Article Per Year (5 Year)
p-Index From 2021 - 2026
0
P-Index
This Author published in this journals
All Journal Journal of Food and Pharmaceutical Science Jurnal Ilmiah Farmasi Journal of the Medical Sciences (Berkala Ilmu Kedokteran) Dentika Dental Journal Pharmaciana: Jurnal Kefarmasian Indonesian Journal of Cancer Chemoprevention The Indonesian Journal of Dental Research Majalah Obat Tradisional INDONESIAN JOURNAL OF PHARMACY Jurnal Farmasi Sains dan Komunitas PHARMACY: Jurnal Farmasi Indonesia (Pharmaceutical Journal of Indonesia) JFIOnline Media Farmasi Indonesia Jurnal Kefarmasian Indonesia
Sudibyo Martono
Faculty Of Pharmacy, Universitas Gadjah Mada Yogyakarta, Indonesia
Biochemistry, Genetics & Molecular Biology Chemistry Dentistry Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Neuroscience Public Health Other

Published : 26 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 26 Documents
Search

 1   2   3 
PENGARUH 1,5-BIS(4’-HIDROKSI-3’-METOKSIFENIL)-1,4-PENTADIEN-3-ON DAN KURKUMIN PADA AKTIVITAS ENZIM GLUTATION S-TRANSFERASE PARU TIKUS Yuniarti, Nunung; Martono, Sudibyo
Jurnal Farmasi Indonesia Vol 3, No 1 (2006)
Publisher : Jurnal Farmasi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35617/jfi.v3i1.70

Abstract

Curcumin was proved to have activity as GST inhibitor. 1,5-bis(4â??-hydroxy-3â??-methoxyphenyl)-1,4-pentadien-3-on which is curcumin analog, was predicted to have  same activity as curcumin. This experiment was conduct to verify that prediction, aimed to revealed the influence of 1,5-bis(4â??-hydroxy-3â??-methoxyphenyl)-1,4-pentadien-3-on as well as curcumin on rat lung GST activity  in vitro, using  1-chloro-2,4-dinitrobenzene (CDNB) as substrate. GST activity was determined using conjugation reaction of glutathione (GSH) with CDNB. GS-DNB conjugate formed was measured using spectrophotometry at l 345 nm between 0-3 minutes by simple kinetic program, result in certain rate (D absorption/minute). Using similar method, conjugation reaction was done, however with addition of 1,5-bis(4â??-hydroxy-3â??-methoxyphenyl)-1,4-pentadien-3-on and curcumin as inhibitor. Inhibition effect followed by the decreasing of reaction rate.  From the result it was concluded that  1,5-bis(4â??-hydroxy-3â??-methoxyphenyl)-1,4-pentadien-3-on and curcumin can inhibit mice lung GST activity with  IC50 value 9,13 mM and 13,32 mM. ABSTRAK Kurkumin dilaporkan memiliki aktivitas sebagai inhibitor GST. Senyawa 1,5-bis(4â??-hidroksi-3â??-metoksifenil)-1,4-pentadien-3-on yang merupakan senyawa analog kurkumin, diprediksikan memiliki aktivitas yang relatif sama dengan kurkumin. Oleh karena itu, dari hasil prediksi tersebut perlu dilakukan verifikasi dengan uji laboratoris. Penelitian ini bertujuan untuk mengetahui pengaruh senyawa 1,5-bis(4â??-hidroksi-3â??-metoksifenil)-1,4-pentadien-3-on dan kurkumin pada aktivitas GST paru tikus dengan substrat 1-kloro-2,4-dinitrobenzen (CDNB) secara in vitro. Aktivitas GST ditentukan menggunakan reaksi konjugasi glutation (GSH) dengan substrat CDNB. Konjugat GS-DNB yang terbentuk diukur secara spektrofotometri pada l 345 nm antara menit ke 0-3 menggunakan program simple kinetic, menghasilkan suatu rate (D serapan/menit). Dengan cara yang sama dilakukan reaksi konjugasi namun dengan penambahan senyawa 1,5-bis(4â??-hidroksi-3â??-metoksifenil)-1,4-pentadien-3-on dan kurkumin sebagai inhibitor. Adanya efek inhibisi diketahui dari penurunan rate. Dari hasil penelitian dapat disimpulkan bahwa senyawa 1,5-bis(4â??-hidroksi-3â??-metoksifenil)-1,4-pentadien-3-on dan kurkumin menghambat GST paru tikus dengan IC50 berturut-turut adalah 9,13 mM dan 13,32 mM.
Penetapan Kadar Alkaloid Ekstrak dari Etanolik Bunga Kembang Sepatu (Hibiscus rosa-sinensis L.) Murrukmihadi, Mimiek; Wahyuono, Subagus; Marchaban, .; Martono, Sudibyo
Jurnal Farmasi Indonesia Vol 6, No 3 (2013)
Publisher : Jurnal Farmasi Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (249.643 KB) | DOI: 10.35617/jfi.v6i3.134

