Article Per Year (5 Year)
p-Index From 2021 - 2026
3.527
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Akuakultur Indonesia Indonesian Journal of Forestry Research Indonesian Journal of Pharmaceutical Science and Technology Agrokreatif Jurnal Ilmiah Pengabdian kepada Masyarakat Dinamisia: Jurnal Pengabdian Kepada Masyarakat Sains Natural: Journal of Biology and Chemistry Bina Hukum Lingkungan Jurnal Penelitian Sosial dan Ekonomi Kehutanan Journal of Science Innovare FITOFARMAKA: Jurnal Ilmiah Farmasi EKOLOGIA : Jurnal Ilmiah Ilmu Dasar dan Lingkungan Hidup Journal of Aquaculture and Fish Health Indonesian Journal of Applied Environmental Studies Journal of Tropical Biodiversity Bina Hukum Lingkungan Warta LPM Scientica: Jurnal Ilmiah Sains dan Teknologi BIODIVERS - BIOTROP Scientific Magazine Indonesian Journal of Forestry Research Jurnal Pengabdian Masyarakat Inovatif Jurnal Pengabdian Masyarakat Inovatif
SATA YOSHIDA SRIE RAHAYU
Program Studi Biologi, FMIPA, Universitas Pakuan
Religion Agriculture, Biological Sciences & Forestry Humanities Automotive Engineering Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Energy Engineering Environmental Science Health Professions Immunology & microbiology Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Social Sciences Other

Published : 41 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 41 Documents
Search

 1   2   3   4   5 
Training In Manufacturing Multipurpose Eco-Enzyme Liquids for Farmers Group Djarot, Prasetyorini; Triastinurmiatiningsih; Haryani, Tri Saptari; Prihatini, Wahyu; Moerfiah; Ismanto; Rahayu, Sata Yoshida Srie; Sudrajat, Cecep
Jurnal Pengabdian Masyarakat Inovatif Vol. 2 No. 1 (2024): JPMI (Jurnal Pengabdian Masyarakat Inovatif)
Publisher : Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Pakuan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33751/jpmi.v2i1.113

Abstract

Eco-enzyme is an active ingredient from organic waste that can be used for various daily purposes such as fertilizer, herbicide, cleaning fluid, and even medicine, this is because it contains Lactobacillus, Asotobacter xylinum, yeast fungi, and lactic acid bacteria, enzymes (such as protease, amylase, lipase), minerals, and secondary metabolites (such as polyphenols, alkaloids, antioxidants). By utilizing ecoenzymes optimally, it will support the use of household organic waste with an environmentally friendly concept. And this is also an effort to reduce disruption to the environment due to landfills, which can be done by utilizing household organic waste to make eco-enzymes. The aim of this service is to provide training in making eco-enzymes as a multi-purpose liquid which will have an impact on waste utilization. Organic which is oriented towards maintaining a clean environment. The first method used was socialization and continued with presentation of material about what eco-enzymes, why we need to develop them, how to make eco-enzymes and how to use them. The material was delivered through a presentation using a projector and the production was carried out by demonstrating how to make eco-enzymes. This activity was carried out by delivering presentation material about eco-enzymes. The training was carried out at the homes of Tanah Baru Village residents with the permission of the Village Head. The training participants were farmers of the Tanah Baru Subdistrict Farmers Group, totalling 20 people and several village officials.  The training was held on June 13 2022 which included counselling and demonstrations on making eco-enzyme solutions from fruit peels and vegetable waste. The training participants seemed very enthusiastic by asking questions and having lots of discussions about eco-enzymes and their uses, participants also actively participated in manufacturing activities.
Training In Manufacturing Multipurpose Eco-Enzyme Liquids for Farmers Group Djarot, Prasetyorini; Triastinurmiatiningsih; Haryani, Tri Saptari; Prihatini, Wahyu; Moerfiah; Ismanto; Rahayu, Sata Yoshida Srie; Sudrajat, Cecep
Jurnal Pengabdian Masyarakat Inovatif Vol. 2 No. 1 (2024): JPMI (Jurnal Pengabdian Masyarakat Inovatif)
Publisher : Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Pakuan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33751/jpmi.v2i1.113

