cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Syifania Hanifah Samara
Contact Email
jafh@fpk.unair.ac.id
Phone
-
Journal Mail Official
jafh@fpk.unair.ac.id
Editorial Address
-
Location
Kota surabaya,
Jawa timur
INDONESIA
Journal of Aquaculture and Fish Health
Published by Universitas Airlangga
ISSN : 23017309     EISSN : 25280864     DOI : -
Core Subject : Agriculture,
Agriculture, Biological Sciences & Forestry
The Journal of Aquaculture And Fish Health (JAFH) has an objective to publish and provide high-quality scientific contributions to the field of fisheries. These contributions came from innovative researches that encourage science and technology development in the field of fisheries and marine science on a national and international scale. This journal serves as a communication medium for researchers, academics, students, and communities.
Arjuna Subject : -
Articles 359 Documents
 32   33   34   35   36 
Comparative Analysis of the Efficacy of Bacillus subtilis and Lactoba-cillus acidophilus in Inhibiting Vibrio parahaemolyticus Infection in Black Tiger Shrimp (Penaeus monodon) Ery Gusman; Andini Aisyah Nur Raoda; Diana Maulianawati; Rukisah Rukisah; Zainuddin Zainuddin; Imra Imra
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.76562

Abstract

The application of probiotic bacteria in black tiger shrimp (Penaeus monodon) aquaculture constitutes a preventive strategy aimed at mitigating the risk of disease outbreaks. This study aims to compare the efficacy of Bacillus subtilis and Lactobacillus acidophilus in inhibiting Vibrio parahaemolyticus infection through both in vitro and in vivo evaluations. The research was conducted from January to March 2025 at the Fisheries Biology Laboratory, Faculty of Fisheries and Marine Science, Universitas Borneo Tarakan. This study used a Completely Randomized Design (CRD) with four treatments and three replicates each, namely Control (-) uninfected and without probiotics, Control (+) infected with V. parahaemolyticus at 104 CFU/mL without probiotics, Bs given B. subtilis at 108 CFU/mL and infected with V. parahaemolyticus at 104 CFU/mL, and La given L. acidophilus at 108 CFU/mL and infected with V. parahaemolyticus at 104 CFU/mL. Observed parameters included antibacterial inhibition, survival rate (SR), mortality pattern, mean time to death (MTD), relative percentage survival (RPS), bacterial population, clinical symptoms, and water quality. L. acidophilus demonstrated greater efficacy than B. subtilis in inhibiting V. parahaemolyticus infection in black tiger shrimp. The survival rate of shrimp treated with L. acidophilus reached 69.67%, whereas the group treated with B. subtilis exhibited a survival rate of 43.00%. Overall, the application of L. acidophilus consistently yielded superior survival outcomes compared to B. subtilis.
Relationship Between Nitrogenous Wastes, Organic Matter, Bacteri-al Abundance, and Protozoan Abundance in Whiteleg Shrimp Inten-sive Farming Ponds Diah Ayu Satyari Utami; Anik Kusmiatun; Ilham; Desy Febrianti; I Nyoman Sudiarsa; Mohsan Abrori; Andina Chairun Nisa; Annisa Khairani Aras; Diklawati Jatayu; Yasinta Ega Kaborang; I Gusti Ayu Budiadnyani; I Made Aditya Nugraha; Budi Rianto Wahidi; Wahyu
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77343

