cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kab. sleman,
Daerah istimewa yogyakarta
INDONESIA
Jurnal Sain Veteriner
Published by Universitas Gadjah Mada
ISSN : 012660421     EISSN : 24073733     DOI : -
Core Subject : Health,
Veterinary
Arjuna Subject : -
Articles 13 Documents
 1   2 
Search results for , issue "Vol 39, No 3 (2021): Desember" : 13 Documents clear
Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development Narendra Yoga Hendarta; Asmarani Kusumawati; Tri Wibawa; Abu Tholib Aman
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.44696

Abstract

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping
Pemodelan Epidemiologi Kejadian Multidrug Resistance Bakteri Escherichia coli pada Peternakan Ayam Komersial di Kabupaten Blitar Freshinta Jellia Wibisono; Bambang Sumiarto; Tri Untari; Mustofa Helmi Effendi; Dian Ayu Permatasari; Adiana Mutamsari Witaningrum
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.52071

Abstract

Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar.  Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelitian ini menunjukkan Distribusi kasus kejadian multidrug resistance pada ayam komersial di Kabupaten Blitar menunjukkan prevalensi kejadian pada tingkat peternakan sebesar 95.9%. Pemodelan kejadian multidrug resistance bakteri Escherichia coli tingkat ternak menghasilkan model regresi logistik ganda Ln () = 0.21964 + 1.60374 RefTS + 1.44989 Broiler + 0.96022 PakRacik + 0.84182 ProgAb – 1.16667 SaniKan – 1.15046 Tritendap, dengan peluang kejadian sebesar 94 %. Pemodelan kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan menghasilkan model regresi linier, MDR (Y) = 0.57886 + 0.16105 JUMitra + 0.19342 ProgAb – 0.16178 Dukudrh. Model ini memiliki wilk saphiro mendekati 1 (W = 0,9573) sehingga model persamaan ini merupakan model yang baik untuk kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan.
ANALISIS KUALITAS DAGING AYAM BROILER ASAL PASAR SWALAYAN DAN PASAR TRADISIONAL DI KOTA MEDAN SUMATERA UTARA Dhirgo Adji; Angelina Susanty; Ma’ruf Tafsin
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.54354

Abstract

The mean protein content in broiler chickens from high to low were respectively protein in breast meat from supermarkets: 16.83 ± 0.42 %; breasts from the traditional market: 15.63 ± 1.09 %, thighs from the supermarket: 14.5 ± 0.57 % and thighs from the traditional market: 13.6 ± 0.38 gr / 100 %. Based on all of the datas collection,  the result of statistical analysis using a 2x2 factorial pattern showed that there were no significant differences of water content (P>0.05) whreas: the ash, carbohydrates, fats and proteins showed significant (P£0.05).Thighs from traditional markets 4.5 ± 0.60 % and chest from traditional markets from 5.3 ± 0.69 %. The Average of fat content of broiler meat in the thigh, from supermarket: 2.56 ± 0.63 %; chest origin supermarket 1.2 ± 0.5 %; thigh meat from traditional markets: 3.15 ± 0.21 % and breast meat from traditional markets: 1.8 ± 0.227 %. Broiller is one of the biggest contributor to animals protein from livestock and is a superior commodity in Indonesia. At present, the broiler chicken industry has developed rapidly and become the largest contributor to animal protein as well as a major source of consumer menus that are very easy to obtain, both in modern and traditional markets. After the achievement of the population of broiller chickens, government policy began to emphasize on improving the quality of meat by changing meat characteristics such as appearance, texture, moisture content, firmness, softness, odor, taste and the nutritional content is no exception. Thirty-two samples of broiller chicken meat consisting of 16 meat samples purchased from 4 supermarkets and 16 samples purchased from 4 traditional markets were used as research objects. A hundred grams of fresh meat per sample were purchased and immediately packed in aluminum foil, packaged in a cooler box then sent to the Food and Nutrition Laboratory, Inter-University Center, Gadjah Mada University for proximate analysis. The results of the examination of water concentration showed that the average of water content of thigh meat from supermarkets was 76.26 ± 0.86 %; supermarket breast meat 74.135 ± 0.92 %; thigh meat from the traditional market 75 ± 0.56 % and breast meat from the traditional market: 75.64 ± 1.044 %. Analysis of the average levels of the ash concentration respectively: thighs from the supermarket 0.96 ± 0.027 %, chest from the supermarket 1.095 ± 0.05 %, thighs from the traditional market 1.034 ± 0.106 % and breasts from the traditional market 1.155 ± 0.11%. The average of carbohydrate levels were consecutive: Thigh meat from the supermarket: 5.6 ± 1.33 %; chest of origin of the supermarket: 6.7 ± 1.078 %;
Studi Histopatologi Ren Tikus Putih (Rattus Norvegicus L.) Diabetes Setelah Pemberian Cuka dari Kulit Nanas (Ananas Comosus (L.) Mer.) Tazkia Annisa; Agung Janika Sitasiwi; Sri Isdadiyanto; Siti Nur Jannah
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.56891