Abstract

Eco-enzyme is an active ingredient from organic waste that can be used for various daily purposes such as fertilizer, herbicide, cleaning fluid, and even medicine, this is because it contains Lactobacillus, Asotobacter xylinum, yeast fungi, and lactic acid bacteria, enzymes (such as protease, amylase, lipase), minerals, and secondary metabolites (such as polyphenols, alkaloids, antioxidants). By utilizing ecoenzymes optimally, it will support the use of household organic waste with an environmentally friendly concept. And this is also an effort to reduce disruption to the environment due to landfills, which can be done by utilizing household organic waste to make eco-enzymes. The aim of this service is to provide training in making eco-enzymes as a multi-purpose liquid which will have an impact on waste utilization. Organic which is oriented towards maintaining a clean environment. The first method used was socialization and continued with presentation of material about what eco-enzymes, why we need to develop them, how to make eco-enzymes and how to use them. The material was delivered through a presentation using a projector and the production was carried out by demonstrating how to make eco-enzymes. This activity was carried out by delivering presentation material about eco-enzymes. The training was carried out at the homes of Tanah Baru Village residents with the permission of the Village Head. The training participants were farmers of the Tanah Baru Subdistrict Farmers Group, totalling 20 people and several village officials.  The training was held on June 13 2022 which included counselling and demonstrations on making eco-enzyme solutions from fruit peels and vegetable waste. The training participants seemed very enthusiastic by asking questions and having lots of discussions about eco-enzymes and their uses, participants also actively participated in manufacturing activities.
Harmonisasi Hukum Lingkungan dalam Pemanfaatan Refuse Derived Fuel untuk Transisi Energi untuk Net Zero 2060 Mista, Efendi; Wahyuni, Sri; Rahayu, Sata Yoshida Srie
Bina Hukum Lingkungan Vol. 10 No. 1 (2025): Bina Hukum Lingkungan, Volume 10, Nomor 1, Oktober 2025
Publisher : Asosiasi Pembina Hukum Lingkungan Indonesia (PHLI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24970/bhl.v10i1.481

