Claim Missing Document
Check
Articles

Found 19 Documents
Search

KEBERADAAN ARTHROPODA MUSUH ALAMI PADA TANAMAN BERBUNGA DAN PELLET YANG DIAPLIKASIKAN DI PERTANAMAN PADI Chaeriyah, Naeilul; Okasa, Andi Muliarni; Desriani, Desriani; Jumardi, Jumardi; Munawarah, Munawarah
PLANTKLOPEDIA: Jurnal Sains dan Teknologi Pertanian Vol 4 No 1 (2024): Maret
Publisher : Program Studi Agroteknologi, Fakultas Sains dan Teknologi, Universitas Muhammadiyah Siddenreng Rappang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55678/plantklopedia.v4i1.995

Abstract

Keberadaan dan peranan musuh alami di alam semakin berkurang karena penggunaan pestisida sintetik yang tidak bijaksana sehingga perlu diadakan kegiatan konservasi. Konservasi musuh alami dengan cara penanaman tanaman berbunga, penambahan suplemen buatan serta sistem tanam tumpang sari adalah beberapa kegiatan dalam meningkatkan peranan musuh alami yang ada di ekosistem. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pellet dan tanaman berbunga terhadap keberadaan arthropoda musuh alami di sawah. Pengambilan sampel dilaksanakan di area persawahan Kecamatan Bajeng Kabupaten Gowa dan dilanjutkan di Laboratorium Hama, Jurusan Ilmu Hama dan Penyakit Tanaman, Universitas Hasanuddin, Makassar. Percobaan dilakukan di lahan petani seluas kira-kira 25 are lalu dibagi menjadi tiga petak dengan luas 12 m × 25 m untuk masing-masing perlakuan yang dibatasi dengan plastik putih. Pemberian pellet dan tanaman berbunga kenikir merupakan perlakuan. Hasil penelitian menunjukkan bahwa Jenis musuh alami yang di temukan pada perlakuan kombinasi pellet dan kenikir adalah Semut, Larva Coccinella, Laba-laba loncat, Laba-laba rahang panjang, Belalang, Laba-laba kerdil, dan Laba-laba serigala. Jenis Arthropoda tersebut lebih banyak bila di bandingkan dengan perlakuan pellet atau bunga kenikir secara sendiri-sendiri.
Effectiveness of Botanical Pesticides in Managing Pests in Shallot Cultivation Desriani, Desriani; Okasa, Andi Muliarni
PLANTKLOPEDIA: Jurnal Sains dan Teknologi Pertanian Vol 4 No 2 (2024): September
Publisher : Program Studi Agroteknologi, Fakultas Sains dan Teknologi, Universitas Muhammadiyah Siddenreng Rappang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55678/plantklopedia.v4i2.1647

Abstract

Botanical pesticides have emerged as a sustainable alternative to synthetic chemical pesticides in agricultural production. These plant-derived compounds offer various advantages, including efficacy against different crop pests, biodegradability, and low toxicity to non-target organisms. This literature review examines the potential of botanical pesticides for managing pests in shallot cultivation, a vital crop in many regions. The review synthesizes research on the phytochemical composition, modes of action, and practical applications of botanical pesticides in shallot pest management. Botanical pesticides contain a diverse array of phytochemicals, such as alkaloids, terpenes, and phenolic compounds, which can exhibit insecticidal, antifeedant, and repellent properties against a range of shallot pests. These natural compounds often target multiple physiological and behavioral processes in pests, reducing the likelihood of developing resistance. Furthermore, botanical pesticides are generally less persistent in the environment and have a lower impact on beneficial organisms, making them a more ecologically sustainable option for integrated pest management in shallot cultivation.
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
PREFERENSI MUSUH ALAMI Coccinella sp TERHADAP SIRUP TUMBUHAN BERBUNGA Chaeriyah, Naeilul; Desriani, Desriani; Okasa, Andi Muliarni; Sulaiman, Sulaiman
AGROTEK: Jurnal Ilmiah Ilmu Pertanian Vol 8, No 2 (2024): September
Publisher : Percetakan Umi Toaha Makassar

