Article Per Year (5 Year)
p-Index From 2020 - 2025
1.235
P-Index
This Author published in this journals
All Journal Jurnal Pendidikan Matematika dan IPA Prosiding Seminar Biologi AGRIVITA, Journal of Agricultural Science Sawwa: Jurnal Studi Gender ANNALES BOGORIENSES AGROTEK: Jurnal Ilmiah Ilmu Pertanian Jurnal Sains dan Teknologi Pertanian Proceeding Biology Education Conference Makara Journal of Health Research Jurnal El-Thawalib
Desriani Desriani
Research Centre for Biotechnology, LIPI. Jl. Raya Bogor Km 46, Kec. Cibinong, Kab. Bogor, 16911. Indonesia. Telp: +62-21-8754587.
Religion Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Education Environmental Science Immunology & microbiology Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Physics Public Health Social Sciences

Published : 17 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 17 Documents
Search

 1   2 
Development of Sybr Green I-Based Melting Curve Method for HER2I655V Polymorphism Detection in Breast Cancer Budiarto, Bugi R; Harahap, Wirsma A; Desriani, Desriani
Makara Journal of Health Research Vol. 20, No. 2
Publisher : UI Scholars Hub

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Background: Currently available molecular method to detect HER2I655V polymorphism such as PCR-RFLP is hampered by the costly experimental method, and post-PCR treatment requirement that makes this technique is not meeting for high-throughput analysis purpose. In this study, we developed an accurate, simple, low cost and rapid test to detect polymorphism at HER2 gene using SBR Green I based-melting curve method. Methods: Two forward allele-specific primers and one common reverse primer were used then these primers were tested to discriminate known genotypes of genomic templates (GG type or AA type) and genomic samples retrieved from breast cancer patients. Results: Melting curve analysis derived from SYBR Green I-based allele-specific PCR with defined primers concentration and annealing temperature at 54.3 °C showed good discrimination level of Tm peaks in which GG genotype melted at 89 °C slightly higher than AA genotype which melted at 86 °C, while AG genotype harbored both of homozygous Tm characteristics. Conclusions: This preliminary result will be as basic for further large-scale typing of HER2I655V polymorphism.
TA CLONING PARTIAL ALBUMIN GENE AND ITS TEST FOR SUPPORTING PHARMACOGENOMIC DETECTION DEVELOPMENT Effendi, Rinal; Putri Kumala, Ajeng; Marti Abna, Inherni; Yurika, Oktri; Desriani, Desriani
Jurnal Pendidikan Matematika dan IPA Vol 15, No 3 (2024): September 2024
Publisher : Universitas Tanjungpura

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.26418/jpmipa.v15i3.85093

Abstract

DNA recombinant technology is a tool that could support thedevelopment of pharmacogenomic detection such as for CYP2D6 copy number detection application. The housekeeping gene was identified as an internal control alternative for the copy number of the CYP2D6 detection component. There are many kinds of housekeeping genes, including albumin. In this report, we have successfully TA-cloned partial albumin to support the development of CYP2D6 copy number detection. TA-cloning was successfully confirmed with white-blue methods in media LB + ampicillin + IPTG + X-Gal and with colony PCR methods. Further, we made a standard curve with this recombinant plasmid to evaluate albumin qPCR efficiency and showed high-efficiency qPCR 0,9914 (99%). Based on the CYP2D6 copy number developed, the test in this study showed low concordance with high reproducibility Long PCR, indicating that the nucleotide base area of albuminand CYP2D6 in this studywas not recommended for CYP2D6 gene multiplication detection. 
KEBERADAAN ARTHROPODA MUSUH ALAMI PADA TANAMAN BERBUNGA DAN PELLET YANG DIAPLIKASIKAN DI PERTANAMAN PADI Chaeriyah, Naeilul; Okasa, Andi Muliarni; Desriani, Desriani; Jumardi, Jumardi; Munawarah, Munawarah
PLANTKLOPEDIA: Jurnal Sains dan Teknologi Pertanian Vol 4 No 1 (2024): Maret
Publisher : Program Studi Agroteknologi, Fakultas Sains dan Teknologi, Universitas Muhammadiyah Siddenreng Rappang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55678/plantklopedia.v4i1.995