Abstract

ABSTRAKPermasalahan pengelolaan sampah dan kebutuhan transisi energi menuju target Net Zero Emission 2060 menuntut adanya instrumen hukum yang jelas dan aplikatif. Salah satu terobosan yang berkembang di Indonesia adalah pemanfaatan Refuse Derived Fuel (RDF) pada industri semen sebagai alternatif pengganti energi fosil. Namun, kerangka regulasi yang ada masih menghadapi disharmoni, baik antar undang-undang maupun antara kewenangan lembaga, sehingga menciptakan ketidakpastian hukum. Penelitian ini bertujuan untuk menganalisis posisi RDF dalam sistem hukum lingkungan dan energi nasional, mengidentifikasi potensi konflik hukum, serta merumuskan rekomendasi kebijakan yang sesuai dengan prinsip hukum lingkungan berkelanjutan. Metode penelitian yang digunakan adalah pendekatan normatif-yuridis dengan analisis peraturan perundang-undangan, dokumen kebijakan, serta perbandingan praktik internasional. Penelitian ini juga memanfaatkan studi kasus aktual, termasuk praktik RDF di industri semen dan keterkaitannya dengan perdagangan karbon global. Hasil analisis menunjukkan bahwa RDF memiliki potensi strategis dalam menurunkan emisi industri semen dan mengurangi timbunan sampah, namun belum memperoleh pengakuan eksplisit dalam regulasi nasional. Kondisi ini mengakibatkan kontribusi RDF tidak tercatat dalam dokumen mitigasi resmi, serta menimbulkan potensi konflik hukum dalam skema perdagangan karbon. Perbandingan internasional memperlihatkan bahwa keberhasilan RDF sangat ditentukan oleh kepastian hukum, standar mutu, serta integrasi dengan kebijakan energi. Kesimpulannya, RDF dapat menjadi instrumen penting menuju transisi energi berkelanjutan, tetapi membutuhkan reformasi hukum yang lebih sistematis. Rekomendasi kebijakan meliputi penyusunan payung hukum RDF, harmonisasi regulasi, pengembangan standar mutu, insentif ekonomi, serta integrasi RDF ke dalam strategi Net Zero Emission 2060.Kata kunci: hukum lingkungan; net zero emission; perdagangan karbon, refuse derived fuel, tata kelola. ABSTRACTIndonesia faces intertwined challenges of waste management and energy transition in achieving its Net Zero Emission 2060 target. One emerging pathway is the use of Refuse Derived Fuel (RDF) in cement industries as a substitute for coal, simultaneously addressing solid waste accumulation and reducing greenhouse gas emissions. Yet, the current regulatory framework is fragmented, with overlapping mandates between waste and energy laws, creating significant legal uncertainty. This study analyzes the normative position of RDF within Indonesia’s legal system, identifies regulatory gaps, and proposes policy reforms consistent with sustainable environmental law. The research employs a normative-juridical method through statutory interpretation, supported by conceptual and comparative approaches. Relevant legislation, government regulations, and ministerial decrees were examined alongside international practices in the European Union and Japan. A case study of RDF application in corporate illustrates both opportunities and challenges in practice, particularly regarding supply continuity, quality standards, and contractual arrangements with local governments. The findings show RDF’s strategic potential in reducing cement industry emissions and minimizing landfill dependency, but its absence in national legislation prevents formal recognition in climate policy and creates ambiguity in carbon trading schemes. Comparative experiences reveal that RDF requires explicit regulation, standardized quality, and integration into national energy policy to be effective. This study concludes that RDF can serve as a vital instrument for Indonesia’s sustainable energy transition. Key recommendations include enacting specific RDF regulation, harmonizing cross-sectoral laws, establishing national standards, providing fiscal incentives, and integrating RDF into the Net Zero Emission 2060 roadmap.Keywords: carbon trading and legal conflict; energy transitio;, environmental law in Indonesia; net zero emission 2060 policy; refuse derived fuel; waste-to-energy governance.
Harmonisasi Hukum Lingkungan dalam Pemanfaatan Refuse Derived Fuel untuk Transisi Energi untuk Net Zero 2060 Mista, Efendi; Wahyuni, Sri; Rahayu, Sata Yoshida Srie
Bina Hukum Lingkungan Vol. 10 No. 1 (2025): Bina Hukum Lingkungan, Volume 10, Nomor 1, Oktober 2025
Publisher : Asosiasi Pembina Hukum Lingkungan Indonesia (PHLI)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24970/bhl.v10i1.481