Abstract

Whiteleg shrimp (Litopenaeus vannamei) dominates global aquaculture production due to its adaptability to intensive systems. However, intensive systems often experience excess accumulation of nitrogenous waste and total organic matter (TOM), which can destabilize microbial communities and affect water quality. While protozoa are known as bioindicators, few studies have explored how their functional composition interacts with nitrogen cycling and production performance in shrimp ponds. This study investigated the relationships between nitrogenous compounds, TOM, bacterial and protozoan abundance in two intensive shrimp ponds (HP: high protozoan abundance and LP: low protozoan abundance). Water quality parameters, including Total Ammonia Nitrogen (TAN), nitrite, nitrate, TOM, and phosphate, were monitored weekly alongside microbial assessments of total bacterial count (TBC), total Vibrio count (TVC), and protozoa abundance. Protozoa were identified microscopically, while shrimp performance was measured by growth, feed conversion ratio (FCR), survival, and productivity. TOM emerged as the primary ecological driver, significantly correlating with Vibrio abundance (r = 0.585, p < 0.05). Although the high-protozoa pond featured greater bacterial biomass and more bacterivorous taxa (e.g., Ciliata, Vorticella), it had lower shrimp productivity. Conversely, the low-protozoa pond dominated by detritivores (Euplotes, Strombidionopsis) achieved superior growth, FCR, and final biomass, despite higher TOM and nitrite levels. These findings suggest that protozoan functional composition, rather than total abundance, critically influences nutrient cycling, microbial stability, and production outcomes. Managing TOM and fostering beneficial microbial loops are essential strategies for sustainable shrimp farming.
Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis Sata Yoshida Srie Rahayu; Alya Fairuz Fikriyyani; Toto Hadiarto; Ren Fitriadi
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77996

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.
The Growth Performance of Tilapia (Oreochromis sp.) using Different Doses of Organic Cooper (Cu–O) in the Diets Dedi Jusadi; Yessy Rahmayanti; Muhammad Raditya Gumelar; Talita Shofa Adestia; Muhammad Agus Suprayudi
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.78070

Abstract

Copper (Cu-O) is a micromineral required in small amounts in the body, yet it plays an important role in the metabolism and health of fish. This study aimed to evaluate the growth performance of tilapia (Oreochromis sp.) fed diets supplemented with organic copper (Cu-O). Four treatments were tested: K (control, without Cu-O), Cu-O 1 (1 mg kg⁻¹ Cu-O), Cu-O 2 (2 mg kg⁻¹ Cu-O), and Cu-O 3 (3 mg kg⁻¹ Cu-O). Fifteen tilapia with an average initial weight of 8.75 ± 0.02 g were reared in aquaria (60 × 50 × 40 cm, water depth 30 cm) for 60 days. Fish were fed to satiation three times daily. The results showed that the growth parameters of tilapia fed Cu-O-supplemented diets were significantly higher (P < 0.05) than those of the control. The optimal dose of Cu-O supplementation was found to be 2 mg kg⁻¹ feed; subsequent studies should investigate interspecies variations and refine dosage recommendations accordingly.
Effects of Water Quality on the Seasonal Variability of Gonadosomat-ic Index (GSI), Hepatosomatic Index (HSI), Stomach Repletion Index (SRI) and Condition Factor (K) of Clarias gariepinus and Oreo-chromis niloticus from River Ngadda, Borno State – Nigeria: Effect of Water Quality on Fish Health Mathias Bwala; Ezra Gaya; Ahmed Nayaya; Toma Buba
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.80544

Abstract

Environmental stressors such as water quality depletion, micro-(nano) plastics (MNPs), heavy metals, and endocrine-disrupting chemicals (EDC) may exert behavioral, developmental, physiological, and reproductive stress on organisms, particularly fish in the aquatic ecosystems. Ecotoxicological biomarkers such as the gonadosomatic index (GSI), hepatosomatic index (HSI), stomach repletion index (SRI), and condition factor (K) provide insights into the fish’s health, nutritional status, and reproductive dynamics. This study assessed the influence of water quality on GSI, HSI, SRI, and K in Clarias gariepinus and Oreochromis niloticus from River Ngadda, Maiduguri, Borno State, Nigeria, across dry and wet seasons. Results showed that all measured parameters were within the permissible limits of the National Environmental Standards & Regulations Enforcement Agency (NESREA) and the World Health Organization (WHO). During the dry season, pH ranged from 7.27 ± 0.24 to 7.71 ± 0.19, while TDS ranged from 179 ± 22.4 to 463 ± 287.5 ppm. Nitrate concentrations during the wet season ranged from 26.35 ± 7.04 to 29.80 ± 8.03 mg/L. Seasonal variations were observed in fish biomarkers, with male C. gariepinus exhibiting GSI values of 0.531 ± 0.5–4.428 ± 1.4 (wet season) and 0.919 ± 0.9–2.665 ± 0.3 (dry season). In O. niloticus, GSI of the females peaked during the dry season (10.542 ± 3.1–14.737 ± 4.4), while others also showed pronounced seasonal and species-specific patterns. Canonical correlation analysis revealed strong relationships (r > 0.90) between water quality variables and fish physiological and reproductive indexes, suggesting a strong relationship between water quality and the fish’s health.
In-vitro Assessment of Inhibitory Capacity of Selected Woody Herbs on Isolated Fish Pathogens: In-vitro Assessment of Inhibitory Capacity of Selected Woody Herbs on Isolated Fish Pathogens Abiola Fadilat Durojaiye; Silifat Adewunmi Olanloye; Musifat Abosede Kolapo
Journal of Aquaculture and Fish Health Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i2.63508

