Article Per Year (5 Year)
p-Index From 2021 - 2026
4.426
P-Index
This Author published in this journals
All Journal MANAJEMEN HUTAN TROPIKA Journal of Tropical Forest Management Natural Science: Journal of Science and Technology Journal of Tropical Life Science : International Journal of Theoretical, Experimental, and Applied Life Sciences Biota: Jurnal Ilmiah Ilmu-Ilmu Hayati KUKILA JTSL (Jurnal Tanah dan Sumberdaya Lahan) Jurnal Biologi Universitas Andalas BioCONCETTA ZOO INDONESIA Jurnal Biologi Tropis JURNAL EDUCATION AND DEVELOPMENT Jurnal Kelautan Nasional AL-HAYAT: Journal of Biology and Applied Biology EKOLOGIA : Jurnal Ilmiah Ilmu Dasar dan Lingkungan Hidup Menara Ilmu Jurnal Pembangunan Nagari Jurnal Pembelajaran dan Biologi Nukleus Sainstek : Jurnal Sains dan Teknologi Jurnal Sosiologi Andalas Jurnal Pengabdian kepada Masyarakat Nusantara Zoo Indonesia Dinamika Lingkungan Indonesia International Journal of Science and Society (IJSOC) Buletin Dharmas Andalas Biodiversitas Journal of Biological Diversity
Wilson Novarino
Andalas University
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Public Health Social Sciences Other

Published : 68 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 68 Documents
Search

 3   4   5   6   7 
Bird Diversity and its Potential for Tourism Activities in Mangrove Areas, Carocok Anau, West Sumatra, Indonesia Khairini, Ridha; Mukhtar, Erizal; Novarino, Wilson
Jurnal Biologi Tropis Vol. 24 No. 4 (2024): Oktober - Desember
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v24i4.7611

Abstract

Avitourism is activity that utilizes bird diversity in economic aspect that provides benefits for conservation and economic improvement. Mangrove ecosystem in Carocok Anau located in tourist area that has high potential to diversity of bird species. Data related to bird diversity and potential in tourism activities have not been conducted. This study aims to analyze bird diversity and its potential in tourism activities in Carocok Anau mangrove ecosystem area. This research was carried out from February until April 2024. The method used is the point count method. Data collection is species and numbers of bird species was carried out at 15 observation points. The distance of each points was 150 meters with 50 meters of radius observation. Data collection in 10 minutes of each point. Observation was conducted during four days, and continued by bird species identification. Data analysis used is Shannon Wiener diversity index, evenness index and richness index. The results found 40 bird species with 1023 individu. Dominated by family of E strildidae and species of Collocalia esculenta. The diversity index value of 2.51 included in medium diversity category. 0.68 for evenness index value with uneven category and 5.63 for richness index with high species richness category. Birds with ecotourism attractions found are three types of raptors, one endemic, 13 protected bird, there are eight bird with attractive feather colors and 20 bird with beautiful voices, so that the Carocok Anau mangrove ecosystem area has capability to avitourism activity.
Bird Diversity and its Potential for Tourism Activities In Mandeh Mangrove Forest, West Sumatra, Indonesia Novita, Aulya; Mukhta, Erizal; Novarino, Wilson
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8306

Abstract

Avitourism is a form of tourism that focuses on bird watching intheir natural habitat. The existence of mangrove forests is very important in anarea because it is a habitat for various types of wildlife, especially birds. Thisstudy aims to analyze bird diversity and its potential in tourism activities in theMandeh mangrove ecosystem area. This research was conducted fromFebruary to April 2024. The method used was the point count method. Datacollection of bird species and numbers was carried out at 15 observation points.The distance of each observation point is 150 meters with an observation radiusof 50 meters. Data collection was carried out for 10 minutes at each point.Observations were conducted for four days, and continued with bird speciesidentification. Data analysis used was Shannon Wiener diversity index,evenness index and richness index. The results found 32 bird species from 18families. Dominated by the Apodidae and Estrildidae families. The diversityindex value is 2.17 with moderate index criteria. evenness index 0.63 which isincluded in the uneven category and a wealth index of 4.96 with a high wealthcategory. Birds that have ecotourism attractions found are 1 type of endemicbird, not found raptor birds, 2 types of birds listed on the IUCN, 7 types ofmelodious sound birds and 16 types of beautiful feathers, so that the Mandehmangrove ecosystem area has potential.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Pelatihan Pembuatan Kain Eco-Print bagi Ibu PKK di Kelurahan Lubuk Begalung Nan XX r maliza, rita; Nazri Janra, Muhammad; Santoso, Putra; Idris, Muhamma; Nofrita, Nofrita; Novarino, Wilson; Herwina, Henny; Fadillah; Hamdi Ibrahim, Muhammad; Putri Pratama Elisa, Tasya; Aini, Wardahtul; Marchellino Irwan, Reziq; Afif, Muhammad; Ilham Samudra, Muhammad
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 5 No. 4 (2024): Jurnal Pengabdian kepada Masyarakat Nusantara (JPkMN) Edisi September - Desembe
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v5i4.4656