Abstract

ABSTRAKPermasalahan pengelolaan sampah dan kebutuhan transisi energi menuju target Net Zero Emission 2060 menuntut adanya instrumen hukum yang jelas dan aplikatif. Salah satu terobosan yang berkembang di Indonesia adalah pemanfaatan Refuse Derived Fuel (RDF) pada industri semen sebagai alternatif pengganti energi fosil. Namun, kerangka regulasi yang ada masih menghadapi disharmoni, baik antar undang-undang maupun antara kewenangan lembaga, sehingga menciptakan ketidakpastian hukum. Penelitian ini bertujuan untuk menganalisis posisi RDF dalam sistem hukum lingkungan dan energi nasional, mengidentifikasi potensi konflik hukum, serta merumuskan rekomendasi kebijakan yang sesuai dengan prinsip hukum lingkungan berkelanjutan. Metode penelitian yang digunakan adalah pendekatan normatif-yuridis dengan analisis peraturan perundang-undangan, dokumen kebijakan, serta perbandingan praktik internasional. Penelitian ini juga memanfaatkan studi kasus aktual, termasuk praktik RDF di industri semen dan keterkaitannya dengan perdagangan karbon global. Hasil analisis menunjukkan bahwa RDF memiliki potensi strategis dalam menurunkan emisi industri semen dan mengurangi timbunan sampah, namun belum memperoleh pengakuan eksplisit dalam regulasi nasional. Kondisi ini mengakibatkan kontribusi RDF tidak tercatat dalam dokumen mitigasi resmi, serta menimbulkan potensi konflik hukum dalam skema perdagangan karbon. Perbandingan internasional memperlihatkan bahwa keberhasilan RDF sangat ditentukan oleh kepastian hukum, standar mutu, serta integrasi dengan kebijakan energi. Kesimpulannya, RDF dapat menjadi instrumen penting menuju transisi energi berkelanjutan, tetapi membutuhkan reformasi hukum yang lebih sistematis. Rekomendasi kebijakan meliputi penyusunan payung hukum RDF, harmonisasi regulasi, pengembangan standar mutu, insentif ekonomi, serta integrasi RDF ke dalam strategi Net Zero Emission 2060.Kata kunci: hukum lingkungan; net zero emission; perdagangan karbon, refuse derived fuel, tata kelola. ABSTRACTIndonesia faces intertwined challenges of waste management and energy transition in achieving its Net Zero Emission 2060 target. One emerging pathway is the use of Refuse Derived Fuel (RDF) in cement industries as a substitute for coal, simultaneously addressing solid waste accumulation and reducing greenhouse gas emissions. Yet, the current regulatory framework is fragmented, with overlapping mandates between waste and energy laws, creating significant legal uncertainty. This study analyzes the normative position of RDF within Indonesia’s legal system, identifies regulatory gaps, and proposes policy reforms consistent with sustainable environmental law. The research employs a normative-juridical method through statutory interpretation, supported by conceptual and comparative approaches. Relevant legislation, government regulations, and ministerial decrees were examined alongside international practices in the European Union and Japan. A case study of RDF application in corporate illustrates both opportunities and challenges in practice, particularly regarding supply continuity, quality standards, and contractual arrangements with local governments. The findings show RDF’s strategic potential in reducing cement industry emissions and minimizing landfill dependency, but its absence in national legislation prevents formal recognition in climate policy and creates ambiguity in carbon trading schemes. Comparative experiences reveal that RDF requires explicit regulation, standardized quality, and integration into national energy policy to be effective. This study concludes that RDF can serve as a vital instrument for Indonesia’s sustainable energy transition. Key recommendations include enacting specific RDF regulation, harmonizing cross-sectoral laws, establishing national standards, providing fiscal incentives, and integrating RDF into the Net Zero Emission 2060 roadmap.Keywords: carbon trading and legal conflict; energy transitio;, environmental law in Indonesia; net zero emission 2060 policy; refuse derived fuel; waste-to-energy governance.
Optimizing Public Health Services through the Implementation of IoT Sterilization and Water Purifier Technology at the Kemuning 1A Integrated Health Post in Sukamakmur Village, Ciomas, West Java: Optimalisasi Layanan Kesehatan Masyarakat melalui Implementasi Teknologi IoT Sterilization dan Water Purifier di Posyandu Kemuning 1A Desa Sukamakmur, Ciomas, Jawa Barat Nyayu Siti Aminah Lily Elfrieda; Sata Yoshida Srie Rahayu; Johan Iskandar; Yuli Wahyuni
Dinamisia : Jurnal Pengabdian Kepada Masyarakat Vol. 9 No. 5 (2025): Dinamisia: Jurnal Pengabdian Kepada Masyarakat
Publisher : Universitas Lancang Kuning