Abstract

Keberadaan dan peranan musuh alami di alam semakin berkurang karena penggunaan pestisida sintetik yang tidak bijaksana sehingga perlu diadakan kegiatan konservasi. Konservasi musuh alami dengan cara penanaman tanaman berbunga, penambahan suplemen buatan serta sistem tanam tumpang sari adalah beberapa kegiatan dalam meningkatkan peranan musuh alami yang ada di ekosistem. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pellet dan tanaman berbunga terhadap keberadaan arthropoda musuh alami di sawah. Pengambilan sampel dilaksanakan di area persawahan Kecamatan Bajeng Kabupaten Gowa dan dilanjutkan di Laboratorium Hama, Jurusan Ilmu Hama dan Penyakit Tanaman, Universitas Hasanuddin, Makassar. Percobaan dilakukan di lahan petani seluas kira-kira 25 are lalu dibagi menjadi tiga petak dengan luas 12 m × 25 m untuk masing-masing perlakuan yang dibatasi dengan plastik putih. Pemberian pellet dan tanaman berbunga kenikir merupakan perlakuan. Hasil penelitian menunjukkan bahwa Jenis musuh alami yang di temukan pada perlakuan kombinasi pellet dan kenikir adalah Semut, Larva Coccinella, Laba-laba loncat, Laba-laba rahang panjang, Belalang, Laba-laba kerdil, dan Laba-laba serigala. Jenis Arthropoda tersebut lebih banyak bila di bandingkan dengan perlakuan pellet atau bunga kenikir secara sendiri-sendiri.
Effectiveness of Botanical Pesticides in Managing Pests in Shallot Cultivation Desriani, Desriani; Okasa, Andi Muliarni
PLANTKLOPEDIA: Jurnal Sains dan Teknologi Pertanian Vol 4 No 2 (2024): September
Publisher : Program Studi Agroteknologi, Fakultas Sains dan Teknologi, Universitas Muhammadiyah Siddenreng Rappang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55678/plantklopedia.v4i2.1647

Abstract

Botanical pesticides have emerged as a sustainable alternative to synthetic chemical pesticides in agricultural production. These plant-derived compounds offer various advantages, including efficacy against different crop pests, biodegradability, and low toxicity to non-target organisms. This literature review examines the potential of botanical pesticides for managing pests in shallot cultivation, a vital crop in many regions. The review synthesizes research on the phytochemical composition, modes of action, and practical applications of botanical pesticides in shallot pest management. Botanical pesticides contain a diverse array of phytochemicals, such as alkaloids, terpenes, and phenolic compounds, which can exhibit insecticidal, antifeedant, and repellent properties against a range of shallot pests. These natural compounds often target multiple physiological and behavioral processes in pests, reducing the likelihood of developing resistance. Furthermore, botanical pesticides are generally less persistent in the environment and have a lower impact on beneficial organisms, making them a more ecologically sustainable option for integrated pest management in shallot cultivation.
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
PREFERENSI MUSUH ALAMI Coccinella sp TERHADAP SIRUP TUMBUHAN BERBUNGA Chaeriyah, Naeilul; Desriani, Desriani; Okasa, Andi Muliarni; Sulaiman, Sulaiman
AGROTEK: Jurnal Ilmiah Ilmu Pertanian Vol 8, No 2 (2024): September
Publisher : Percetakan Umi Toaha Makassar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33096/agrotek.v8i2.621