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33096/agrotek.v8i2.621

Abstract

The need for rice as one of the main food sources increases along with the population of Indonesia. One of the obstacles to increasing rice productivity is pest attacks. In the rice fields, there are predatory insects which are important as pest control agents in rice plants. Coccinella sp is a type of predator that is often found in rice plantations. The urgency of this research is the need to conserve natural enemies such as managing flowering plants and providing additional food (supplements) to predators. This is because planting flowering plants in rice fields will hinder or disrupt farmers' roads and if flowering plants are not managed properly they will become nesting places for mice, so it would be better to formulate these flowering plants into artificial syrup. This study aimed to determine the preferences of insect predators for various forms of pellets and various types of flowers. The treatments in this study were kenikir and Zinnia (Zinnia elegans). In each experiment, all treatments were put into a petri dish and a predatory imago, Coccinella sp., was released in the middle. From testing the predator response of Coccinella sp. for Kenikir and Zinnia flower syrup which were rated the best by observing the average frequency of Coccinella sp. attending each treatment with the length of time used. The experiment was arranged using a completely randomized design (CRD) treated with ANNOVA. The results showed that the response of the natural enemy Coccinella sp. frequency of visits was most often to white Zinnia flower syrup which was sweetened with brown sugar solution and the longest was to yellow kenikir flower syrup which was added to honey solution.
Analisis Fatwa MUI Nomor 4 Tahun 2003 Desriani, Desriani; Hasibuan, Zulfan Efendi; Harahap, Risalan Basri
Jurnal El-Thawalib Vol 2, No 5 (2021)
Publisher : UIN Syekh Ali Hasan Ahmad Addary Padangsidimpuan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24952/el-thawalib.v2i5.4400

Abstract

Various kinds of culinary are rife in the middle of the city of padangsidimpuan by using thr name of processed food using a strange name. one of the branded products thet are currently becoming a tren in the community are meatballs with children, devil’s noodles, missile meatball cones and so on.Islam requires that the products to be consumed will be guaranteed to be halal and pure. Halal is not only from the type but also from the name. where in the explanation of the MUI Fatwa Number 4 of 2003 concerning standardization of halal fatwas, it is contained in the fourth section: the problem of using names and ingredients in point 1, namely “not to consume and use names and/or symbols of food/drinks that leat to kufr and falsehood”. From this background for naming processed foods in padangsidimpuan city based on MUI Fatwa Analysis Number 4 of 2003.This research is a field research. The research used is to collect data on the phenomena that occur. The data sources of this research are primary data and secondary data. Data collection techniques using field studies, namely ovservation, interviews and documentation.The results of this study indicate that traders or sesllers give the names of the foods they make with strange names because of the many business competitors. Based on the MUI Fatwa Number 4 of 2003, the author’s analysis of the naming of processed foods that are contrary to the MUI Fatwa are devil noodles, dragon whiskers, and devil’s chili chicken, while the names of processed foods that are allowed or not contrary to the MUI Fatwa Number 4 of 2003 such as meadballs with planet chicken because these names do not lead to  kufr/falsehood as described in the MUI Fatwa.
Evaluation of Curcumin-derived Carbon-dots' Inhibitory Activity as SARS-CoV-2 Antiviral Candidate Using Chemical Crosslinking Taharuddin, Audrey Angelina Putri; Yamahoki, Nicholas; Stephanie, Rebecca; Agustiyanti, Dian Fitria; Wisnuwardhani, Popi Hadi; Angelina, Marissa; Rubiyana, Yana; Ningrum, Ratih Asmana; Wardiana, Andri; Desriani, Desriani; Hariyatun, Hariyatun; Iskandar, Ferry; Permatasari, Fitri Aulia; Giri-Rachman, Ernawati Arifin; Fibriani, Azzania
HAYATI Journal of Biosciences Vol. 33 No. 1 (2026): January 2026
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.33.1.232-239