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31849/

Abstract

The people of Sukamakmur Village, Ciomas, West Java, face limited access to health care and clean water. This problem has resulted in a decreased quality of life, increased risk of water-based diseases, and low public understanding of clean and healthy lifestyles. This community service program attempts to provide solutions through the implementation of IoT Sterilization and Water Purifier technology at the Kemuning 1A Integrated Health Post (Posyandu). The goal is to improve Posyandu health services, ensure the availability of clean drinking water, and empower Posyandu cadres to be independent in the use and maintenance of technology. This is in line with SDG 3 (Healthy and Prosperous Life) and SDG 6 (Clean Water and Adequate Sanitation) through training and mentoring activities on the use of IoT Sterilization and Water Purifier devices, as well as socialization and counseling on healthy lifestyles and the importance of clean drinking water to support the realization of a healthy and prosperous life. The activity methods include socialization, cadre training, mentoring on the use of tools, technology application, and program evaluation and replication. In terms of increasing community knowledge through the transfer of IoT Sterilization technology to sterilize and kill microbes, positive behavioral changes in water use and management, the community's ability to operate and maintain equipment independently, and cadres acting as health education facilitators, the empowerment of partners in the social aspect of the community has increased from 20% to 80%. Meanwhile, in terms of improving management capabilities, this is reflected in the availability of clean water access directly at the Integrated Health Post (Posyandu), the development of documentation and program models that can be adapted by other Posyandus, resulting in an increase in partner empowerment in the management aspect from 35% to 85%.
EVALUATION OF THE IMPLEMENTATION OF THE MINING SAFETY MANAGEMENT SYSTEM (SMKP) AT PT INDODRILL SITE TUJUH BUKIT OPERATION BANYUWANGI IN 2022 Wahyu Wijanarko; Rita Retnowati; Sata Yoshida Srie Rahayu
Scientica: Jurnal Ilmiah Sains dan Teknologi Vol. 2 No. 2 (2024): Scientica: Jurnal Ilmiah Sains dan Teknologi
Publisher : Komunitas Menulis dan Meneliti (Kolibi)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.572349/scientica.v2i2.950

Abstract

Penelitian ini bertujuan untuk mengevaluasi penerapan Sistem Manajemen Keselamatan Pertambangan (SMKP) di PT Indodrill Indonesia Site Tujuh Bukit Operation Banyuwangi pada tahun 2022. Tujuan penelitian mencakup pemahaman kontek kebijakan dan perencanaan, analisis input terkait organisasi dan personel, evaluasi proses implementasi, dan penilaian produk serta tindak lanjutnya. Metode penelitian ini menggunakan pendekatan evaluasi CIPP (Context, Input, Process, Product), dengan desain evaluatif untuk memperoleh data dan informasi guna mengambil keputusan terhadap program SMKP yang ada. Hasil penelitian menunjukkan bahwa konteks program SMKP PT. Indodrill Indonesia dapat dinilai sebagai sangat baik, dengan latar belakang program sesuai dengan kebijakan Ditjen Minerba Kementrian ESDM dan pencapaian kinerja keselamatan yang positif. Namun, evaluasi input program SMKP termasuk dalam kategori cukup, terutama terkait dengan perluasan dan penyesuaian struktur organisasi site dalam struktur organisasi Head Office serta kebutuhan sumber daya manusia yang perlu ditambah. Evaluasi Proses Program SMKP juga dinilai Cukup, dengan kesesuaian perencanaan dan pelaksanaan yang sesuai, namun perlu perhatian terhadap faktor penghambat dan upaya pencegahan. Sementara itu, evaluasi produk program SMKP di PT. Indodrill dinilai Cukup, PT. Indodrill Indonesia sudah melaksanakan Audit SMKP namun tindak lanjut belum konsisten dilakukan dan dimonitoring. Dampak penerapan SMKP belum memberikan efek signifikan terhadap penurunan kecelakaan dan peningkatan budaya keselamatan. Keterbatasan SDM di bidang EHS Sistem dan monitoring yang tidak dilakukan menjadikan SMKP belum begitu memberikan pengaruh yang signifikan. Dampak positif dari penerapan SMKP dirasakan oleh PT. Indodrill Indonesia, dengan dukungan eksternal dari pemerintah, badan regulasi, asosiasi, organisasi, media, dan LSM. Kesimpulannya, meskipun terdapat beberapa aspek yang perlu diperbaiki dan disesuaikan, penerapan SMKP di PT Indodrill Indonesia Site Tujuh Bukit Operation Banyuwangi pada tahun 2022 memberikan kontribusi positif terhadap keselamatan pertambangan dan mendapatkan dukungan luas dari berbagai pihak eksternal.
Habitat and Nest Characteristics of Javan Hawk-eagle (Nisaetus bartelsi Stresemann 1924) in Gunung Salak 1 Resort Area of Gunung Halimun Salak National Park Febryan , Febryan; Prihatini, Wahyu; Rahayu, Sata Yoshida Srie
Journal of Tropical Biodiversity Vol 4 No 3 (2024): August 2024
Publisher : Universitas Nasional Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59689/bio.v4i3.234