Abstract

Diabetes mellitus is a metabolic disease that occurs due to impaired insulin secretion caused by progressive damage to beta cells. Pineapple skin vinegar contained acetic acid and antioxidants which have the potential to help repaired the structure of the nephron ren and other organs affected by diabetes. The purpose of this study was to examined the effectiveness of pineapple skin vinegar on improved the histological structure of diabetic rats ( Rattus norvegicus L.). This study based on changed in the structure of the nephron in samples of normal and alloxan-induced mice pre-treatmented and post-treatmented. Twenty-four rats were divided into 6 groups, named normal control, positive control (diabetes + 0.4 mL apple vinegar), negative control (diabetes + water), dose test groups 1, 2, and 3 (pineapple vinegar 0.2 mL; 0.4 mL; 0.8 mL). Statistical analysis test used ANOVA was followed by Duncan test. The conclusion of this research, the pineapple skin vinegar showed the ability to repair the histopathological structure of white rats damaged by diabetes. The optimum dose needed was 0.8 mL to improved the histological structure of the nephron, as indicated by the glomerular diameter and the distance of the Bowman's capsule space to near normal.
Deteksi Kebuntingan Ternak Sapi : Aplikasi Test Strip Dairy Cow Pregnancy Colloidal Gold Test Strip Sartika Juwita; Mihrani .; Agusriady .; Aris Handono
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.58084

Abstract

Deteksi kebuntingan dini pada ternak sapi sangat penting ditinjau dari segi ekonomi karena akan mempengaruhi pendapatan peternak. Deteksi kebuntingan dini sangat penting untuk memperpendek calving interval melalui peningkatan pengetahuan peternak untuk mengidentifikasi status reproduksi, sehingga dapat melakukan terapi dan mengawinkannya sesegera mungkin. Kegiatan penetapan ternak sapi bunting atau tidak bunting dilaksanakan dengan metode deteksi kebuntingan. Penelitian ini bertujuan untuk mengetahui akurasi test strip dalam diagnosis kebuntingan pada ternak sapi. Test strip digunakan untuk mendeteksi kebuntingan 46 ekor ternak sapi Bali betina yang berasal dari peternakan rakyat.  Hasil menunjukkan bahwa test strip yang dilakukan pada 30 hari pasca inseminasi buatan menunjukkan sensitivitas 75% dan spesifisitas 90%. Test strip dapat digunakan untuk deteksi kebuntingan dini pada ternak sapi.
Faktor Risiko Potensial terhadap Canine Leptospirosis di Ragunan Animal Hospital Jakarta, Indonesia Ambar Retnowati; Agustin Indrawati; Upik Kesumawati Hadi; Safika .; Pratitis S Wibowo; Susan M Noor
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.60354

Abstract

Leptospirosis is a zoonotic disease caused by bacteria Leptospira sp. which causes infection in animals and humans. Dogs infected with leptospirosis showed symptoms such as anorexia, fever, vomiting, weakness, diarrhea and often experience yellowing of the eye area and mucosa around the mouth (icteric) with fatal systemic complications and multi-organ dysfunction, especially in the kidneys and liver. Leptospirosis is an endemic disease in Jakarta. This study aims to identify risk factors that can contribute to canine mortality based on early clinical symptoms that are found when the dog is in an animal health service facility such as a veterinary clinic, veterinary hospital or independent practice veterinarian. Method were used in this study is clinical manifestations and laboratory examinations and medical records of dogs with suspected leptospirosis. Criteria inclusion were based on aspects of the clinical symptoms of dogs in and around Jakarta. Analysis data used the chi-square with confidence of interval (CI) 95%. Dogs used during the study had ages for puppies (less than 1 year) totaling 13 or 32.50%, for adult dogs over 1 year amounted to 27 or 67.50%, 80% male dogs and 20% female. with 80% maintenance system not housed by the owner. Risk factors for clinical symptoms such as myalgia, symptomatic vomiting of the pulmonary area or shortness of breath and abdominal pain, conjunctival suffusion, anorexia and diarrhea contributed to the high mortality rate leptospirosis during study in dogs 2020.
Gangguan Pertumbuhan Organ Limfoid Ayam Broiler yang Menderita Omfalitis Bambang Sutrisno; R Wasito; Sitarina Widyarini; Yuli Purwandari Kristianingrum; Sugiyono .
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.60465

