cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
I G. Made Krisna Erawan
Contact Email
krisnaerawan@unud.ac.id
Phone
-
Journal Mail Official
-
Editorial Address
Animal Hospital, Faculty of Veterinary Medecine Building, Udayana University, 2nd Floor, Jalan Raya Sesetan, Gang Markisa No 6, Banjar Gaduh, Sesetan, Denpasar, Bali, Indonesia
Location
Kota denpasar,
Bali
INDONESIA
Jurnal Veteriner
Published by Universitas Udayana
ISSN : 14118327     EISSN : 24775665     DOI : https://doi.org/10.19087/jveteriner
Core Subject : Health,
Veterinary
Jurnal Veteriner memuat naskah ilmiah dalam bidang kedokteran hewan. Naskah dapat berupa: hasil penelitian, artikel ulas balik (review), dan laporan kasus. Naskah harus asli (belum pernah dipublikasikan) dan ditulis menggunakan bahasa Indonesia atau bahasa Inggris. Naskah ilmiah yang telah diseminarkan dalam pertemuan ilmiah nasional dan internasional, hendaknya disertai dengan catatan kaki
Arjuna Subject : -
Articles 1,116 Documents
 75   76   77   78   79 
Survei Penyakit Porcine Reproductive and Respiratory Syndrome pada Peternakan Babi di Bali (SEROLOGICAL SURVEILLANCE OF PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME IN PIGGERIES IN BALI) I Nyoman Suartha; I Made Suma Anthara; I Wayan Wirata; Tri Komala Sari; Ni Made Ritha Krisna Dewi; I Gusti Ngurah Narendra; I Gusti Ngurah Mahardika
Jurnal Veteriner Vol 14 No 1 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (248.951 KB)

Abstract

This study aimed to determine the presence and burden of Porcine Respiration and ReproductiveSyndrome (PRRS) virus in pig farms in Bali. A total of 305 sera samples were collected from 10 intensivepig farms and backyard piggeries located in eight districts, in Bali. The PRRS antibody and the virus wasdetected using enzyme linked immunosorbent assay (ELISA) and transverse reverse polymerase chainreaction (RT-PCR), respectively. The results showed that, generally the average percentage of positiveswine anti-PRRS antibody was 13.4%, 14.3%,  and 11.7% in the backyard farms and commercial farms,respectively. Whereas, the detection rate of PRRS virus was 8.9% (15.3% and 5.6% in the backyard farmand commercial farms, respectively). It was concluded that PRRS virus is endemic in pigs, in Bali.Vaccination, management, biosafety, and quarantine  should be implemented to prevent the economicloss due to PRRS.
Residu Gula Glikokonjugat pada Lambung Depan Kerbau Rawa (Bubalus bubalis) Kalimantan Selatan (SUGAR RESIDU OF GLYCOCONJUGATES IN FORESTOMACH OF SOUTH KALIMANTAN SWAMP BUFFALO (BUBALUS BUBALIS) Anni Nurliani; Teguh Budi Pitojo; Dwi Liliek Kusindarta
Jurnal Veteriner Vol 15 No 2 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (292.58 KB)

Abstract

The ability of swamp buffaloes to adapt with swamp environment was suggested to be supported bytheir digestive system efficiency. The research was done to obtain scientific explanation about digestiveefficiency of swamp buffalo by identification on kinds and distribution of glycoconjugates in swamp buffaloforestomach. Six male swamp buffaloes aged more than 2.5 year old and had body weight between 300-400kg were used in this study. Samples were obtained from Regency of Banjar slaughter house, SouthKalimantan. Every parts of the forestomach included rumen, reticulum, and omasum was taken andprocessed for microscopic observation with hematoxyline eosin (HE) and alcian blue-periodic acid schiff(AB-PAS) stainings. Sugar residues of glycoconjugates were localized with lectin histochemistry wheatgerm agglutinin (WGA), ulex europaeus agglutinin (UEA), ricinus communis agglutinin (RCA), concanavalinagglutinin (Con A), and soybean agglutinin (SBA). Every part of swamp buffalo forestomach had kinds ofspecific glycoconjugates with special distribution pattern which were different with other ruminant, andwere suitable for their functions in that part. The existence of D mannose/D glucose glycoconjugates thatwas dominant in forestomach estimated that had important role in supporting fermentative digestionfunction in swamp buffalo, through its function as receptor bacteria attachment. This is suggested as aspecial characteristic in digestive system of swamp buffalo which causes high digestive efficiency inswamp buffalo.
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (736.87 KB)

