Article Per Year (5 Year)
p-Index From 2021 - 2026
4.782
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Akuakultur Indonesia Indonesian Journal of Forestry Research Indonesian Journal of Pharmaceutical Science and Technology Agrokreatif Jurnal Ilmiah Pengabdian kepada Masyarakat Dinamisia: Jurnal Pengabdian Kepada Masyarakat Sains Natural: Journal of Biology and Chemistry Bina Hukum Lingkungan Jurnal Penelitian Sosial dan Ekonomi Kehutanan Journal of Science Innovare FITOFARMAKA: Jurnal Ilmiah Farmasi EKOLOGIA : Jurnal Ilmiah Ilmu Dasar dan Lingkungan Hidup Barometer Journal of Aquaculture and Fish Health Jurnal Pengabdian Kepada Masyarakat MEMBANGUN NEGERI Indonesian Journal of Applied Environmental Studies Journal of Tropical Biodiversity Bina Hukum Lingkungan Warta LPM Scientica: Jurnal Ilmiah Sains dan Teknologi BIODIVERS - BIOTROP Scientific Magazine Indonesian Journal of Forestry Research Jurnal Pengabdian Masyarakat Inovatif Jurnal Pengabdian Masyarakat Inovatif Nusantara Bioscience Indonesian Journal of Applied Environmental Studies
SATA YOSHIDA SRIE RAHAYU
Universitas Pakuan
Religion Agriculture, Biological Sciences & Forestry Humanities Automotive Engineering Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Energy Engineering Environmental Science Health Professions Immunology & microbiology Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Social Sciences Other

Published : 51 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 51 Documents
Search

 2   3   4   5   6 
Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis Sata Yoshida Srie Rahayu; Alya Fairuz Fikriyyani; Toto Hadiarto; Ren Fitriadi
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77996

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.
Co-Authors . Yulianita, . Adna Sumadikarta Alya Fairuz Fikriyyani Ambar Dwi Suseno Anisa, Dede Asep Hasbilah AZAHRA FADILA Azis Kemal Fauzie Bina Lohita Sari Boedi Rachman Boedi Rachman Dadang Edi Rochaedi Dewi Suryani Oktavia B Djarot, Prasetyorini Dolly Priatna Erni Rustiani Fawziah, Rieskha Febryan , Febryan Fietri Setiawati Sulaeman Herdiana Herdiana Ismanto Johan Iskandar Koko Komarudin Layung Paramesti Martha Lilik Sulastri MELTA RINI FAHMI Mira Miranti Mista, Efendi Moerfiah Namira, Raisa Nida Masyidatul Madyan Al-Adhari Nisvera, Mela Nyayu Siti Aminah Lily Elfrieda Pitra Panderi Ratna Wulandari Ren Fitriadi RIDWAN AFFANDI Rita Retnowati Rokhmad Khabibi Rosadi Rosadi Rosadi rosadi Rosadi Rosadi Rosi Purwaningsih Sa'i Hendri Yana Sanan Supriatna Siti Nazilah Sri Nuryati Sri Wahyuni Sri Wahyuni Sudrajat, Cecep Sudrajat, Cecep Supriatna, Sanan Surono, . Suryanto Suryanto Suryanto Suryanto Syamsul T r i a s t i n u r m i a t i n i n g s i h Tarmin Abdulghani TARUNI SRI PRAWAST MIEN KAOMINI ANY ARYANI DEDY DURYADI SOLIHIN Toto Hadiarto Tri Aminingsih Tri Aminingsih Tri Aminingsih Tri Saptari Haryani Triastinurmiatiningsih Trini Handayani usep suhendar Wahyu Prihatini Wahyu Prihatini Wahyu Wijanarko Wasmen Manalu Wida Riyanti Yossa Istiadi Yudi Prakasa Yuli Wahyuni Yuli Wahyuni Yulianita, Yulianita