymorphic, 97.83% and 95%, respectively. Size of the bands was varied from 350bp to 2.0 kbp. The range of genetic distance was from 0.06 to 0.07. The molecular data showed that these banana varieties were diverse collection.
Khelatisasi Ion Aluminium oleh Asam Organik Eksudat Akar Brachiaria B. Hafif; S. Sabiham; A. Iswandi; A. Sutandi; Suyamto Suyamto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2585

Abstract

Aluminum toxicity is one of the major factors inhibiting plant growth in acid soils. Brachiaria grass adapt to high Al concentration. This experiment was conducted to study exudation of low molecular weight organic acids (LMWOA) activated by Al, from Brachiaria roots and its potential in chelating Al. Three Brachiaria species, i.e. B. decumbens, B. ruziziensis and B. brizantha, planted in sterile sand culture and were treated with 5 Al concentrations (0, 100, 200, 300 and 400 μM). After two-month experiment, three kinds of LMWOA, i.e, malic, citric, and oxalic acids, produced by the three Brachiaria-root exudates were measured in the sand culture. The production of malic acid was higher than that of citric and oxalic acid. Those organic acids were influenced by Al concentration; the higher Al concentration the higher organic acid content would be. The organic acids were also proved to form Al-organic compounds effectively of which B. decumbens and B. brizantha were more effective in chelating Al at relatively low Al (100 μM) and at relatively high Al concentration (300 μM and 400 μM), respectively.
Aktivitas Antibakteri Bacillus yang Berasosiasi dengan Landak Laut di Pantai Mentigi, Lombok Barat Bambang Fajar Suryadi; Novi Febrian
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2586

Abstract

The search for new antimicrobial agents is very significant. The prevalence of antimicrobialresistance among key microbial pathogens is increasing at an alarming rate worldwide. Bacillusspecies produce many kinds of antibiotics which share a full range of antimicrobial activities.The aim of this research is to study antibacterial activity of three bacillus isolates (1A, 2J, 3L)which were isolated in Mentigi Beach, West Lombok. Assessment for antibacterial activity wasconducted using Overlaid Molten agar method on Nutrient Agar medium at different salinity(concentration of NaCl 0, 5, 10%) and different pH (pH 6, 7 and 8). The study showed that therewere different antibacterial activities at different salinity and different pH media. Production ofantibacterial at 0% NaCl concentration occurred only at pH 6 and 7 and had narrow spectrumcharacter (only for Gram positive bacteria). Addition of 5% NaCl made antibacterialproduction might occur at pH 6, 7 and 8 and had wide spectrum character (for Gram positiveand negative bacteria).
Optimasi Produksi Poli-β-Hidroksibutirat (PHB) oleh Bacillus sp. PSA10 Nur Arfa Yanti; Sebastian Margino; Langkah Sembiring
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2587

Abstract

A new strain characterized as Bacillus sp. PSA10 was found to produce poly-β-hydroxybutyrate (PHB) at concentration of 52.28% (g PHB/g dry cell weight) in shaken flask culture, using sago starch as a carbon source. This research is aimed to determine the optimum culture condition of PHB production Bacillus sp. PSA10 at laboratory scale. Optimization of PHB production was conducted in this research, in terms of inoculum concentration, concentration of the major components in minimal medium, environmental condition and incubation time. The result showed that optimum conditions for the production of PHB by Bacillus sp. PSA10 were achieved at minimal medium (Ramsay medium) with 5% (v/v) inoculum concentration, 2% (w/v) sago starch, 1.0 g/l (NH4)2SO4, 6.7 g/l Na2HPO4.7H2O, and 0 g/l KCl. The optimum environmental conditions were achieved with initial pH 7, temperature 37oC, agitation speed at 150 rotary per minute (rpm) and the best of incubation time was 48 hour. Under this optimum condition, the maximum PHB production by Bacillus sp. PSA10 increased from 52.28% to 71.35% (g PHB/g dry cell weight) at 48 hour cultivation. Therefore, Bacillus sp. PSA10 is potential to apply for PHB production from sago starch at industrial scale.
Aktivitas Antibakteri Ekstrak Karang Lunak Sarcophyton sp. yang Difragmentasi dan Tidak Difragmentasi dari Perairan Pulau Pramuka, Kepulauan Seribu, Jakarta Mujizat Kawaroe; Dedi Soedarma; Hefni Effendi; Tati Nurhayati; Safrina Dyah Hardiningtyas
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2588