Abstract

This study investigated the antimicrobial activity of Uvaria chamae, Nauclea latifolia, Anogeissus leiocarpus, Perquetina nigrescens, and Enantia chlorantha against the selected fish pathogens. Fish were divided into five treatments with concentrations of 0 mg/L, 50 mg/L, 100 mg/L, 150 mg/L, and 250 mg/L of the plant extracts. Minimum inhibitory concentration (MIC) tests were employed to determine the lowest effective concentrations of these extracts. Results showed that the aqueous extracts of these phytobiotics demonstrated significant antimicrobial potential. Generally, the control consistently showed higher MIC values across all pathogens, except P. nigrescens. Notably, U. chamae exhibited the lowest MIC values against Proteus vulgaris and Klebsiella species at concentrations of 50 mg/L and 100 mg/L, respectively. A. leiocarpus also showed effectiveness against Proteus vulgaris at 100 mg/L, while P. nigrescens had an MIC of 100 mg/L against the same pathogen. E. chlorantha was effective against Proteus vulgaris at 50 mg/L and Staphylococcus saprophyticus at 100 mg/L. Overall, P. nigrescens emerged as a compelling candidate for integration into aquaculture practices, with evidence of its ability to combat bacterial infections effectively while E. chlorantha displayed broad-spectrum antimicrobial activity, indicating its potential as a preventative measure. This study highlights the requirement for further research into the phytochemical constituents of these phytobiotics to better understand their mechanisms of action. Additionally, investigating synergistic effects when combined with other phytobiotics may enhance their overall antimicrobial profiles.
Growth Performance of Gracilaria sp. in Relation to Nitrogen Uptake from Effluents of Shrimp Culture at Varying Stocking Densities: Growth Performance of Gracilaria sp. in Relation to Nitrogen Uptake from Effluents of Shrimp Culture at Varying Stocking Densities Restiana Wisnu Ariyati; Lestari Lakhsmi Widowati; Ichwanus Sofa Alkisai; sri Rejeki; Sarjito; Alfabetian Herjuno Condro Haditomo; Dicky Harwanto; Roel H. Bosma
Journal of Aquaculture and Fish Health Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i2.72377

Abstract

The growth performance of Gracilaria sp. is influenced by its ability to absorb excess nutrients, particularly nitrogen, from aquaculture effluents. This study aimed to evaluate the nitrogen uptake and growth rate of Gracilaria verucosa cultivated in a mesocosm system receiving effluents from black tiger shrimp (Penaeus monodon) cultured at different stocking densities. Post larvae (PL-20) with an initial body weight of 0.4 ± 0.1 g were reared for 28 days at three shrimp stocking densities (20, 60, and 100 PL m⁻²) integrated in a recirculation system with Gracilaria. The highest nitrogen uptake rate by Gracilaria (11.36 mg DW m⁻² day⁻¹) was recorded under the highest shrimp density (100 PL m⁻²). A significant correlation (R² = 0.7) was identified between nitrogen absorption and the growth rate of Gracilaria sp., with the highest growth rate (2.24 ± 0.08% day⁻¹) recorded at this density. However, nitrogen retention in Gracilaria was not significantly affected by the different effluent concentrations. These findings suggest that higher shrimp densities can enhance nitrogen uptake and stimulate Gracilaria growth in integrated aquaculture systems.
Effect of Carbon Sources with Different Types and Concentrations as Culture Media on the Growth of Probiotic Isolate Lactococcus lactis UIS6 Sri Marnani; Purnama Sukardi; Jefri Anjaini; Tohap Simangunsong; Mustika Palupi; Mohammad Nurhafid; Laela Trianingtyas; Ufianah; Ren Fitriadi
Journal of Aquaculture and Fish Health Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i2.78439