Abstract

Penelitian ini bertujuan untuk melihat gangguan pertumbuhan jaringan limfoid primer dan sekunder yang menderita omphalitis dengan pemeriksaan histopatologi diwarnai dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan imunohistokimia streptavidin biotin terhadap interleukin-10 (IL-10) pada ayam muda. Ayam umur 24 hari (DOC) broiler digunakan dan dikumpulkan dari tempat penetasan yang sama di Jawa Tengah di Indonesia. Semua 24 DOC dibagi menjadi dua kelompok yang masing-masing terdiri dari 12 DOC (Grup A) dan 12 DOC omphalitic (Grup B). Semua DOC dirawat di kandang yang berbeda, diberi makan dan diminum di libitum. Pada hari ke 3, 6 dan 9, empat ekor ayam dari masing-masing kelompok ditimbang untuk kemudian dinekropsi. Timus, bursa fabricius dan limpa dikumpulkan dan ditimbang. Semua jaringan diproses secara histopatologi dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan biotin streptavidin imunohistokimia imunopatologi. Data indeks berat limpa, bursa Fabricius dan tymus dianalisis menggunakan program statistik IBM SPSS versi 22. Hasil penelitian menunjukkan bahwa indeks bobot limpa, bursa fabricius dan timus ayam omphalitic (kelompok B) lebih rendah dibandingkan dengan indeks bobot ayam sehat (kelompok A). Indeks berat timus berbeda nyata (P <0, 05). Lesi histopatologis pada organ limfoid diamati pada semua ayam di Grup B. Lesi ditandai dengan penipisan dan nekrosis limfosit. Ayam dari Grup A tidak mengalami perubahan pada organ limfoid. Biotin streptavidin immunostaining dengan ekspresi antibodi policlonal anti IL-10 pada bursa Fabricius pada ayam omphalitic (Grup B) memiliki IL-10 yang sangat sedikit jika dibandingkan dengan ayam sehat (Grup A). Kesimpulan, omfalitis menyebabkan penurunan indeks berat badan yang signifikan dan gangguan pertumbuhan organ limfoid yang ditandai dengan deplesi dan nekrosis limfosit.  
Efektivitas Low Density Lipoprotein (LDL) dari Kuning Telur Ayam terhadap Kualitas Semen Cair Domba Dwitya Citraesti; Wahono Esthi Prasetyaningtyas; Ni Wayan Kurniani Karja
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.63395

Abstract

Low-Density Lipoprotein (LDL) extracted from egg yolk (LDL) has recently known can eliminate the adverse effect associated in the use of fresh egg yolk. The role of LDL in liquid preservation at 4°C of ram sperm has not been explored. This research evaluates the effects of substituting egg yolk with LDL in ram sperm preservation at 4 °C on 5 days. The objective of this research was to assess the effects of substituting egg yolk with LDL for use as an extender in sperm preservation at 4°C, as well as on spermatozoa motility, viability, morphology, plasma membrane, and acrosome integrity, for 5 days. The semen was subsequently divided into five and diluted with Tris–fresh egg yolk (K), Tris–LDL5% (LDL5), Tris–LDL10% (LDL10), Tris–LDL15% (LDL15), and Tris–LDL20% (LDL20). The result showed a significant difference between LDL to fresh egg yolk for ram sperm quality (P<0.05). The effectiveness of LDL on sperm quality decreased following by its concentration. Even though up to 20% concentration of LDL, it can not preserve the quality of diluted semen for motility, viability, and plasm membrane integrity. 
Respon Imun Seluler Ayam Petelur Pascavaksinasi Avian Influenza Subtipe H5N1 Isolat dari Bali Gusti Ayu Yuniati Kencana; Tri Komala Sari; I Nyoman Suartha; I Ketut Tomy Caesar Ramanda; Anak Agung Sagung Kendran
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.66086

Abstract

Avian Influenza subtype H5N1 (AI-H5N1) is a malignant virus that is very detrimental to laying chickens because it is highly contagious and mutates easily. Prevention of AI-H5N1 disease in laying chickens is carried out by vaccination, therefore to maintain the quality of the vaccine, continuous research is needed. This study aims to determine the potential of AI-H5N1 vaccine isolates from Bali as measured based on cellular immune response based on total and differential leukocyte cells. Formation of antibodies is influenced by the nonspecific and specific immune system involving leukocytes, especially lymphocytes. Total of 40 layers of Novogen Brown strain were used for the research sample, kept since the age of one day on a commercial farm in Perean Village, Tabanan Regency, Bali. Laying chickens are vaccinated at 5 weeks of age by intramuscular injection. Total of 20 chikens were taken randomly and used for the sample. Blood draws were performed once pre-vaccination and five times each week after vaccination with anticoagulants. Total leukocytes were examined by an auto hematology analyzer, while differential leucocytes with thin blood smear stained with Giemsa. Total and differential leukocyte data were analyzed by means of the variance test followed by the Duncan test. Results showed that AI-H5N1 vaccination from Bali isolates could increase total and differential leucocytes of laying chickens and had significant effect on the mean total leukocytes, the absolute values of heterophyll cells, eosinophils, lymphocytes, and monocytes, but had no significant effect on post-vaccination basophil cells.
Daya Antelmintik Serbuk Kulit Nanas (Ananas comosus) terhadap Cacing Haemochus contortus pada Domba Dewi Pranatasari; Rido Florensius Manik; Budi Purwo Widiarso; Wida Wahidah Mubarokah
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.66420

