Claim Missing Document
Check
Articles

Species Distribution Modelling on Long-tailed Macaque (Macaca fascicularis) in Padang, West Sumatra Utami, Radila; Novarino, Wilson; Rizaldi, Rizaldi
Jurnal Biologi Universitas Andalas Vol 13 No 01 (2025)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.13.01.14-21.2025

Abstract

Human activity is a major factor in the decline of primate biodiversity, including long-tailed macaques, which thrive in varied habitats, even near human settlements. This overlap can lead to conflicts for both humans and macaques. The objective of this study is to determine the distribution of long-tailed macaques through direct observation and potential distribution based on habitat suitability modelling using MaxEnt. Six environmental variables were selected based on the ecological traits of long-tailed macaques, including forest cover, population density, distance to roads, distance to forests, distance to conservation areas, and land use type. Moreover, 32 coordinate points were identified in Padang for locating long-tailed macaque and modelled using MaxEnt. The results indicate that long-tailed macaques are primarily distributed in areas with forest cover but are close to anthropogenic activities. The modelling reveals that the habitat suitability for this species in Padang tends to be low to moderate. The environmental variables that exert the most significant influence on their distribution are distance to roads and forest cover (53.3% and 20.1% respectively). Consequently, areas with a higher potential of habitat suitability required particular attention to manage conflicts and populations to avoid potential negative impacts that could arise.
Bird Diversity and its Potential for Tourism Activities in Mangrove Areas, Carocok Anau, West Sumatra, Indonesia Khairini, Ridha; Mukhtar, Erizal; Novarino, Wilson
Jurnal Biologi Tropis Vol. 24 No. 4 (2024): Oktober - Desember
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v24i4.7611

Abstract

Avitourism is activity that utilizes bird diversity in economic aspect that provides benefits for conservation and economic improvement. Mangrove ecosystem in Carocok Anau located in tourist area that has high potential to diversity of bird species. Data related to bird diversity and potential in tourism activities have not been conducted. This study aims to analyze bird diversity and its potential in tourism activities in Carocok Anau mangrove ecosystem area. This research was carried out from February until April 2024. The method used is the point count method. Data collection is species and numbers of bird species was carried out at 15 observation points. The distance of each points was 150 meters with 50 meters of radius observation. Data collection in 10 minutes of each point. Observation was conducted during four days, and continued by bird species identification. Data analysis used is Shannon Wiener diversity index, evenness index and richness index. The results found 40 bird species with 1023 individu. Dominated by family of E strildidae and species of Collocalia esculenta. The diversity index value of 2.51 included in medium diversity category. 0.68 for evenness index value with uneven category and 5.63 for richness index with high species richness category. Birds with ecotourism attractions found are three types of raptors, one endemic, 13 protected bird, there are eight bird with attractive feather colors and 20 bird with beautiful voices, so that the Carocok Anau mangrove ecosystem area has capability to avitourism activity.
Bird Diversity and its Potential for Tourism Activities In Mandeh Mangrove Forest, West Sumatra, Indonesia Novita, Aulya; Mukhta, Erizal; Novarino, Wilson
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8306