Abstract

Kembang sepatu flower (Hibiscus rosa-sinensis L.) was fractionally used as expectorant. Based on Bioassay Guided fractionation, an active fraction was separated, and the fraction was identified is Alkaloid was the major compound based on TLC analysis. Viscosity value measured by viscometer was used as a Bioassay model of expectorant activity in vitro and acetyl cysteine was used as positive control. Alkaloid content determination of the ethanolic extract was measured by TLC-Densitometric compared with standard curve of isolated alkaloid as the selected marker (Y=12,1360X+2901,4474). The alkaloid content in the ethanolic extract was determined as 2.35±0,67%.Keywords : alkaloid, ethanolic extract, Hibiscus rosa-sinensis L.
Authentication of Wild Boar Meat in Meatball Formulation Using Differential Scanning Calorimetry and Chemometrics Guntarti, Any; Rohman, Abdul; Martono, Sudibyo; Yuswanto, Agustinus
Journal of Food and Pharmaceutical Sciences Vol 5, No 1 (2017): J. Food Pharm. Sci (January-April)
Publisher : Fakultas Farmasi, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (560.177 KB) | DOI: 10.14499/jfps

Abstract

Bakso or meatball is one of the Indonesian favorite foods, commonly made from beef. This food is quite popular among Indonesian societies. Due to the high price of beef, unethical producers may adulterate beef with wild boar meat (WBM). In this study, the potential use of differential scanning calorimetry (DSC) combined with multivariate calibration was used to verify adulteration of WBM in meatball formulation. Oil extracted from WBM is characterized by significantly different cooling and heating DSC thermal profiles. The change of characteristic exothermic and endothermic event in oil with increasing crystallization, melting enthalpy and developing both process over a narrower temperature range is investigated. In this research, we developed DSC and multivariate calibration of Partial Least Square (PLS) calibration to analyze WBM in beef meatball. Meanwhile, the chemometrics of Principle Componen Analysis (PCA) is used to classify WBM and beef in the meatball. The validation model using crystalization profiles yield the coefficient of determination (R2) of 0.999 for the correlation between actual value of WBM (x-axis) and DSC predicted value (y-axis) with equation of y= 0.9999 x + 0.0027, root mean square error of cross validation (RMSECV) of 0.380%, and root mean square error of prediction (RMSEP) of 0.203%. PCA is successfully used for classification of WBM in beef meatball. DSC in combination with PLS and PCA can be an alternative technique for analysis of WBM in meatball.Key words: Differential scanning calorimetry, Wild bear meat, Crystallization profile, Melting profile, Partial least square.
Effect of pentagamavunon-O on rat kidney’s glutathione s-transferase in-vivo with 1-chloro-2, 4-dinitro benzene as a substrate Rohman, Abdul; Martono, Sudibyo; A. Margono, Supardjan
Indonesian Journal of Pharmacy Vol 15 No 1, 2004
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (246.769 KB) | DOI: 10.14499/indonesianjpharm0iss0pp33-36