Abstract

The Javan Hawk-eagle Nisaetus bartelsi is a protected bird of prey endemic to Java Island and is one of Indonesia's mascot fauna. The survival of this species in nature is threatened, among others due to habitat degradation, and land use change around its habitat. This study was conducted to analyze the presence and characteristics of nests and the habitat around Javan eagle nests in the Gunung Salak 1 Resort area within the Gunung Halimun Salak National Park. The research was conducted using the Direct Observation method, with parameters namely characteristics of nest trees, and nests, as well as biotic and abiotic environments around Javan eagle nests. The results found the presence of active Javan eagle nests in the Hameurang Valley block in the Sintok area, and the Curug Cibadak block in the Loji area. The nest in Sintok was found in a beunying tree (Ficus fistulosa) in a natural forest, at 1,097 m above sea level. Nests in Loji were found in rasamala (Altingia excelsa) trees in the natural forest, at 1,347 m asl. The nest is located at the height of 15-22 m from the ground, round in shape, the nest material is epiphytic plants, branches of puspa (Schima wallichii), rasamala (Altingia excelsa), and manii (Maesopsis eminii). The plant around the nest with the highest INP in Sintok is the manii tree (Maeopsis emini), while in Loji it is the seuhang tree (Ficus grossulariodes).
MANAGEMENT STRATEGY OF ELEPHANT RIDING AT THE ZOO Yoshida Srie Rahayu, Sata; Priatna, Dolly; Rosadi, Rosadi; Suryanto, Suryanto
Indonesian Journal of Forestry Research Vol. 9 No. 1 (2022): Indonesian Journal of Forestry Research
Publisher : Association of Indonesian Forestry and Environment Researchers and Technicians

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59465/ijfr.2022.9.1.29-47

Abstract

Elephant Riding (ER) in zoos has become a matter of public interest, raising debates among experts regarding animal ethics, elephants’ welfare, and human safety. Through the submission of the Middle Hypothesis that ER tends to enhance human knowledge about conservation, this study’s aim is to provide strategies to help zoo managements in their works based on the basic principles of wildlife conservation and protection, especially Sumatran elephants. The participants’ knowledge was measured using questionnaires distributed to two groups of respondents: people who have and people who have not utilized ER services. Meanwhile, the strategy was recommended through the Analytical Hierarchy Process of 17 expert respondents. According to the independent sample t-test performed with 95% confidence level, human knowledge of elephant conservation increased significantly through ER. Furthermore, experts with consistency ratios (CR) ≤ 0.1 selected a strategy where environmental quality was prioritized as a recommended strategy in ER management. This strategy is to put forward the principles guaranteeing the elephants’ welfare, which has a criterion weight of 0.40717. The other recommended strategies include conducting conservation education (0.23973), ensuring the safety of visitors (0.22972), and improving the welfare of the community around zoo (0.12338).
Hematology profile of kissing gourami Helostoma temminckii infected with Aeromonas hydrophila bacteria Sumadikarta, Adna; Yoshida Srie Rahayu, Sata; Nuryati, Sri
Jurnal Akuakultur Indonesia Vol. 25 No. 1 (2026): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19027/jai.25.1.129-137