Abstract

Lactococcus lactis strain UIS6 is a lactic acid bacteria isolate that has been successfully isolated and developed as a probiotic isolate. Carbon sources are very important factors in supporting the growth of probiotic isolates both in culture media and production media. This study aimed to determine the type and concentration of carbon sources suitable for optimizing the growth of L. lactis strain UIS6. This study was conducted in two stages, 1). Determination of the type of carbon source and 2). Determination of the dose as a continuation of the first stage of the study. Experimental designs are used to test the specified treatments. A total of 4 types of carbon sources in this study include rice bran, soybean meal, fish meal, and molasses. The results of the study showed that soybean meal had an effect on the growth of L. lactis strain UIS6 (p <0.05). Furthermore, the concentration of soybean meal carbon sources was tested at several concentrations, namely 5%, 10%, 15%, and 20% of the total volume of the treatment media. A concentration of 20% was able to optimally increase the growth of L. lactis strain UIS6, obtaining a density of 6.1 x 108 cells/ml-1 after 24 hours. Soybean meal flour has great potential to be developed as a carbon source for probiotic products.
The Length-Weight Relationship and Condition Factor of Anabas testudineus in Tidal Flood Plains Mempawah Regency, West Kalimantan: Growth Pattern and Condition Facton Anabas testudineus in Tidal Flood Plains Farid Mudlofar; Sarmila; Ridwan Salim; Rizal Akbar Hutagalung; Agus Setiawan; Susilawati; Suparmin
Journal of Aquaculture and Fish Health Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i2.80055

Abstract

This study aims to analyze the length–weight relationship and condition factor of Anabas testudineus inhabiting the tidal floodplain ecosystem of Mempawah Regency, West Kalimantan, as a basis for assessing its physiological condition and ecological adaptation to environmental variation. Sampling was conducted at three stations representing different salinity gradients along the tidal floodplain system. A total of 300 individual fish (100 per station, consisting of 50 males and 50 females) were analyzed for total length and body weight. The results showed that the growth coefficient (b) varied among stations: Station 1 exhibited a negative allometric growth pattern (b < 3), Station 2 showed a positive allometric pattern (b > 3) in the combined population, and Station 3 displayed a positive allometric growth pattern (b > 3) in all groups. The condition factor (K) also varied among stations, with the highest average value recorded at Station 3 (1.191), indicating better physiological status and growth performance. Variations in growth and condition factor were influenced by differences in water quality, particularly salinity, dissolved oxygen, and natural food availability. Ecologically, these findings demonstrate the high adaptive capacity of A. testudineus to fluctuating tidal floodplain environments and highlight the importance of conserving low-salinity habitats to support sustainable biomass growth and management of freshwater fish populations.
Utilization of Seagrass Leaf Waste (Thalassia hemprichii) as Feed Ingredient for Koi Fish (Cyprinus rubrofuscus) Growth: English Anita Prihatini Ilyas; Muh Fahruddin; Astutiwati; Wiwin Apri Hartina
Journal of Aquaculture and Fish Health Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i2.80565