Abstract

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Aktivitas Antioksidan Ekstrak Daun Cengkeh (ANTIOKSIDANT ACTIVITY OF CLOVE LEAF EXTRACT) Andi Mu’nisa; Tutik Wresdiyati; Nastiti Kusumorini; Wasmen Manalu
Jurnal Veteriner Vol 13 No 3 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (113.656 KB)

Abstract

Antioxidant activity of clove leaf was investigated. The clove leaves (Eugenia aromatica) wereprepared with reflux extraction using methanol, water, and ethanol. Total activities of the extractsand reducing power were measured with thiocyanate method and reducing potential method. Resultshowed that the highest total antioxidant activity was observed in methanol extract. It appearsthat the ability of this extract for partitioning at the interface of emulsion in tested oxidationsystem was the highest among the other extracts, therefore it had the best activity to inhibitoxidation. The type of phenolic compounds of this extract appeared to be responsible for the highestradical scavenging capacity. The same phenomenon occurred for reducing power, methanol extracthad the highest reducing power, thereby suggesting that each extracts comprised different type ofphenol based on different polarity of reflux used for extraction. Total antioxidant activity and thehighest reducing power obtained from methanol extract. Both are closely related to total phenolcontent of the clove leaves.
Variasi Molekuler Gen Reseptor Melanokortin-4 pada Monyet Ekor Panjang I Gusti Agung Arta Putra; Dondin Sajuthi; Dedy Duryadi Solihin; Raden Roro Dyah Perwitasari
Jurnal Veteriner Vol 11 No 3 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (124.565 KB)

Abstract

Melanocortin-4 receptor (MC4R) is one of G protein-coupled receptors that plays an important role inregulation of energy homeostasis. MC4R mutations constitute the most common cause of human obesity.The study was conducted in order to investigate the variation of MC4R gene in Macaca fascicularis and itsassociation with obesity as a model of human obesity. Forty eight adult male macaques from Bali (Ubudand Uluwatu), East Java (Alas Purwo and Baluran), and Sumatera island (Palembang) were used in thisresearch. The animals had been anaesthetized using ketamine (10 mg/kg body weight) and xylazine (2mg/kg body weight) before collecting blood samples and phenotypic data (weight, crown rump length. Bloodsamples were used as source of DNA. To determine MC4R variation, coding region of this gene wasamplified and sequenced. The results showed that 20 variations sites were identified and 13 of them werenon-synonymous. Among the non-synonymous mutations, five mutations were only found in obese macaque;two mutations were found both in obese and non-obese macaque; and six mutations were only found in nonobesemacaque .
Keragaman Fenotipik dan Pendugaan Jarak Genetik pada Ayam Lokal dan Ayam Broiler Menggunakan Analisis Morfologi (PHENOTYPIC VARIATION AND ESTIMATION GENETIC DISTANCE BETWEEN LOCAL CHICKEN AND BROILER CHICKEN USING MORPHOLOGICAL ANALYSIS) Harini Nurcahya Mariandayani; Dedy Duryadi Solihin; Sri Sulandari; Cece Sumantri
Jurnal Veteriner Vol 14 No 4 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (161.127 KB)