Abstract

Fragmented and non-fragmented soft corals showed antibacterial activities. Soft corals were gradually extracted using methanol, ethyl acetate, and hexane. Crude extract of the samples was tested its antibacterial activity, Minimun Inhibitory Concentration, toxicity (Brine Shrimp Lethality Test method), and phytochemicals. Overall, the antibacterial activity of crude extract of non-fragmented soft coral Sarcophyton sp. was higher than the crude extract of fragmented soft coral Sarcophyton sp. Crude ethyl acetate extract showed higher antibacterial activities. The ethyl acetate crude extract of non-fragmented soft coral Sarcophyton sp. is able to inhibit all tested bacteria is E. coli, S. aureus, P. aeruginosa and B.cereus, while the ethyl acetate crude extract of fragmented Sarcophyton sp. is unable to inhibit bacteria P. aeruginosa. Minimum inhibitory concentration extracts of non-fragmented Sarcophyton sp. in range 240−480 μg/disc. The 24-h LC50 extracts of fragmented and non-fragmented Sarcophyton sp. for Artemia salina were 149.50 ppm and 45.15 ppm, respectively. Bioactive compounds of fragmented and non-fragmented Sarcophyton sp. extract are steroid, flavonoid and alkaloid.
Keanekaragaman Laba-laba Pada Pertanaman Jambu Mete Monokultur dan Polikultur di Lombok Utara I Wayan Suana; Hery Haryanto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2589

Abstract

Agricultural practice is suspected to influence the availability of spiders in cashew plantation. The aim of this research was to study the diversity of spider in two different agricultural practices: monoculture and polyculture. The research was conducted in cashew plantations in Desa Kayangan (monoculture) and Desa Salut (polyculture), Lombok Utara. Two trapping techniques were used to sample the spiders: sweep net and pitfall trap. In each study area, 10 sampling sites were selected along line transect that was 5000 meters long. The study found 36 species of spiders from 12 families. The diversity and richness of spiders were higher in the polyculture cashew plantation than that in monoculture. Habitat structure was more complex in the polyculture cashew plantation; hence many species of spiders were able to coexist there.
Daya Dukung dan Laju Pertumbuhan Microcystis Hasil Isolasi dari Waduk Sutami pada Berbagai Variasi Konsentrasi Nitrat dan Fosfat dalam Medium Selektif B-12 Catur Retnaningdyah; Suharjono Suharjono; Agoes Soegianto; Bambang Irawan
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2590

Abstract

The main objective of this research was to calculate the carrying capacity and growth rate ofisolated Microcystis result in Sutami reservoir on a variety of nitrate and phosphateconcentrations in the B-12 selective medium. Research was conducted in the laboratory withpure experiments using completely randomized factorial design with factors of nitrateconcentration variation (8, 16, 32, and 64 ppm) and phosphate (0.2, 0.4, 0.8 and 1.6 ppm) in B-12medium. Repetition of the study was conducted three times at the same time. Microcystispopulation abundance which was counted every day until the stationary phase (day +30) wasused to calculate the rate of growth (β) and maximum abundance of Microcystis can besupported by each medium treatment (γ). The results showed that the growth rate of Microcystiswas not significantly influenced by levels of phosphate in the medium but significantly positivelycorrelated with increasing nitrate concentration in the medium. Carrying capacity or themaximum abundance (γ) of Microcystis was influenced by the combination of nitrate andphosphate in the B12 medium. Concentration of phosphate 0.4 ppm in medium combined withnitrate 8−64 ppm could support the highest abundance of Microcystis.
Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene Yohana Theresia Astuti; Kumala Dewi; Santosa Santosa; A. Adi Prawoto
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 15, No 3 (2010): October 2010
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v15i3.2591

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.

