cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Syifania Hanifah Samara
Contact Email
jafh@fpk.unair.ac.id
Phone
-
Journal Mail Official
jafh@fpk.unair.ac.id
Editorial Address
-
Location
Kota surabaya,
Jawa timur
INDONESIA
Journal of Aquaculture and Fish Health
Published by Universitas Airlangga
ISSN : 23017309     EISSN : 25280864     DOI : -
Core Subject : Agriculture,
Agriculture, Biological Sciences & Forestry
The Journal of Aquaculture And Fish Health (JAFH) has an objective to publish and provide high-quality scientific contributions to the field of fisheries. These contributions came from innovative researches that encourage science and technology development in the field of fisheries and marine science on a national and international scale. This journal serves as a communication medium for researchers, academics, students, and communities.
Arjuna Subject : -
Articles 345 Documents
 31   32   33   34   35 
Comparative Analysis of the Efficacy of Bacillus subtilis and Lactoba-cillus acidophilus in Inhibiting Vibrio parahaemolyticus Infection in Black Tiger Shrimp (Penaeus monodon) Gusman, Ery; Raoda, Andini Aisyah Nur; Maulianawati, Diana; Rukisah, Rukisah; Zainuddin, Zainuddin; Imra, Imra
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.76562

Abstract

The application of probiotic bacteria in black tiger shrimp (Penaeus monodon) aquaculture constitutes a preventive strategy aimed at mitigating the risk of disease outbreaks. This study aims to compare the efficacy of Bacillus subtilis and Lactobacillus acidophilus in inhibiting Vibrio parahaemolyticus infection through both in vitro and in vivo evaluations. The research was conducted from January to March 2025 at the Fisheries Biology Laboratory, Faculty of Fisheries and Marine Science, Universitas Borneo Tarakan. This study used a Completely Randomized Design (CRD) with four treatments and three replicates each, namely Control (-) uninfected and without probiotics, Control (+) infected with V. parahaemolyticus at 104 CFU/mL without probiotics, Bs given B. subtilis at 108 CFU/mL and infected with V. parahaemolyticus at 104 CFU/mL, and La given L. acidophilus at 108 CFU/mL and infected with V. parahaemolyticus at 104 CFU/mL. Observed parameters included antibacterial inhibition, survival rate (SR), mortality pattern, mean time to death (MTD), relative percentage survival (RPS), bacterial population, clinical symptoms, and water quality. L. acidophilus demonstrated greater efficacy than B. subtilis in inhibiting V. parahaemolyticus infection in black tiger shrimp. The survival rate of shrimp treated with L. acidophilus reached 69.67%, whereas the group treated with B. subtilis exhibited a survival rate of 43.00%. Overall, the application of L. acidophilus consistently yielded superior survival outcomes compared to B. subtilis.
Relationship Between Nitrogenous Wastes, Organic Matter, Bacteri-al Abundance, and Protozoan Abundance in Whiteleg Shrimp Inten-sive Farming Ponds Utami, Diah Ayu Satyari; Kusmiatun, Anik; Ilham; Febrianti, Desy; Sudiarsa, I Nyoman; Abrori, Mohsan; Nisa, Andina Chairun; Aras, Annisa Khairani; Jatayu, Diklawati; Kaborang, Yasinta Ega; Budiadnyani, I Gusti Ayu; Nugraha, I Made Aditya; Wahidi, Budi Rianto; Wahyu
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77343