Abstract

This aim of the research was to study the morphological characteristic and estimating genetic distancebetween local chicken and broiler chicken with discriminant and canonical analysis. This research washeld in Faculty of Animal Husbandry, Bogor Agricultural University, using 25 sentul chickens,  25  kampongchickens, 25 kedu chickens , 25  pelung chickens and 25 broiler chickens. The variable as the length ofshank, beak length, back length, chest depth and chest width were measured in this study. The collecteddata were analyzed by using SAS  and SPSS package program. Kampung chickens were mixed with sentulchickens (17.60 %) and kedu chickens (17,70 %). Kedu, kampong,  and  sentul chickens have a relativelyclose genetic distance   compared the genetic distance to pelung chickens with the kampung, sentul, andkedu chickens. Fenogram tree show that there were three separate groups of chickens at the age of eightweeks i.e. : (1) pelung chickens (2), kedu, kampong, and sentul chickens, (3) broiler chickens.  Fenogram treealso shows two separate groups : (1) pelung chickens (2) kedu, kampong, and Sentul chickens (at the age of28 weeks chicken).  The crossbreed between kedu and sentul chickens, also have a relatively close geneticdistance. The phenotypic size of  chickens giving a strong influence on the distinction variable of chickengroups were body length and chest circumference.
Ovisidal dan Vermisidal Bawang Putih terhadap Telur dan Cacing Ascaridia galli pada Ayam Kampung (OVICIDAL AND VERMICIDAL ACTIVITIES OF GARLIC AGAINST THE EGGS AND ADULT HELMINTH OF ASCARIDIA GALLI IN KAMPONG CHICKENS) Ida Bagus Made Oka
Jurnal Veteriner Vol 4 No 2 (2003)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3532.708 KB)

Abstract

Abstak dapat dibaca pada Full Text Abstract can be read at Full Text
Kejadian Balantidiosis pada Babi Landrace (A CASE STUDY OF BALANTIDIOSIS IN LANDRACE SWINE ) Ida Bagus Oka Winaya; I Ketut Berata; Ida Ayu Pasti Apsari
Jurnal Veteriner Vol 12 No 1 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (162.049 KB)

Abstract

The aim of the study was to identify the incidence of balantidiosis in landrace pigs. A total of 60 pigswere examined at Faculty of veterinary medicine, Udayana University between January 2007 and January2008. Seven out of go pigs showed cahexia and diarrhoea . Macroscopic changes were observed, such as: thecolon was fully distended with gas and slight peritonitis,whereas microscopic examination revealed thepresence of Balantidium coli trophozoites and cysta within the intestinal mucosa. Additionally, enteritiskatarrhalis, slight hemorrhagis, erosin and pseudomembranous inflammation with lymphocytes andpolymorphonuclear cells were also noted.
Ekstrak Sambiloto Menurunkan Patogenesitas Ookista Eimeria Tenella Yulia Yellita; Umi Cahyaningsih; Dyah Iswantini Pradono; Wiwin Winarsih; Wasmen Manalu
Jurnal Veteriner Vol 12 No 4 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (348.817 KB)

Abstract

Eimeria tenella is one of the nine of Eimeria species, a pathogenic intraseluler protozoa causing aviancoccidiosis. Infection was initiated by the ingestion of sporulated oocysts. The aim of this study was toinvestigate the effect of E. tenella oocyst incubation in methanol extract of Andrographis paniculata beforeinfection in broiler performance. This research used 115 broiler DOC (CP 707) devided into five groups,each group consisted of 23 broilers. The infection with 1x105 oocyst were done at the 14th day old of chicken.The 1st group was placebo (KN), while the 2nd group was infected with unincubated oocyst (KP), and theother three groups i.e. : 3rd, 4th, 5th were infected with incubated oocyst in A. paniculata extract for 2, 4, and6 hours, respectively. The number of oocysts in feces were counted on day 5th to 14th post-infection, theheterophile and macrophages were counted from caecum histology preparation, by slaughtered threechickens of each of groups on the day 0,3,6.9, and 14 post infection, and accretion body weight wasmeasured by weighing chickens per week to five-week old chickens. The results of this study indicated thatthe incubation period the sporulated oocyst in the extract of A.paniculata for six hours before infection,reduced the number of oocysts production in the feces, the number of inflammatory cells (macrophages andheterophile) in the cecum, and increases body weight (gain). In conclusion A.paniculata extract decreasedthe pathogenisity of E.tenella oocyst, so the extract of A.paniculata has good potential as anticoccidia. Itis high likely that A. paniculata extract has a potential to be anticoccidia.
Analisis Faktor Risiko Penyakit Distemper pada Anjing di Denpasar I Gusti Made Krisna Erawan; I Nyoman Suartha; Emy Sapta Budiari; Diana Mustikawati; I Wayan Batan
Jurnal Veteriner Vol 10 No 3 (2009)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (124.542 KB)