Abstract

Program Pengabdian kepada Masyarakat ini bertujuan untuk meningkatkan keterampilan Ibu-Ibu PKK di Kelurahan Lubuk Begalung Nan XX, Padang, dalam memanfaatkan pewarna alami dari daun mangga untuk menghasilkan kain eco-print yang ramah lingkungan. Permasalahan yang dihadapi adalah rendahnya pemanfaatan sumber daya lokal serta minimnya keterampilan ibu-ibu PKK dalam menghasilkan produk bernilai ekonomi. Kegiatan ini memberikan pelatihan dua teknik eco-print, yaitu teknik steam dan pounding, yang memungkinkan peserta menghasilkan motif kain alami menggunakan pewarna dari tanin daun mangga. Metode pelaksanaan meliputi penyuluhan dan praktik langsung, di mana peserta belajar membuat pola kain eco-print dengan memanfaatkan dedaunan dan bunga yang tersedia di lingkungan sekitar. Hasil kegiatan menunjukkan peningkatan pemahaman dan keterampilan peserta dalam eco-print, serta antusiasme untuk mengembangkan produk berbasis kerajinan ramah lingkungan. Pelatihan ini diharapkan dapat membuka peluang ekonomi baru bagi masyarakat dan mendukung pelestarian lingkungan melalui inovasi kerajinan berbahan alami.
Assessing Bird Diversity and Birdwatching Potential in the Area of Sungkai Green Park Ecotourism, Padang City Firjatullah, Fadhilah; Rizaldi, Rizaldi; Novarino, Wilson
Jurnal Biologi Universitas Andalas Vol 12 No 2 (2024)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.12.2.97-105.2024

Abstract

Kawasan Ekowisata Taman Hijau Sungkai (ESGP) memiliki berbagai jenis vegetasi yang berpotensi menjadi habitat bagi beragam spesies burung. Penelitian ini bertujuan untuk menilai keanekaragaman burung dan potensi pengembangan kegiatan pengamatan burung di kawasan ESGP. Inventarisasi spesies burung dan pengamatan karakteristik morfologi dilakukan melalui pengamatan langsung dan fotografi. Pengamatan dilakukan pada pagi dan sore hari dari Mei hingga Juni 2024 di sepanjang jalur pemantauan. Daftar MacKinnon 10 spesies digunakan untuk menghitung akumulasi spesies burung yang tercatat selama studi lapangan. Penelitian ini mengidentifikasi 52 spesies burung dari 25 famili dan 11 ordo, dengan total 893 penampakan selama 90 jam (9,92 individu/jam). Berdasarkan penilaian potensi pengamatan burung menggunakan kriteria status fisik, ekologi, dan konservasi, direkomendasikan sepuluh spesies burung sebagai target utama kegiatan pengamatan burung: Rangkong Karangan Karangan, Barbet Berwarna-warni, Elang Elang yang Dapat Diubah, Iora Biasa, Pelatuk Buff-rumped, Merpati Zamrud, Burung Matahari Tenggorokan Coklat, Burung Matahari Merah, Burung Matahari Polos, dan Jalak Glossy Asia. Temuan penelitian ini menunjukkan bahwa keanekaragaman spesies, daya tarik burung, dan status konservasi di kawasan ESGP dapat mendukung pengembangan kegiatan pengamatan burung
Pengelolaan Ekowisata Berbasis Konservasi Alam pada Kawasan Kandi sebagai Lokasi Pembangunan Taman Kehati Emil Salim Sawahlunto Hendrita, Juli; Helmi, Helmi; Novarino, Wilson
Jurnal Sosiologi Andalas Vol. 10 No. 1 (2024)
Publisher : Department of Sociology, Faculty of Social and Political Sciences, Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsa.10.1.30-41.2024