Abstract

Glutathione S-transferase (GST) is a detoxifying enzyme which plays an important role in glutathione conjugation reaction with electrophilic xenobiotic on phase two metabolism. In this research, the effect of oral administration of PGV-0 on rat kidney’s GST activity was investigated.To represent GST activity isolated from rat kidney, 1-chloro-2,4-dinitro benzen (CDNB) was used as a substrate on conjugation with glutathione (GSH) spectrophotometrically. The activity of rat kidney’s GSTs from untreated rat was used as control, Based on data, it can be concluded that PGV-0 showed an inhibitory effect on rat kidney’s GSTs. The optimum effect was obtained at 40 mg/kgBW with % inhibition value of 16,16.Key words : Pentagamavunon-0, Glutathione S-transferase, 1-chloro-2,4-dinitro benzene
Analgesic and anti-inflammatory activities of combrang (Nicolaia speciosaHoran) stem the extract Susilowati, Sri Sutji; Martono, Sudibyo; Riyanto, Sugeng; Nugroho, Agung Endro
Indonesian Journal of Pharmacy Vol 22 No 2, 2011
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (184.077 KB) | DOI: 10.14499/indonesianjpharm0iss0pp115-119

Abstract

Long-term  goal  of  this  study  is  the  use  of  combrang  (Nicolaia  speciosa Horan)  as  an  ingredient  of  traditional  medicine  after  being  evaluated  through preclinical  testing  and  clinical  trials  both  extract  and  its  bioactive  compounds. This  study  includes  analgesic-antiinflammatory  activity  test  of  n-hexane, chloroform,  ethyl  acetate  and  methanol  extract  of combrang stem.  Analgesic test against crude extract of n-hexane, chloroform,ethyl acetate and methanol, using acetate writhing method. Antiinflammatory test using inhibition method of paw oedema by carrageenan induced on Wistar rats. Analgesic-antiinflammatory activity  compared  to  Na-diclofenac.  The  result  is  four  extracts  have  analgesic and  antiinflammatory  activity,  ethyl  acetate  extract  has  the  highest  analgesic and antiinflammatory activity.Key words: analgesics, anti-inflammatory, extract of combrang stem
ANALYTICAL METHOD VALIDATION OF BENZENE USING HIGH PERFORMANCE LIQUID CHROMATOGRAPHY IN BEVERAGE CONTAINING SODIUM BENZOATE AND ASCORBIC ACID Melania Perwitasari; Endang Lukitaningsih; Sudibyo Martono
Jurnal Farmasi Sains dan Komunitas (Journal of Pharmaceutical Sciences and Community) Vol 11, No 1 (2014)
Publisher : Sanata Dharma University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (862.64 KB) | DOI: 10.24071/jpsc.0067