Page 76 of 120 | Total Record : 1193


Filter by Year

2003 2026


Filter By Issues
All Issue Vol 11, No 1 (2026): February 2026 Vol 10, No 3 (2025): October 2025 Vol 10, No 2 (2025): June 2025 Vol 10, No 1 (2025): February 2025 Vol 9, No 3 (2024): October 2024 Vol 9, No 2 (2024): June 2024 Vol 9, No 1 (2024): February 2024 Vol 8, No 3 (2023): October 2023 Vol 8, No 2 (2023): June 2023 Vol 8, No 1 (2023): February 2023 Vol 7, No 3 (2022): October 2022 Vol 7, No 2 (2022): June 2022 Vol 7, No 1 (2022): February 2022 Vol 6, No 3 (2021): October 2021 Vol 6, No 2 (2021): June 2021 Vol 6, No 1 (2021): February 2021 Vol 5, No 3 (2020): October 2020 Vol 5, No 2 (2020): June 2020 Vol 5, No 1 (2020): February 2020 Vol 4, No 3 (2019): October 2019 Vol 4, No 2 (2019): June 2019 Vol 4, No 1 (2019): February 2019 Vol 4, No 1 (2019): February 2019 Vol 3, No 3 (2018): October 2018 Vol 3, No 2 (2018): June 2018 Vol 3, No 1 (2018): February 2018 Vol 3, No 1 (2018): February 2018 Vol 2, No 3 (2017): October 2017 Vol 2, No 2 (2017): June 2017 Vol 2, No 1 (2017): February 2017 Vol 2, No 1 (2017): February 2017 Vol 1, No 3 (2016): October 2016 Vol 1, No 2 (2016): June 2016 Vol 1, No 1 (2016): February 2016 Vol 1, No 1 (2016): February 2016 Vol 19, No 1 (2014): February 2014 Biota Volume 19 Nomor 1 Tahun 2014 Biota Volume 13 Nomor 2 Tahun 2014 Vol 18, No 2 (2013): June 2013 Vol 18, No 1 (2013): February 2013 Biota Volume 18 Nomor 1 Tahun 2013 Vol 17, No 3 (2012): October 2012 Vol 17, No 2 (2012): June 2012 Vol 17, No 1 (2012): February 2012 BIOTA Volume 17 Nomor 3 Tahun 2012 Vol 16, No 2 (2011): June 2011 Vol 16, No 2 (2011): June 2011 Vol 16, No 1 (2011): February 2011 Vol 16, No 1 (2011): February 2011 Vol 15, No 3 (2010): October 2010 Vol 15, No 2 (2010): June 2010 Vol 15, No 1 (2010): February 2010 Vol 14, No 3 (2009): October 2009 Vol 14, No 2 (2009): June 2009 Vol 14, No 1 (2009): February 2009 Vol 13, No 3 (2008): October 2008 Vol 13, No 2 (2008): June 2008 Vol 13, No 1 (2008): February 2008 Vol 12, No 3 (2007): October 2007 Vol 12, No 2 (2007): June 2007 Vol 12, No 1 (2007): February 2007 Vol 11, No 3 (2006): October 2006 Vol 11, No 2 (2006): June 2006 Vol 11, No 1 (2006): February 2006 Vol 10, No 3 (2005): October 2005 Vol 10, No 2 (2005): June 2005 Vol 10, No 1 (2005): February 2005 Vol 9, No 3 (2004): October 2004 Vol 9, No 2 (2004): June 2004 Vol 9, No 1 (2004): February 2004 Vol 8, No 3 (2003): October 2003 Vol 8, No 2 (2003): June 2003 Vol 8, No 1 (2003): February 2003 More Issue