Abstract

Participatory management of conservation areas requires collaboration in management. Multistakeholder collaboration and community participation in conservation area management are essential in realising the awareness of each element involved. Kandi area is situated in Sawahlunto City. a former location of coal mining. After the close of the mining this area is used for a tourism destination with various attractions such as Kandi Fruit Park, Kandi Animal Park, Camping ground, Horse Racing Field, and Circuit. Taman Kehati Emil Salim Sawahlunto will also be built in this location with an area of 24 ha containing local biodiversity. The purpose of this study is to analyse engagement of multi-stakeholders, tourist perceptions and community participation in the Kandi area. The approach used in this research is mixed method with descriptive analysis. The respondents of this research were the Head of Destination Division of Sawahlunto City, Head of Tourism Objects Division of Kandi Area, and Head of UPTD Plant Nursery of Kandi Fruit Garden, tourists, and community. Data were collected by means of literature study, observation, pre-research, research, interviews and questionnaires. The results of the study are there is no engagement between stakeholders, because the tourist attraction is managed by the government of Sawahlunto City. however, Taman Kehati Emil Salim Sawahlunto involves multi-stakeholders. Then, tourists who visit are satisfied with the vast land, but tourists are unsatisfied with the sanitary of tourist attractions and incomplete tourist facilities. Community participation in the organization of biodiversity park management indicates that the surrounding community cares about nature conservation.
In-silico Design and Testing of Tetra-Primer Arms-PCR for SNPs-Based Identification of Sumatran Tiger (Panthera tigris sumatrae): ARMS-PCR SNP Identification of Sumatran Tiger Asrori, Ikrima; Novarino, Wilson; Tjong, Djong Hon; Roesma, Dewi Imelda
Journal of Tropical Life Science Vol. 16 No. 01 (2026)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/jtls.16.01.03

Abstract

The Sumatran tiger (Panthera tigris sumatrae) is a subspecies of tiger classified as critically endangered by the International Union for Conservation of Nature (IUCN) due to poaching and illegal trade. In the law enforcement process, it is very important to ensure that the sample is indeed from a Sumatran tiger. Seized samples from illegal trade cannot be identified based on their morphology because they have been degraded and processed into other forms. Previous studies have reported the use of molecular markers for Sumatran tiger identification, which involve lengthy procedures and analyses. Therefore, for a more effective identification process, faster and more accurate techniques are needed. This study aims to design tetra primers for the identification of Sumatran tiger subspecies, particularly from incomplete confiscated samples, using the Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR) technique based on Single Nucleotide Polymorphism (SNP) markers. The primers were designed using the Primer1 application and validated in silico with CloneManager and NCBI BLAST, as well as through direct testing on Sumatran tiger blood samples. The design results showed one pair of primers with optimal specifications, producing G allele fragments (452 bp), A allele fragments (408 bp), and internal control fragments (819 bp). Specificity testing results indicated that all samples were Sumatran tigers, with amplification bands at 452 bp and 819 bp. These results demonstrate that the developed tetra-primer ARMS-PCR assay provides a rapid and practical molecular approach for identifying Sumatran tiger samples, particularly for forensic verification of confiscated wildlife materials.
Implementasi Praktikum Biologi Berbasis Teknologi untuk Peningkatan Kompetensi Siswa dan Guru di SMU N 15 Padang Rita Maliza; Muhammad Idris; Ashrifurrahman Ashrifurrahman; Arthauly Yopita Sinurat; M.Nazri Janra; Nofrita Nofrita; Muhammad Syukri Fadil; Robby Jannatan; Mansyurdin Mansyurdin; Wilson Novarino; Kurniadi Ilham; Putra Santoso; Henny Herwina; Bramadi Arya; Tasya Putri Pratama Elisa; Reziq Marchellino Irwan
Buletin Dharmas Andalas Vol. 3 No. 1 (2026): Buletin Dharmas Andalas
Publisher : Departemen Budidaya Tanaman Perkebunan, Fakultas Pertanian, Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/bda.v3i1.60