Abstract

The kissing gourami (Helostoma temminckii) is an important commodity in aquaculture, but its susceptibility to bacterial infections such as Aeromonas hydrophila can hinder production. This study aims to investigate the hematological profile of kissing gourami (Helostoma temminckii) with an average length of 8.00 ± 1.00 cm and weight of 10.00 ± 1.00 g, following intramuscular injection of Aeromonas hydrophila at a dose of 10⁶ CFU/mL.Evaluations were conducted on survival rate, hematological parameters such as total erythrocytes, total leukocytes, hemoglobin levels, and hematocrit, as well as phagocytic activity, respiratory burst, and lysozyme activity. Infection with A. hydrophila caused a decrease in erythrocytes and hemoglobin, and an increase in leukocytes, phagocytic activity, respiratory burst, and lysozyme activity. The survival rate dropped to 47.5% in the treatment group, while the control group showed 100% survival. The conclusion is, infection of Aeromonas hydrophila significantly affects the immune response of kissing gourami, characterized by an decrease in erythrocyte count and hemoglobin levels in the treatment group. However, phagocytic activity, respiratory burst, and lysozyme levels consistently decreased in infected fish. Keywords: Aeromonas hydrophila, hematology, kissing gourami, pathogenicity   Abstrak Ikan tambakan (Helostoma temminckii) merupakan komoditas penting dalam budidaya perikanan, namun kerentanannya terhadap infeksi bakteri seperti Aeromonas hydrophila dapat menghambat produksi. Penelitian ini bertujuan untuk mengkaji profil hematologi ikan tambakan (Helostoma temminckii) dengan panjang rata-rata 8,00 ± 1,00 cm dan bobot 10,00 ± 1,00 g setelah disuntik intramuskular Aeromonas hydrophila dengan dosis 10⁶ CFU/mL. Evaluasi dilakukan terhadap tingkat kelangsungan hidup, parameter hematologi seperti jumlah eritrosit total, leukosit total, kadar hemoglobin, dan hematokrit, serta aktivitas fagositosis, respiratory burst, dan aktivitas lisozim. Infeksi A. hydrophila menyebabkan penurunan jumlah eritrosit dan kadar hemoglobin, serta peningkatan jumlah leukosit, aktivitas fagositosis, respiratory burst, dan aktivitas lisozim. Tingkat kelangsungan hidup menurun menjadi 47,5% pada kelompok perlakuan, sedangkan kelompok kontrol menunjukkan kelangsungan hidup 100%. Kesimpulannya, infeksi Aeromonas hydrophila secara signifikan memengaruhi respons imun ikan kissing gourami, yang ditandai dengan penurunan jumlah eritrosit dan kadar hemoglobin, serta peningkatan aktivitas fagositosis, respiratory burst, dan kadar lisozim pada ikan yang terinfeksi. Kata kunci: Aeromonas hydrophila, hematologi, ikan tambakan, patogenisitas
Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis Rahayu, Sata Yoshida Srie; Fikriyyani, Alya Fairuz; Hadiarto, Toto; Fitriadi, Ren
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77996

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.
Co-Authors . Yulianita, . Anisa, Dede Asep Hasbilah Bina Lohita Sari Boedi Rachman Boedi Rachman Dadang Edi Rochaedi Dewi Suryani Oktavia B Djarot, Prasetyorini Dolly Priatna Erni Rustiani Fawziah, Rieskha Febryan , Febryan Fikriyyani, Alya Fairuz Fitriadi, Ren Hendri Yana, Sa'i Herdiana Herdiana Ismanto Johan Iskandar Koko Komarudin Layung Paramesti Martha Lilik Sulastri Mira Miranti Mista, Efendi Moerfiah Namira, Raisa Nazilah, Siti Nida Masyidatul Madyan Al-Adhari Nisvera, Mela Nyayu Siti Aminah Lily Elfrieda Ratna Wulandari RIDWAN AFFANDI Rita Retnowati Rokhmad Khabibi Rosadi Rosadi Rosadi rosadi Sanan Supriatna Setiawati Sulaeman, Fietri Sri Nuryati Sri Wahyuni Sudrajat, Cecep Sumadikarta, Adna Supriatna, Sanan Surono, . Suryanto Suryanto Suryanto Suryanto Tarmin Abdulghani TARUNI SRI PRAWAST MIEN KAOMINI ANY ARYANI DEDY DURYADI SOLIHIN Toto Hadiarto Tri Aminingsih Tri Aminingsih Tri Aminingsih Tri Saptari Haryani Triastinurmiatiningsih Trini Handayani usep suhendar Wahyu Prihatini Wahyu Prihatini Wahyu Wijanarko Wasmen Manalu Yossa Istiadi Yuli Wahyuni Yulianita, Yulianita