Abstract

Avitourism is a form of tourism that focuses on bird watching intheir natural habitat. The existence of mangrove forests is very important in anarea because it is a habitat for various types of wildlife, especially birds. Thisstudy aims to analyze bird diversity and its potential in tourism activities in theMandeh mangrove ecosystem area. This research was conducted fromFebruary to April 2024. The method used was the point count method. Datacollection of bird species and numbers was carried out at 15 observation points.The distance of each observation point is 150 meters with an observation radiusof 50 meters. Data collection was carried out for 10 minutes at each point.Observations were conducted for four days, and continued with bird speciesidentification. Data analysis used was Shannon Wiener diversity index,evenness index and richness index. The results found 32 bird species from 18families. Dominated by the Apodidae and Estrildidae families. The diversityindex value is 2.17 with moderate index criteria. evenness index 0.63 which isincluded in the uneven category and a wealth index of 4.96 with a high wealthcategory. Birds that have ecotourism attractions found are 1 type of endemicbird, not found raptor birds, 2 types of birds listed on the IUCN, 7 types ofmelodious sound birds and 16 types of beautiful feathers, so that the Mandehmangrove ecosystem area has potential.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Pelatihan Pembuatan Kain Eco-Print bagi Ibu PKK di Kelurahan Lubuk Begalung Nan XX r maliza, rita; Nazri Janra, Muhammad; Santoso, Putra; Idris, Muhamma; Nofrita, Nofrita; Novarino, Wilson; Herwina, Henny; Fadillah; Hamdi Ibrahim, Muhammad; Putri Pratama Elisa, Tasya; Aini, Wardahtul; Marchellino Irwan, Reziq; Afif, Muhammad; Ilham Samudra, Muhammad
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 5 No. 4 (2024): Jurnal Pengabdian kepada Masyarakat Nusantara (JPkMN) Edisi September - Desembe
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v5i4.4656

Abstract

Program Pengabdian kepada Masyarakat ini bertujuan untuk meningkatkan keterampilan Ibu-Ibu PKK di Kelurahan Lubuk Begalung Nan XX, Padang, dalam memanfaatkan pewarna alami dari daun mangga untuk menghasilkan kain eco-print yang ramah lingkungan. Permasalahan yang dihadapi adalah rendahnya pemanfaatan sumber daya lokal serta minimnya keterampilan ibu-ibu PKK dalam menghasilkan produk bernilai ekonomi. Kegiatan ini memberikan pelatihan dua teknik eco-print, yaitu teknik steam dan pounding, yang memungkinkan peserta menghasilkan motif kain alami menggunakan pewarna dari tanin daun mangga. Metode pelaksanaan meliputi penyuluhan dan praktik langsung, di mana peserta belajar membuat pola kain eco-print dengan memanfaatkan dedaunan dan bunga yang tersedia di lingkungan sekitar. Hasil kegiatan menunjukkan peningkatan pemahaman dan keterampilan peserta dalam eco-print, serta antusiasme untuk mengembangkan produk berbasis kerajinan ramah lingkungan. Pelatihan ini diharapkan dapat membuka peluang ekonomi baru bagi masyarakat dan mendukung pelestarian lingkungan melalui inovasi kerajinan berbahan alami.
Assessing Bird Diversity and Birdwatching Potential in the Area of Sungkai Green Park Ecotourism, Padang City Firjatullah, Fadhilah; Rizaldi, Rizaldi; Novarino, Wilson
Jurnal Biologi Universitas Andalas Vol 12 No 2 (2024)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.12.2.97-105.2024

Abstract

Kawasan Ekowisata Taman Hijau Sungkai (ESGP) memiliki berbagai jenis vegetasi yang berpotensi menjadi habitat bagi beragam spesies burung. Penelitian ini bertujuan untuk menilai keanekaragaman burung dan potensi pengembangan kegiatan pengamatan burung di kawasan ESGP. Inventarisasi spesies burung dan pengamatan karakteristik morfologi dilakukan melalui pengamatan langsung dan fotografi. Pengamatan dilakukan pada pagi dan sore hari dari Mei hingga Juni 2024 di sepanjang jalur pemantauan. Daftar MacKinnon 10 spesies digunakan untuk menghitung akumulasi spesies burung yang tercatat selama studi lapangan. Penelitian ini mengidentifikasi 52 spesies burung dari 25 famili dan 11 ordo, dengan total 893 penampakan selama 90 jam (9,92 individu/jam). Berdasarkan penilaian potensi pengamatan burung menggunakan kriteria status fisik, ekologi, dan konservasi, direkomendasikan sepuluh spesies burung sebagai target utama kegiatan pengamatan burung: Rangkong Karangan Karangan, Barbet Berwarna-warni, Elang Elang yang Dapat Diubah, Iora Biasa, Pelatuk Buff-rumped, Merpati Zamrud, Burung Matahari Tenggorokan Coklat, Burung Matahari Merah, Burung Matahari Polos, dan Jalak Glossy Asia. Temuan penelitian ini menunjukkan bahwa keanekaragaman spesies, daya tarik burung, dan status konservasi di kawasan ESGP dapat mendukung pengembangan kegiatan pengamatan burung
Pengelolaan Ekowisata Berbasis Konservasi Alam pada Kawasan Kandi sebagai Lokasi Pembangunan Taman Kehati Emil Salim Sawahlunto Hendrita, Juli; Helmi, Helmi; Novarino, Wilson
Jurnal Sosiologi Andalas Vol. 10 No. 1 (2024)
Publisher : Department of Sociology, Faculty of Social and Political Sciences, Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsa.10.1.30-41.2024