Abstract

Whiteleg shrimp (Litopenaeus vannamei) dominates global aquaculture production due to its adaptability to intensive systems. However, intensive systems often experience excess accumulation of nitrogenous waste and total organic matter (TOM), which can destabilize microbial communities and affect water quality. While protozoa are known as bioindicators, few studies have explored how their functional composition interacts with nitrogen cycling and production performance in shrimp ponds. This study investigated the relationships between nitrogenous compounds, TOM, bacterial and protozoan abundance in two intensive shrimp ponds (HP: high protozoan abundance and LP: low protozoan abundance). Water quality parameters, including Total Ammonia Nitrogen (TAN), nitrite, nitrate, TOM, and phosphate, were monitored weekly alongside microbial assessments of total bacterial count (TBC), total Vibrio count (TVC), and protozoa abundance. Protozoa were identified microscopically, while shrimp performance was measured by growth, feed conversion ratio (FCR), survival, and productivity. TOM emerged as the primary ecological driver, significantly correlating with Vibrio abundance (r = 0.585, p < 0.05). Although the high-protozoa pond featured greater bacterial biomass and more bacterivorous taxa (e.g., Ciliata, Vorticella), it had lower shrimp productivity. Conversely, the low-protozoa pond dominated by detritivores (Euplotes, Strombidionopsis) achieved superior growth, FCR, and final biomass, despite higher TOM and nitrite levels. These findings suggest that protozoan functional composition, rather than total abundance, critically influences nutrient cycling, microbial stability, and production outcomes. Managing TOM and fostering beneficial microbial loops are essential strategies for sustainable shrimp farming.
Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis Rahayu, Sata Yoshida Srie; Fikriyyani, Alya Fairuz; Hadiarto, Toto; Fitriadi, Ren
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77996

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.
The Growth Performance of Tilapia (Oreochromis sp.) using Different Doses of Organic Cooper (Cu–O) in the Diets Jusadi, Dedi; Rahmayanti, Yessy; Gumelar, Muhammad Raditya; Adestia, Talita Shofa; Suprayudi, Muhammad Agus
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.78070

Abstract

Copper (Cu-O) is a micromineral required in small amounts in the body, yet it plays an important role in the metabolism and health of fish. This study aimed to evaluate the growth performance of tilapia (Oreochromis sp.) fed diets supplemented with organic copper (Cu-O). Four treatments were tested: K (control, without Cu-O), Cu-O 1 (1 mg kg⁻¹ Cu-O), Cu-O 2 (2 mg kg⁻¹ Cu-O), and Cu-O 3 (3 mg kg⁻¹ Cu-O). Fifteen tilapia with an average initial weight of 8.75 ± 0.02 g were reared in aquaria (60 × 50 × 40 cm, water depth 30 cm) for 60 days. Fish were fed to satiation three times daily. The results showed that the growth parameters of tilapia fed Cu-O-supplemented diets were significantly higher (P < 0.05) than those of the control. The optimal dose of Cu-O supplementation was found to be 2 mg kg⁻¹ feed; subsequent studies should investigate interspecies variations and refine dosage recommendations accordingly.
Effects of Water Quality on the Seasonal Variability of Gonadosomat-ic Index (GSI), Hepatosomatic Index (HSI), Stomach Repletion Index (SRI) and Condition Factor (K) of Clarias gariepinus and Oreo-chromis niloticus from River Ngadda, Borno State – Nigeria: Effect of Water Quality on Fish Health Bwala, Mathias; Gaya, Ezra; Nayaya, Ahmed; Buba, Toma
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.80544

Abstract

Environmental stressors such as water quality depletion, micro-(nano) plastics (MNPs), heavy metals, and endocrine-disrupting chemicals (EDC) may exert behavioral, developmental, physiological, and reproductive stress on organisms, particularly fish in the aquatic ecosystems. Ecotoxicological biomarkers such as the gonadosomatic index (GSI), hepatosomatic index (HSI), stomach repletion index (SRI), and condition factor (K) provide insights into the fish’s health, nutritional status, and reproductive dynamics. This study assessed the influence of water quality on GSI, HSI, SRI, and K in Clarias gariepinus and Oreochromis niloticus from River Ngadda, Maiduguri, Borno State, Nigeria, across dry and wet seasons. Results showed that all measured parameters were within the permissible limits of the National Environmental Standards & Regulations Enforcement Agency (NESREA) and the World Health Organization (WHO). During the dry season, pH ranged from 7.27 ± 0.24 to 7.71 ± 0.19, while TDS ranged from 179 ± 22.4 to 463 ± 287.5 ppm. Nitrate concentrations during the wet season ranged from 26.35 ± 7.04 to 29.80 ± 8.03 mg/L. Seasonal variations were observed in fish biomarkers, with male C. gariepinus exhibiting GSI values of 0.531 ± 0.5–4.428 ± 1.4 (wet season) and 0.919 ± 0.9–2.665 ± 0.3 (dry season). In O. niloticus, GSI of the females peaked during the dry season (10.542 ± 3.1–14.737 ± 4.4), while others also showed pronounced seasonal and species-specific patterns. Canonical correlation analysis revealed strong relationships (r > 0.90) between water quality variables and fish physiological and reproductive indexes, suggesting a strong relationship between water quality and the fish’s health.