Abstract

This community service activity was conducted on October 27, 2025, at SMA Negeri 15 Padang, with the aim of enhancing the competencies of teachers and students in biotechnology through the integration of modern technology as part of the digital transformation of education. The methods employed included direct training and mentoring, supported by a guidebook entitled “Basic Biology and Biotechnology: From Microscope to DNA.” The activity was organized into several thematic groups, namely plant and animal tissue histology, animal anatomy, plant culture, and DNA isolation. The results demonstrated a significant improvement in participants’ abilities to operate basic biotechnology tools, understand applied biotechnology concepts, and develop innovative practicum activities aligned with the Merdeka Curriculum. In addition, this activity strengthened collaboration among schools, universities, and media in disseminating science learning innovations. In conclusion, the implementation of technology-based biology practicum is effective in improving participants’ competencies and scientific literacy and has strong potential for sustainable development through continued mentoring and the development of digital modules.
Alopecia in Bats from Tropical Urban Islands Fauziah Syamsi; Wilson Novarino; Dahelmi Dahelmi; Chairul Chairul
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7188

Abstract

Background: Alopecia or alopecic syndrome is a hair loss condition on the body. Alopecia is caused by a wide variety of factors both internal to the individual (i.e. androgen activity, nutritional deficiencies, metabolic stress, hormonal imbalances) and external (i.e. human-induced pressures, allergens, ectoparasites, fungal dermatitis, bacterial, toxicities, environmental contaminant exposure, idiopathic disease, poor habitat conditions, anthropogenic activities, zinc deficiency, and ingestion of plant toxins). Methods: This study was conducted at four locations in Batam City, consisting of two fragmented forests in the city center and two islands far from the city area. Bats were captured using mist nets and harp traps with a total sampling effort of 120 net nights and 120 harp trap nights. Findings: This study captured 417 bats across seven species, with an overall alopecia prevalence of 10.79 %. The highest prevalence was found in Pipistrellus tenuis (100%), Kerivoula pellucida (50 %), and Macroglossus minimus (20 %), likely due to the small sample sizes of these species. Larger sample sizes resulted in lower prevalence rates: Balionycteris maculata (22.2 %), Cynopterus horsfieldii (11.1 %), C. brachyotis (9.2 %), and C. sphinx (6.86 %). The most severe hair loss generally occurs on the shoulders and neck. Some individuals show hair loss on the back, head, chest, abdomen, and other parts of the body. Alopecia is found in both males and females from mild to severe. The prevalence of alopecia in all species was higher in fragmented forests in urban to periurban, and rural areas. This was associated with differences in the level of anthropogenic pressure. Contribution: These findings provide a scientific contribution to understanding the relationship between alopecia in bats and anthropogenic pressures and highlight the importance of habitat conditions in population health in fragmented environments.
Short Communication: Activity budget and diet in silvery lutung Trachypithecus cristatus at Gunung Padang, West Sumatra, Indonesia MUHAMMAD AZHARI AKBAR; RIZALDI RIZALDI; WILSON NOVARINO; DYAH PERWITASARI-FARAJALLAH; YAMATO TSUJI
Biodiversitas Journal of Biological Diversity Vol. 20 No. 3 (2019)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d200315