Abstract

A study was conducted to identify the risk factors of canine distemper in Denpasar, Bali. Risk factorsfor canine distemper were characterized using hospital records of private veterinary practitioners. Thisstudy showed that there was no difference in the susceptibility to canine distemper virus infection betweenmales and females. The occurrence of canine distemper disease is not significantly affected by the season.The risk of canine distemper disease for young dogs, between 0 and 1 year was 4.95-fold increase ascompared the risk of disease for dogs that were older than 1 year (Oods-Ratio: 4.95). Incomplete vaccinationwas associated with a 3.77-fold increase in the risk of canine distemper (Oods-Ratio: 3.77).

Page 77 of 112 | Total Record : 1116

 75   76   77   78   79 

Filter by Year

2000 2024


Reset
Filter By Issues
All Issue Vol 25 No 1 (2024) Vol 24 No 4 (2023) Vol 24 No 3 (2023) Vol 24 No 2 (2023) Vol 24 No 1 (2023) Vol 23 No 4 (2022) Vol 23 No 3 (2022) Vol 23 No 2 (2022) Vol 23 No 1 (2022) Vol 22 No 4 (2021) Vol 22 No 3 (2021) Vol 22 No 2 (2021) Vol 22 No 1 (2021) Vol 21 No 4 (2020) Vol 21 No 3 (2020) Vol 21 No 2 (2020) Vol 21 No 1 (2020) Vol 20 No 4 (2019) Vol 20 No 3 (2019) Vol 20 No 2 (2019) Vol 20 No 1 (2019) Vol 19 No 4 (2018) Vol 19 No 3 (2018) Vol 19 No 2 (2018) Vol 19 No 1 (2018) Vol 18 No 4 (2017) Vol 18 No 3 (2017) Vol 18 No 2 (2017) Vol 18 No 1 (2017) Vol 17 No 4 (2016) Vol 17 No 3 (2016) Vol 17 No 2 (2016) Vol 17 No 1 (2016) Vol 16 No 4 (2015) Vol 16 No 3 (2015) Vol 16 No 2 (2015) Vol 16 No 1 (2015) Vol 15 No 4 (2014) Vol 15 No 3 (2014) Vol 15 No 2 (2014) Vol 15 No 1 (2014) Vol 14 No 4 (2013) Vol 14 No 3 (2013) Vol 14 No 2 (2013) Vol 14 No 1 (2013) Vol 13 No 4 (2012) Vol 13 No 3 (2012) Vol 13 No 2 (2012) Vol 13 No 1 (2012) Vol 12 No 4 (2011) Vol 12, No 3 (2011) Vol 12, No 2 (2011) Vol 12 No 1 (2011) Vol 11 No 4 (2010) Vol 11 No 3 (2010) Vol 11 No 2 (2010) Vol 11 No 1 (2010) Vol 10 No 4 (2009) Vol 10 No 3 (2009) Vol 10 No 2 (2009) Vol 10 No 1 (2009) Vol 9 No 4 (2008) Vol 9 No 3 (2008) Vol 9 No 2 (2008) Vol 9 No 1 (2008) Vol 8 No 4 (2007) Vol 8 No 2 (2007) Vol 8 No 1 (2007) Vol 7 No 4 (2006) Vol 4 No 2 (2003) Vol 4 No 1 (2003) Vol 2 No 4 (2001) Vol 2 No 3 (2001) Vol 2 No 2 (2001) Vol 2 No 1 (2001) Vol 1 No 1 (2000) More Issue