Abstract

Several alternative feed ingredients can be used in feed production, one of which is the addition of seagrass leaf waste flour in feed formulations. This study aims to determine the use of seagrass leaf waste as a feed ingredient on the growth of koi fish (Cyprinus rubrofuscus). This study was conducted for 30 days at Bhayangkara Residence Baiti Jannati Block T No. 3, Samapuin Village, Sumbawa Regency. This study used an experimental method with a completely randomized design (RAL) consisting of 4 treatments of different doses of seagrass leaf waste flour mixed with other feed raw materials in the form of pellets. The results showed that the highest absolute weight gain was found in treatment P1 with a weight of 20 g, followed by treatment P2 with 5% seagrass leaf waste flour added to the pellet feed at 18 g, treatment P3 at 14 g, and the lowest in treatment P4 at 9 g. Meanwhile, the highest survival rate in this study was shown by treatment P2 at 100%, followed by treatment P3 at 97%, and the lowest was in treatments P1 and P4, which were 90% each.

Page 35 of 36 | Total Record : 359

 32   33   34   35   36 

Filter by Year

2013 2026


Reset
Filter By Issues
All Issue Vol. 15 No. 2 (2026): JAFH Vol. 15 No. 2 June 2026 Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026 Vol. 14 No. 3 (2025): JAFH Vol. 14 No. 3 September 2025 Vol. 14 No. 2 (2025): JAFH Vol. 14 No. 2 June 2025 Vol. 14 No. 1 (2025): JAFH Vol. 14 No. 1 February 2025 Vol. 13 No. 3 (2024): JAFH Vol. 13 No. 3 September 2024 Vol. 13 No. 2 (2024): JAFH Vol. 13 No. 2 June 2024 Vol. 13 No. 1 (2024): JAFH Vol. 13 No. 1 February 2024 Vol. 12 No. 3 (2023): JAFH Vol. 12 No 3 September 2023 Vol. 12 No. 2 (2023): JAFH Vol. 12 No. 2 June 2023 Vol. 12 No. 1 (2023): JAFH Vol. 12 No. 1 February 2023 Vol. 11 No. 3 (2022): JAFH Vol. 11 No. 3 September 2022 Vol. 11 No. 2 (2022): JAFH Vol. 11 No. 2 June 2022 Vol. 11 No. 1 (2022): JAFH Vol. 11 No. 1 February 2022 Vol. 10 No. 3 (2021): JAFH Vol. 10 No. 3 September 2021 Vol. 10 No. 2 (2021): JAFH Vol. 10 No. 2 June 2021 Vol. 10 No. 1 (2021): JAFH Vol 10 No. 1 February 2021 Vol. 9 No. 3 (2020): JAFH Vol. 9 No. 3 September 2020 Vol. 9 No. 2 (2020): JAFH Vol. 9 No. 2 June 2020 Vol. 9 No. 1 (2020): JAFH Vol. 9 no. 1 February 2020 Vol. 8 No. 3 (2019): JAFH vol. 8 no. 3 September 2019 Vol. 8 No. 2 (2019): JAFH vol. 8 no. 2 Juni 2019 Vol. 8 No. 1 (2019): JAFH Vol. 8 No. 1 Februari 2019 Vol. 7 No. 3 (2018): JAFH Vol. 7 No. 3 September 2018 Vol. 7 No. 2 (2018): JAFH Vol. 7 No. 2 Juni 2018 Vol. 7 No. 1 (2018): JAFH Vol. 7 No. 1 Februari 2018 Vol. 6 No. 3 (2017): JAFH Vol. 6 No. 3 September 2017 Vol. 6 No. 2 (2017): JAFH Vol. 6 No. 2 Juni 2017 Vol. 6 No. 1 (2017): JAFH Vol. 6 No. 1 Februari 2017 Vol. 5 No. 3 (2016): JAFH Vol. 5 No. 3 September 2016 Vol. 5 No. 2 (2016): JAFH Vol. 5 No. 2 Juni 2016 Vol. 5 No. 1 (2016): JAFH Vol. 5 No. 1 Februari 2016 Vol. 3 No. 1 (2014): JAFH Vol. 3 No. 1 January 2014 Vol. 2 No. 1 (2013): JAFH Vol 2 No 1 Februari 2013 More Issue