Abstract

Abstract. Akbar MA, Rizaldi, Novarino W, Perwitasari-Farajallah D, Tsuji Y. 2019. Activity budget and diet in silvery lutung Trachypithecus cristatus at Gunung Padang, West Sumatra, Indonesia. Biodiversitas 20: 719-724. We studied the activity budget and diet of a group of wild silvery lutungs (Trachypithecus cristatus) in Gunung Padang, West Sumatra, Indonesia, with special attention to age-and sex-related differences. We conducted behavioral observations between July and October 2016, and found that resting constituted the greatest proportion of their daily activities (46%), followed by moving (38%), feeding (12%), and grooming (4%). Resting peaked between 11 am and 1 pm, while moving decreased in this period. The juveniles showed higher percentage of moving and lower percentage of feeding than the adults. The adult males showed higher percentage of grooming than the adult females. Finally, the nursing females showed lower percentage of resting and higher percentage of grooming than single females. During the study, we recorded 14 plant species consumed by the lutungs. Their dietary composition was composed of 63% foliage and 37% fruit. Both the foliage and fruits of Ficus variegata, a plant species belonging to the family Moraceae, was the most consumed. Foliage was frequently consumed by the nursing females and juveniles. The adult males were frequently observed to eat fruit during the study period. No fruit was consumed by the nursing females.
Co-Authors - Fitri - Junaidi - Rizaldi . Merry Aadrean Aadrean Aadrean Abda Abda Agung Nugroho Ahmad Rizaldy Fanbudy Aini, Wardahtul Ainul Mardiah Aldino Fauzil Fanani Anas Salsabila Anas Salsabila Ani Mardiastuti Antika Fardilla Aprizal Aprizal Aprizon Putra Arba, Risqi Mutia Ardinis Arbain Arthauly Yopita Sinurat Arum Setiawan Asferi Ardiyanto Asferi Ardiyanto Asful, Ferdhinal Ashrifurrahman Ashrifurrahman Ashrifurrahman, Ashrifurrahman Asrori, Ikrima Astuti Astuti Aszareta, Muhammad Andoni Aulia Rizky Aurora, Dhea Apriano Ayu Andira AYU SMARNIA PUTRI Aziz, M. Abdul Baqi, Ahmad Iqbal Boby Hariadi Boby Hariadi Bramadi Arya Chairul Cynthia Ericca Dahelmi Dahelmi Damanhuri, Harfiandri Dedi Hermon Dewi Chandrarini Surya Dewi Imelda Roesma Diana Sari Diana Sari Diana Sari Djong Hon Tjong DYAH PERWITASARI-FARAJALLAH Efrita Ruswenti Efrizal Efrizal Elsa Yolarita Erik Marlius Erizal Mukhtar Eti Yerizel fachrul reza, fachrul Fadil, Muhammad Syukri Fadillah Fardilla, Antika Farid Azel Fauri Yatul Irfan Yanti FAUZIAH SYAMSI Fauziah Syamsi Fikri, Husnul Fikriya - Rahma Firjatullah, Fadhilah Firly Widuri Gita Herliza Sari Hadi Addaha, Hadi Hadi Kurniawan Hamdi Ibrahim, Muhammad Hanif Fadly Helmi Helmi Hendra, Jon hendrita, juli Henny Herwina Hiroshi Kobayashi Idris, Muhamma IKRIMA ASRORI IKRIMA ASRORI Ilham Samudra, Muhammad Inda Dwi Solina Inda Dwi Solina Indang Dewata Indra Junaidi Zakaria Indra Junaidi Zakaria, Indra Irvan Fadli Wanda Jabang Nurdin Janra, M. Nazri Janra, Muhammad Nazri Jarulis . Jarulis Jarulis Jarulis Jarulis Kamilah, Santi N Karmelia Kontesa Kevin Origia Kevin Origia Khairini, Ridha Kurniadi Ilham Laksono Trisnantoro Lilik B. Prasetyo Lilik B. Prasetyo Lintang Yodhy M. Nazri Janra M. Silmi M. Syafrie M.Nazri Janra Mahdi Mahdi Mahdi Mahdi Mahfud Huda Maliza, Rita Mansyurdin Marchellino Irwan, Reziq Muhammad Afif MUHAMMAD AZHARI AKBAR Muhammad Idris Muhammad Idris Muhammad Silmi Mukhta, Erizal Nazri Janra, Muhammad Nindy Ladyfandela Nofrita Nofrita Nofrita Nofrita Nova Adri Yanti Novita, Aulya Nur Halimah Rangkuti Nur Insani PATRICK FLAGGELLATA Pratama Elisa, Tasya Putri Pratama, Raihan Anugrah Putra Santoso PUTRI LISYA ANGGRAINI Putri Pratama Elisa, Tasya Putri, Syntia Mai Rahmi Fitri Ratna Juwita T Reviany Widjakusuma Reziq Marchellino Irwan Richard Noske Richard Noske Ridho, Muhammad Syifa'ur Rifta Septiavi Risqi Mutia Arba Risqi Mutia Arba Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi, . Rizaldi, Rizaldi Rizka Sefmaliza Robby Jannatan RUSDIYAN RITONGA Rusdiyan p. Ritonga Santi N Kamilah SARUEDI SIMAMORA Semeidi Husrin Silmi, M. Sinurat, Arthauly Yopita Sugeng Santoso Suparno . Syafrie, M. SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah Tasya Putri Pratama Elisa Taufiq Afdhal Tjong, Tjong Hon Tofrizal, Alimuddin Tomi Kasayev Try Al Tanto Uswatul Hasana Utami, Radila Widjakusuma, Reviany Widodo, Febri Anggriawan YAMATO TSUJI Yeni A. Mulyani YOLI ZULFANEDI Yunila Berliana Yusni Handayani Zaini Zaini Zettyra Sandova