Abstract

Abstract: Several countries reported discovering benzene in beverages containing benzoic acidand ascorbic acid. Benzoic acid decarboxylation by ascorbic acid will form benzene. AmericanBeverage Association (ABA) recommended the use of accelerated testing to test benzene inbeverages. High Performance Liquid Chromatography (HPLC) is one of several methods toanalyze benzene in a wide variety of samples, but there is no much information providedregarding the validation of analysis method of benzene. Therefore, developing analysis methodof benzene and its validation becomes a current need. The HPLC system consists of Hitachi L-2130 pump, sample injector with 20 L sample loop, and UV detector L-2420 operating at 205nm. The analytical column is a LiChrosorb Phenomenex RP-18 (250 x 4 mm, 10 m, 100 ?), themobile phase is acetonitrile:aquabidest (60:40 v/v) and pumped at a flow rate of 0,8 mL/min.Benzene separated from the matrix and follows the validation requirements. The developedanalytical method showed that resolution was 8.37, r = 0.995 with LOD and LOQ 6.52 ppb and19.75 ppb, with a precise of ?11% and recovery of 80-110%. Accelerated testing indicated thatbenzene levels increased with increasing of the temperature. Beverages containing 400 mg/mL ofascorbic acid and benzoic acid formed benzene which was detected as 699.38 ppb at 25 oC,799.61 ppb at 40 oC, and 808.94 ppb at 60 oC in 48 hours. In conclusion, the method was fullyvalidated and can be utilized to analyze benzene in beverages with the accelerated testing at 60 oC in 48 hours, so that benefits the producers and consumers in the end.Keywords : benzene, HPLC, validation method, ascorbic acid, benzoic acid
FORMULASI MATRIKS TRANSDERMAL PENTAGAMAVUNON-0 DENGAN KOMBINASI POLIMER PVP K30 DAN HIDROKSIPROPIL METILSELULOSA Beti Pudyastuti; Akhmad Kharis Nugroho; Sudibyo Martono
Jurnal Farmasi Sains dan Komunitas (Journal of Pharmaceutical Sciences and Community) Vol 11, No 2 (2014)
Publisher : Sanata Dharma University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (315.292 KB) | DOI: 10.24071/jpsc.0099

Abstract

Abstract: Transdermal delivery system is one of the delivery system for Pentagamavunon-0 (PGV-0) toavoid the high intensity of first pass metabolism of PGV-0 in peroral route. The purpose of this researchwas to optimize the formula of PGV-0 transdermal matrix with a combination of PVP K30 and HPMCpolymers.The simplex lattice optimization approach of the transdermal matrix formulas was performed byusing Design Expert 7.1.5 software. The visual appearance, weight, thickness, moisture content, moistureuptake, folding endurance, drug content, and dissolution efficiency of the release profil of PGV-0 from thematrix for 6 hours were evaluated as responses to determine optimum formula of matrix. The resultshowed that a combination of PVP K30 and HPMC polymers had a significant influence on the visualappearance, moisture content, and dissolution efficiency of PGV-0. Combination of 1.98% of PVP K30and 4.52% of HPMC as the optimum formula could produce homogeneous and flexible matrix withmoisture content of 3.21%. The dissolution efficiency was 9.11%, indicating that 101.93 g of PGV-0 wasreleased from the optimum formula during 6 hours.Keywords : Pentagamavunon-0, Transdermal matrix, PVP K30, HPMC
PENGARUH PEMBERIAN PENTAGAMAVUNON-0 PADA AKTIVITAS GLUTATION-S-TRANSFERASE PADA HATI TIKUS SECARA IN VIVO Sudibyo Martono; Supardjan Amin M; Siti Zahliyatul Munawiroh
Jurnal Ilmiah Farmasi Vol. 1 No. 2 (2004)
Publisher : Universitas Islam Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRACTGlutathione S-transferase is amount of enzymes catalyze conjugation reac-tion of glutathione(GSH) with electrofilic endogen compound or electrofilic xenobiotic. At the particular cancer there isincreasing GST, especially on mu and phi class that it cause therapy on cancer cell by citostaticdrug (commonly as electrofilic compound) not effectively. Pentagamavunon-0 (PGV-0) is antiinflammationcompound. Base on in vivo research denoted this compound has five timesstrengthened than curcumin to inhibit GST enzyme activity. But using PGV-0 by in vivo to GSTactivity never report or publish yet.This research was done by measuring isolated GST enzyme activity from rat liver was given invivo PGV-0, with nine groups treatment. Each group consist of control group without treatment,control group CMC-Na 0.5 % per oral and intraperitoneal DMSO, group with doses treatment ofPGV-0 20, 40, 80 and 160 mg/Kg BB per oral, rat group was given benzo(a)pirene (BP) 1 mg/KgBB i.p. and group was given BP 1 mg/Kg BB i. p. and PGV-0 80 mg/Kg BB per oral. GST enzymeactivity is measured from reaction of conjugate GSH and DCNB that it’s absorption/minute. Base onrate (absorption/minute) GST enzyme activity can be accounted. Then inhibition percentage can beaccounted from each rat treatment compared with control without treatment and solvent control.Analyze use statistic test (Kruskal-Wallis then continued by Mann-Whitney test), to know specificdifferent of GST class mu enzyme activity in rat liver at each treatments group.Result research denoted that PGV-0 give inhibition effect to GST class mu activity of rat liver byin vivo. Doses level did not give proportional result to GST class mu activity of rat liver. Doses levelof PGV-0 give optimum result to GST class mu activity of rat liver inhibition at 80 mg/Kg BB withinhibition value 19,99 % compared with CMC-Na as solvent.Key word: pentagamavunon-0, in vivo, glutathione S-transferase, inhibition
Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B Nina Salamah; Yuny Erwanto; Sudibyo Martono; Abdul Rohman
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (6376.296 KB) | DOI: 10.12928/pharmaciana.v9i2.14070