Page 35 of 35 | Total Record : 345

 31   32   33   34   35 

Filter by Year

2013 2026


Reset
Filter By Issues
All Issue Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026 Vol. 14 No. 3 (2025): JAFH Vol. 14 No. 3 September 2025 Vol. 14 No. 2 (2025): JAFH Vol. 14 No. 2 June 2025 Vol. 14 No. 1 (2025): JAFH Vol. 14 No. 1 February 2025 Vol. 13 No. 3 (2024): JAFH Vol. 13 No. 3 September 2024 Vol. 13 No. 2 (2024): JAFH Vol. 13 No. 2 June 2024 Vol. 13 No. 1 (2024): JAFH Vol. 13 No. 1 February 2024 Vol. 12 No. 3 (2023): JAFH Vol. 12 No 3 September 2023 Vol. 12 No. 2 (2023): JAFH Vol. 12 No. 2 June 2023 Vol. 12 No. 1 (2023): JAFH Vol. 12 No. 1 February 2023 Vol. 11 No. 3 (2022): JAFH Vol. 11 No. 3 September 2022 Vol. 11 No. 2 (2022): JAFH Vol. 11 No. 2 June 2022 Vol. 11 No. 1 (2022): JAFH Vol. 11 No. 1 February 2022 Vol. 10 No. 3 (2021): JAFH Vol. 10 No. 3 September 2021 Vol. 10 No. 2 (2021): JAFH Vol. 10 No. 2 June 2021 Vol. 10 No. 1 (2021): JAFH Vol 10 No. 1 February 2021 Vol. 9 No. 3 (2020): JAFH Vol. 9 No. 3 September 2020 Vol. 9 No. 2 (2020): JAFH Vol. 9 No. 2 June 2020 Vol. 9 No. 1 (2020): JAFH Vol. 9 no. 1 February 2020 Vol. 8 No. 3 (2019): JAFH vol. 8 no. 3 September 2019 Vol. 8 No. 2 (2019): JAFH vol. 8 no. 2 Juni 2019 Vol. 8 No. 1 (2019): JAFH Vol. 8 No. 1 Februari 2019 Vol. 7 No. 3 (2018): JAFH Vol. 7 No. 3 September 2018 Vol. 7 No. 2 (2018): JAFH Vol. 7 No. 2 Juni 2018 Vol. 7 No. 1 (2018): JAFH Vol. 7 No. 1 Februari 2018 Vol. 6 No. 3 (2017): JAFH Vol. 6 No. 3 September 2017 Vol. 6 No. 2 (2017): JAFH Vol. 6 No. 2 Juni 2017 Vol. 6 No. 1 (2017): JAFH Vol. 6 No. 1 Februari 2017 Vol. 5 No. 3 (2016): JAFH Vol. 5 No. 3 September 2016 Vol. 5 No. 2 (2016): JAFH Vol. 5 No. 2 Juni 2016 Vol. 5 No. 1 (2016): JAFH Vol. 5 No. 1 Februari 2016 Vol. 3 No. 1 (2014): JAFH Vol. 3 No. 1 January 2014 Vol. 2 No. 1 (2013): JAFH Vol 2 No 1 Februari 2013 More Issue