Abstract

Participatory management of conservation areas requires collaboration in management. Multistakeholder collaboration and community participation in conservation area management are essential in realising the awareness of each element involved. Kandi area is situated in Sawahlunto City. a former location of coal mining. After the close of the mining this area is used for a tourism destination with various attractions such as Kandi Fruit Park, Kandi Animal Park, Camping ground, Horse Racing Field, and Circuit. Taman Kehati Emil Salim Sawahlunto will also be built in this location with an area of 24 ha containing local biodiversity. The purpose of this study is to analyse engagement of multi-stakeholders, tourist perceptions and community participation in the Kandi area. The approach used in this research is mixed method with descriptive analysis. The respondents of this research were the Head of Destination Division of Sawahlunto City, Head of Tourism Objects Division of Kandi Area, and Head of UPTD Plant Nursery of Kandi Fruit Garden, tourists, and community. Data were collected by means of literature study, observation, pre-research, research, interviews and questionnaires. The results of the study are there is no engagement between stakeholders, because the tourist attraction is managed by the government of Sawahlunto City. however, Taman Kehati Emil Salim Sawahlunto involves multi-stakeholders. Then, tourists who visit are satisfied with the vast land, but tourists are unsatisfied with the sanitary of tourist attractions and incomplete tourist facilities. Community participation in the organization of biodiversity park management indicates that the surrounding community cares about nature conservation.
In-silico Design and Testing of Tetra-Primer Arms-PCR for SNPs-Based Identification of Sumatran Tiger (Panthera tigris sumatrae): ARMS-PCR SNP Identification of Sumatran Tiger Asrori, Ikrima; Novarino, Wilson; Tjong, Djong Hon; Roesma, Dewi Imelda
Journal of Tropical Life Science Vol. 16 No. 01 (2026)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/jtls.16.01.03