Abstract

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.
Response Surface Methodology used in the Optimization of RP-HPLC Condition for Quantitative Analysis of Carmine and Rhodamine B Reyna Nuvitasari; Abdul Rohman; Sudibyo Martono
Indonesian Journal of Pharmacy Vol 30 No 4, 2019
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.14499/indonesianjpharm30iss4pp276

Abstract

The objective of this study was to optimize reversed-phase high-performance liquid chromatography (RP-HPLC) using an experimental design approach based on the response surface methodology of Central Composite Design (CCD) for separation and analysis of carmine (CAR) and Rhodamine B (RHO) in lipstick products. Some factors (independent variables) responsible for RP-HPLC separation including pH of buffer phosphate (X1), the acetonitrile ratio (X2), flow rate of mobile phase (X3), and column temperature (X4) were investigated. While, the responses (dependent variables) evaluated were resolution between CAR and RHO (Y1), tailing factor of CAR (Y2), tailing factor of RHO (Y3), retention time of CAR (Y4), retention time of RHO (Y5), peak area of CAR (Y6) and peak area of RHO (Y7). CCD showed that separation of CAR and RHO was influenced by these independent variables (factors). The optimum predicted conditions for the separation of CAR and RHO based on statistical results was pH buffer of 3.4, ACN 55%, the flow rate of 1.1 mL/min and column temperature of 35oC with the desirability of 1. Both CAR and RHO were clearly separated using optimum conditions, as suggested by CCD. The developed techniques were effective for optimizing chromatographic separation, therefore, the time consumption and a large number of running could be hindered.
Co-Authors . Sugiyanto A. Margono, Supardjan Abdul Rohman Abdul Rohman Achmad Fudholi Achmad Fudholi Agung Endro Nugroho Agus Siswanto Agus Siswanto Agustinus Yuswanto, Agustinus Akhmad Kharis Nugroho Anak Agung Istri Sri Wiadnyani Any Guntarti Beti Pudyastuti Endang Lukitaningsih Etty Sulistyowati Harsini Harsini ,, Harsini I Dewa Gde Mayun Permana Iwa Sutardja, Iwa Iwa Sutardjo Iwa Sutardjo, Iwa Marchaban Marchaban, Marchaban Marchaban, . Marchaban, . Melania Perwitasari, Melania Mimiek Murrukmihadi Mochammad Imron Awalludin Nina Salamah Nunung Yuniarti Purwanto Purwanto Reyna Nuvitasari Ririn Sumiyani Riyanto, Sugeng Rohman, Abdul SATRIYAS ILYAS Siti Sunarintyas Siti Zahliyatul Munawiroh Subagus Wahyuono Sudarsono Sudarsono Sugeng Riyanto Supardjan A.M., Supardjan Supardjan Amin M Susilowati, Sri Sutji Wiranti Sri Rahayu Yuny Erwanto