Abstract

The problem facing sheep breeders in breeding sheep was digestive tract parasite of worm (nematodiasis and haemonchosis). Resistance to anthelmintics was the reason for the study of alternative medication of H. contortus infection. It aimed at finding out the effectiveness of the application of pineapple peel powder as H. contortus anthelmintic in sheep and the dose of the pineapple peel powder as the H. contortus anthelmintic. It used 15 sheep that were assigned to 5 groups. Group I served as positive control with the application of albendazole (Kalbazen) anthelmintic, Group II was treated using the pineapple peel powder at the dose of 150 mg/kg BW. Group III was treated using the pineapple peel powder at the dose of 200 mg/kg BW. Group IV was treated using the pineapple peel powder at the dose of 250 mg/kg BW. And, Group V served as negative control without any treatment. The treatments were conducted for 14 days and the resulting statistic data were analyzed using comparative descriptive method by comparing initial data (before the treatments) and final data (after the treatments). The comparative data showed that there was significant change in the observed variables. The results of the study showed that the pineapple peel powder could be used as the anthelmintic of the H. contortus in the sheep and the dose of 250 mg/kg BW most significantly decreased the mean number of the eggs of the worm per gram of feces

Page 1 of 2 | Total Record : 13

 1   2 

Filter by Year

2021 2021


Reset
Filter By Issues
All Issue Vol 43, No 3 (2025): Desember Vol 43, No 2 (2025): Agustus Vol 43, No 1 (2025): April Vol 42, No 3 (2024): Desember Vol 42, No 2 (2024): Agustus Vol 42, No 1 (2024): April Vol 41, No 3 (2023): Desember Vol 41, No 2 (2023): Agustus Vol 41, No 1 (2023): April Vol 40, No 3 (2022): Desember Vol 40, No 2 (2022): Agustus Vol 40, No 1 (2022): April Vol 39, No 3 (2021): Desember Vol 39, No 2 (2021): Agustus Vol 39, No 1 (2021): April Vol 38, No 3 (2020): Desember Vol 38, No 2 (2020): Agustus Vol 38, No 1 (2020): April Vol 37, No 2 (2019): Desember Vol 37, No 1 (2019): Juni Vol 36, No 2 (2018): Desember Vol 36, No 1 (2018): Juni Vol 35, No 2 (2017): Desember Vol 35, No 1 (2017): Juni Vol 34, No 2 (2016): Desember Vol 34, No 1 (2016): Juni Vol 33, No 2 (2015): Desember Vol 33, No 1 (2015): JUNI Vol 32, No 2 (2014): DESEMBER Vol 32, No 1 (2014): JUNI Vol 31, No 2 (2013): DESEMBER Vol 31, No 1 (2013): JULI Vol 30, No 2 (2012): DESEMBER Vol 30, No 1 (2012): JUNI Vol 29, No 2 (2011): DESEMBER Vol 29, No 1 (2011): JUNI Vol 28, No 2 (2010): DESEMBER Vol 28, No 1 (2010): JUNI Vol 27, No 2 (2009): DESEMBER Vol 27, No 1 (2009): JUNI Vol 26, No 2 (2008): DESEMBER Vol 26, No 1 (2008): JUNI Vol 25, No 2 (2007): DESEMBER Vol 25, No 1 (2007): JUNI Vol 24, No 2 (2006): DESEMBER Vol 24, No 1 (2006): JUNI Vol 23, No 2 (2005): DESEMBER Vol 23, No 1 (2005): JUNI Vol 22, No 2 (2004): DESEMBER Vol 22, No 1 (2004): Juli Vol 21, No 2 (2003): DESEMBER Vol 21, No 1 (2003): JULI Vol 20, No 2 (2002): Desember Vol 20, No 1 (2002): Juli Vol 19, No 2 (2001): DESEMBER Vol 18, No 1&2 (2000) Vol 18, No 2 (2000) Vol 18, No 1 (2000) Vol 17, No 1 (1999) Vol 16, No 2 (1999) Vol 16, No 1 (1998) Vol 15, No 1&2 (1996) Vol 14, No 2 (1995) More Issue