Abstract

The Sumatran tiger (Panthera tigris sumatrae) is a subspecies of tiger classified as critically endangered by the International Union for Conservation of Nature (IUCN) due to poaching and illegal trade. In the law enforcement process, it is very important to ensure that the sample is indeed from a Sumatran tiger. Seized samples from illegal trade cannot be identified based on their morphology because they have been degraded and processed into other forms. Previous studies have reported the use of molecular markers for Sumatran tiger identification, which involve lengthy procedures and analyses. Therefore, for a more effective identification process, faster and more accurate techniques are needed. This study aims to design tetra primers for the identification of Sumatran tiger subspecies, particularly from incomplete confiscated samples, using the Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR) technique based on Single Nucleotide Polymorphism (SNP) markers. The primers were designed using the Primer1 application and validated in silico with CloneManager and NCBI BLAST, as well as through direct testing on Sumatran tiger blood samples. The design results showed one pair of primers with optimal specifications, producing G allele fragments (452 bp), A allele fragments (408 bp), and internal control fragments (819 bp). Specificity testing results indicated that all samples were Sumatran tigers, with amplification bands at 452 bp and 819 bp. These results demonstrate that the developed tetra-primer ARMS-PCR assay provides a rapid and practical molecular approach for identifying Sumatran tiger samples, particularly for forensic verification of confiscated wildlife materials.
Co-Authors - Fitri - Junaidi - Rizaldi . Mansyurdin . Merry Aadrean Aadrean Aadrean Abda Abda Agung Nugroho Ahmad Rizaldy Fanbudy Aini, Wardahtul Ainul Mardiah Aldino Fauzil Fanani Anas Salsabila Anas Salsabila Ani Mardiastuti Antika Fardilla Aprizon Putra Arba, Risqi Mutia Ardinis Arbain Arum Setiawan Asferi Ardiyanto Asferi Ardiyanto Asful, Ferdhinal Ashrifurrahman, Ashrifurrahman Asrori, Ikrima Aszareta, Muhammad Andoni Aurora, Dhea Apriano Ayu Andira Aziz, M. Abdul Baqi, Ahmad Iqbal Boby Hariadi Boby Hariadi Bramadi Arya Chairul Chairul Dahelmi Dahelmi Damanhuri, Harfiandri Dedi Hermon Dewi Chandrarini Surya Dewi Imelda Roesma Diana Sari Diana Sari Diana Sari Djong Hon Tjong Efrita Ruswenti Efrizal Efrizal Elsa Yolarita Erik Marlius Erizal Mukhtar Eti Yerizel fachrul reza, fachrul Fadillah Fardilla, Antika Farid Azel Fauziah Syamsi Fikri, Husnul Fikriya - Rahma Firjatullah, Fadhilah Fuji Astuti Febria Gita Herliza Sari Hadi Addaha, Hadi Hadi Kurniawan Hamdi Ibrahim, Muhammad Hanif Fadly Helmi Helmi Hendra, Jon hendrita, juli Henny Herwina Hiroshi Kobayashi Idris, Muhamma Ilham Samudra, Muhammad Inda Dwi Solina Indang Dewata Indra Junaidi Zakaria Indra Junaidi Zakaria, Indra Irvan Fadli Wanda Jabang Nurdin Janra, M. Nazri Janra, Muhammad Nazri Jarulis . Jarulis Jarulis Jarulis Jarulis Kamilah, Santi N Karmelia Kontesa Kevin Origia Kevin Origia Khairini, Ridha Laksono Trisnantoro Lilik B. Prasetyo Lilik B. Prasetyo Lintang Yodhy M. Nazri Janra M. Silmi M. Syafrie Mahdi Mahdi Mahdi Mahdi Mahfud Huda Maliza, Rita Marchellino Irwan, Reziq Muhammad Afif Muhammad Idris Muhammad Silmi Mukhta, Erizal Nazri Janra, Muhammad Nindy Ladyfandela Nofrita Nofrita Nova Adri Yanti Novita, Aulya Nur Halimah Rangkuti Nur Insani Pratama Elisa, Tasya Putri Pratama, Raihan Anugrah Putra Santoso Putri Pratama Elisa, Tasya Putri, Syntia Mai r maliza, rita Rahmi Fitri Ratna Juwita T Reviany Widjakusuma Richard Noske Richard Noske Ridho, Muhammad Syifa'ur Rifta Septiavi Risqi Mutia Arba Risqi Mutia Arba Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi, . Rizaldi, Rizaldi Rizka Sefmaliza Rusdiyan p. Ritonga Santi N Kamilah Semeidi Husrin Silmi, M. Sinurat, Arthauly Yopita Sugeng Santoso Suparno . Syafrie, M. Syaifullah Syaifullah Taufiq Afdhal Tjong, Tjong Hon Tofrizal, Alimuddin Tomi Kasayev Try Al Tanto Uswatul Hasana Utami, Radila Widjakusuma, Reviany Widodo, Febri Anggriawan Yeni A. Mulyani Yunila Berliana Yusni Handayani Zaini Zaini