Abstract

The need for rice as one of the main food sources increases along with the population of Indonesia. One of the obstacles to increasing rice productivity is pest attacks. In the rice fields, there are predatory insects which are important as pest control agents in rice plants. Coccinella sp is a type of predator that is often found in rice plantations. The urgency of this research is the need to conserve natural enemies such as managing flowering plants and providing additional food (supplements) to predators. This is because planting flowering plants in rice fields will hinder or disrupt farmers' roads and if flowering plants are not managed properly they will become nesting places for mice, so it would be better to formulate these flowering plants into artificial syrup. This study aimed to determine the preferences of insect predators for various forms of pellets and various types of flowers. The treatments in this study were kenikir and Zinnia (Zinnia elegans). In each experiment, all treatments were put into a petri dish and a predatory imago, Coccinella sp., was released in the middle. From testing the predator response of Coccinella sp. for Kenikir and Zinnia flower syrup which were rated the best by observing the average frequency of Coccinella sp. attending each treatment with the length of time used. The experiment was arranged using a completely randomized design (CRD) treated with ANNOVA. The results showed that the response of the natural enemy Coccinella sp. frequency of visits was most often to white Zinnia flower syrup which was sweetened with brown sugar solution and the longest was to yellow kenikir flower syrup which was added to honey solution.
Analisis Fatwa MUI Nomor 4 Tahun 2003 Desriani, Desriani; Hasibuan, Zulfan Efendi; Harahap, Risalan Basri
Jurnal El-Thawalib Vol 2, No 5 (2021)
Publisher : UIN Syekh Ali Hasan Ahmad Addary Padangsidimpuan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24952/el-thawalib.v2i5.4400

Abstract

Various kinds of culinary are rife in the middle of the city of padangsidimpuan by using thr name of processed food using a strange name. one of the branded products thet are currently becoming a tren in the community are meatballs with children, devil’s noodles, missile meatball cones and so on.Islam requires that the products to be consumed will be guaranteed to be halal and pure. Halal is not only from the type but also from the name. where in the explanation of the MUI Fatwa Number 4 of 2003 concerning standardization of halal fatwas, it is contained in the fourth section: the problem of using names and ingredients in point 1, namely “not to consume and use names and/or symbols of food/drinks that leat to kufr and falsehood”. From this background for naming processed foods in padangsidimpuan city based on MUI Fatwa Analysis Number 4 of 2003.This research is a field research. The research used is to collect data on the phenomena that occur. The data sources of this research are primary data and secondary data. Data collection techniques using field studies, namely ovservation, interviews and documentation.The results of this study indicate that traders or sesllers give the names of the foods they make with strange names because of the many business competitors. Based on the MUI Fatwa Number 4 of 2003, the author’s analysis of the naming of processed foods that are contrary to the MUI Fatwa are devil noodles, dragon whiskers, and devil’s chili chicken, while the names of processed foods that are allowed or not contrary to the MUI Fatwa Number 4 of 2003 such as meadballs with planet chicken because these names do not lead to  kufr/falsehood as described in the MUI Fatwa.
Co-Authors Azamris, Azamris Budiarto, Bugi R BUGI RATNO BUDIARTO Chaeriyah, Naeilul Dwi Endah Kusumawati Dwi Wulandari Filasofa, Lilif Muallifatul Khorida Hapsari, Betalini Widhi Harahap, Risalan Basri Harahap, Wirsma A Hasibuan, zulfan Efendi Haz, Aufa Rizqia Isna Nurhayati, Isna Jumardi Jumardi Kumala, Ajeng Putri MARIA BINTANG Marti Abna, Inherni Munawarah Munawarah, Munawarah Mursid Mursid Neneng Hasanah Noorohmah, Siti Okasa, Andi Muliarni Putri Kumala, Ajeng Rahayu, Resa Sri Raihan, Eldrian Daffa Rantau, Deritha Ellfy Rinal Effendi Siti Zubaidah Sitti Fatimah Syahid Sofa Muthohar Sulaiman Sulaiman Syamsul Falah Warisman, M Ali Wiwit Amrinola Wulandari, Dyah Retno Yuliawati Yurika, Oktri