Abstract

In our previous work, we demonstrated that curcumin-derived carbon dots (Cur-CDs) have potential as antivirals for COVID-19. However, the precise mechanism of action remains unclear. This study investigated the potential of Cur-CDs against SARS-CoV-2 by targeting the dimerization of the C-terminal domain of nucleocapsid protein (N-CTD) using chemical crosslinking. Recombinant SARS-CoV-2 N-CTD was expressed, purified, and subjected to chemical crosslinking. The dimerization inhibition ability of Cur-CDs was assessed with ligand concentrations ranging from 0 to 2,000 μg/mL. Successful inhibition —defined as a noticeable reduction in SARS-CoV-2 N-CTD dimer band intensity on SDS-PAGE—was observed when Cur-CDs were present at 8 to 16 times the protein concentration. We hypothesize that Cur-CDs bind to the dimerization residues, preventing non-covalent interactions between monomers and limiting dimer formation. Our findings suggest that Cur-CDs could be a promising antiviral strategy for SARS-CoV-2, especially targeting the dimerization of the nucleocapsid protein. Additionally, this study also highlights the use of chemical crosslinking as a valuable tool for interaction-based drug screening.
Improvement of HER2I655V TARMS-PCR Performance by DNA Quality Analysis Budiarto, Bugi Ratno; Azamris, Azamris; Desriani, Desriani
Annales Bogorienses Vol. 21 No. 2 (2017): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Reliable TARMS-PCR is a prerequisite in constructing a solid conclusion in genetic diagnostics. The validity of data generated by this molecular technique is hampered by a false positive result. In attempt to develop a TARMS-PCR for HER2I655V genotyping with no interfering of bias we used DNase I to eliminate DNA contaminant resided in PCR reagent. TARMS-PCR without enzyme treatment using recombinant plasmids that contained HER2I655V gene with represented its alleles was used to evaluate the presence of false positive result while DNase I treated-PCR reagent was used in TARMS-PCR to evaluate the effective dose of the enzyme and further to adjust the TARMS-PCR conditions. PCR master mix kit used in this study produced a false positive result on HER2I655V TARMS-PCR as proven by the presence of multiple PCR products in Non-Template Control (NTC) and 0.1 U of the enzyme could eliminate this DNA contaminant effectively, although this pretreatment altered the specificity of HER2I655V TARMS-PCR genotyping on certain genotype. Combination of touchdown TARMS-PCR with another allele-specific primer recovered specificity of detection on this model system. Interestingly, this optimized HER2I655V TARMS-PCR can only be used for genotyping the clinical samples if only further optimization was done using genomic DNA as template
ILE655VAL Genotyping Study of HER2 - Positive Breast Cancer of Patients from Padang - Indonesia With High Resolution Melting Technique Wulandari, Dwi; Azamris, Azamris; Nurhayati, Isna; Warisman, M. Ali; Budiarto, Bugi Ratno; Desriani, Desriani
Annales Bogorienses Vol. 21 No. 2 (2017): Annales Bogorienses
Publisher : BRIN

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Transtuzumab has proven to be a great improvement in the treatment of HER2 + of breast cancer patients, but it is associated with relevant adverse cardiac events and with significantly elevated cost of treatment. One of the risk factors for cardiotoxicity due to transtuzumab is the I655V HER2 polymorphism (GTC> ATC mutation) in which the allele mutant (Ile val or val / val) has a higher risk than the wild type (Ile/Ile). The detection of specific alleles is very important for therapeutic decision-making. In this study, our group have developed a HRM with EvaGreen dye method to discriminate specific allele of I655V HER2 (wild type, heterozygote mutant or homozygote mutant) in 66 frozen section samples of HER2+ of breast cancer patients. Our group reported the wild type is the most prevalent allele (77,27%), whereas heterozygous mutation is significantly present in this research (21,21%) and only 1,52% of sample detected as minor allele. It showed that only one sample detected as a minor allele (val/val) and may have relatively low abundance in the population. This method has been compared with sanger sequencing and giving 100% of validity.
Analisis Strategi Pemasaran Untuk Meningkatkan Volume Penjualan Pada Toko Emas Anak Rokan Di Kecamatan Kubu Babussalam Kabupaten Rokan Hilir Dalam Ekonomi Islam Zulfikar, Zulfikar; Desriani, Desriani; Wahyudi, Denny
Journal of Islamic Banking, Economics and Finance Vol. 1 No. 1 (2024): October 2024
Publisher : EL-EMIR Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.63477/jibef.v1i1.79

Abstract

This research was conducted to see the increase in gold sales at Anak Rokan gold shops in Kubu Babussalam Rokan Hilir District and what strategies are used to increase sales volume and what, from an Islamic perspective, are the marketing strategies used at Anak Rokan gold shops. The research method used in this research is a qualitative method by conducting interviews with customers or buyers who shop at the Emas Anak Rokan store. Based on the results of the IE matrix analysis, Anak Rokan Gold Shop occupies Cell V, which means that the company or Gold Shop tends to carry out market penetration strategies and product development strategies. Based on the results of the Grand Strategy Matrix analysis, the Anak Rokan Gold Shop is located in quadrant 1, because according to the EFE and IFE, the opportunities for strength are greater than the threats and weaknesses. Anak Rokan Gold Shop must be more dominant in carrying out strategies by growing and developing products.