Garuda - Garba Rujukan Digital

Identifikasi dan Karakterisasi Bakteri Asam Laktat Isolat Susu Segar Sapi Bali (IDENTIFICATION AND CHARACTERIZATION OF LACTIC ACID BACTERIA ISOLATED FROM BALI CATTLE’S RAW MILK) I Nengah Sujaya; Komang Ayu Nocianitri; Ni Putu Desy Aryantini; Wayan Nursini; Yan Ramona; Yoshitake Orikasa; Fukuda Kenji; Tadashu Urashima; Yuji Oda
Jurnal Veteriner Vol 17 No 2 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (177.957 KB)

Bali cattle is an indigenous spesies in Bali, which pay great attention due to its uniqueness. Numerousarticles have been published on Bali cattle especially related to its disease, nutritional requirement forgrowth and domestication. Nevertherless, it was no any report has been published on the lactic acidbacteria (LAB) assosiated with the cattles raw milk and its potential used as probiotic. This work isaimed to identify LAB isolated from bali cattle raw milk and its resistance to secondary bile acid (sodiumdeoxy cholic), a prequisite in development of probiotic for human. The results revealed that based upon thehomology studies of the variable region I, II, and III sequences of the 16S rDNA showed that 44 out of 62isolates were closely related to Pediococcus acidilactici; 11 out of 62 isolats were closely related to Enterococusgallinarum, five out of 62 isolates were closely related to Lactococcus garvieae, while only one isolate was closely related to Lactobacillus plantarum and Weisella confusa. Some isolates showed resistant to 0.2-0.6mM deoxy cholic acid, which might be also resist in human gastrointestinal tract conditions. Based onthose finding, it can be concluded that the LAB associated with raw bali cattle milk were closey related toP. acidilactici, E. gallinarum, Lac. garvieae, Lb. plantarum and W. confusa, which different from thosecommonly LAB found in others cattle raw milk. Somes isolates were potential to be developed as probioticfrom human helath.

CHARACTERIZATION OF LACTIC ACID BACTERIA ISOLATED FROM SUMBAWA MARE MILK Nengah Sujaya; Yan Ramona; Ni Putu Widarini; Ni Putu Suariani; Ni Made Utama Dwipayanti; Komang Ayu Nocianitri; Ni Wayan Nursini
Jurnal Veteriner Vol 9 No 2 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (233.662 KB)

A study was carried out to isolate and characterize lactic acid bacteria (LAB) from the Sumbawa mares milk The Isolation of LAB was conducted in Man Rogosa Sharpe (MRS) agar. The isolates were characterized by standard methods, such as Gram staining, cell morphology study and fermentation activities. The ability of the isolates to inhibit some pathogenic bacteria was studied by dual culture assay. Isolates showing the widest spectrum of inhibiting pathogenic bacteria were further identified using API 50 CHL. The results showed that Sumbawa mare milk was dominated by lactobacilli and weisella/leuconostoc. As many as 26 out 36 isolates belong to homofermentative lactobacilli and another 10 isolates belong to both heterofermentative lactobacilli and weissella or leuconostoc. Twenty four isolates inhibited the growth of Escherichia coli 25922, Shigela flexneri, Salmonella typhimurium, and Staphylococcus aureus 29213. Two promising isolates with the widest spectrum of inhibiting pathogenic bacteria, Lactobacillus sp. SKG34 and Lactobacillus sp. SKG49, were identified respectively as Lactobacillus rhamnosus SKG34 and Lactobacillus ramnosus SKG49. These two isolates were specific strains of the sumbawa mare milk and are very potential to be developed as probiotic for human.

Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.

PROBIOTIC POTENCY OF LACTOBACILLUS SPP. ISOLATED FROM SUMBAWA MARE MILK I Nengah Sujaya; I Made Utami Dwipayanti; Ni Luh Putu Suariani; Ni Putu Widarini; Komang Ayu Nocianitri; Ni Wayan Nursini
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (479.163 KB)

This research was deigned to elucidate the potency of Lactobacillus spp. isolated from sumbawa mare milk to be developed as a probiotic. Sixteen lacobacilli were screened based on their resitancy to a model of gastric juice at pH 2, 3, and 4, then followed by their resistncy to small intestional fluid model containing deoxycholic. Three lactobacilli i.e. Lactobacillus sp. SKA13, Lactobacillus rhamnosus SKG34 and Lactobacillus rhamnosus SKG49 were found to be resistentent to gastric juice at pH 3 and 4. However, there were no lactobacilli resisted to pH 2. Lactobacillus rhamnosus SKG34 and Lactobacillus rhamnosus SKG49 were able to reach the colon even after being expossed to a model of intestinal fluid containing 0,4 mM deoxycholate and pancreatine. Therefore, these isolates have a potency to be developed as probiotic lactobacilli. Nevertherless, these lactobcailli could probably transform cholic acid into secondary bile acids, which were not expected to be found in the probiotic, and this capability is not appropriate for probiotic. This character is worthly to be studied since it has never been reported in lactobacilli.

Karakterisasi Lactobacillus spp. yang Diisolasi dari Susu Kambing Etawa untuk Pengembangan Probiotik (CHARACTERIZATION OF LACTOBACILLUS SPP., ISOLATED FROM MILK OF ETAWA GOATS FOR LOCAL PROBIOTIC DEVELOPMENT) Putu Rima Sintyadewi; Yan Ramona; I Nengah Sujaya
Jurnal Veteriner Vol 16 No 2 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (370.683 KB)

The objective of this research was to characterize Lactobacillus spp., isolated from milk of Etawagoats for local probiotic development. Total of 23 isolates Lactobacillus spp. were tested for resistance tolow pH conditions, high levels of natrium deoxy cholate, and modified gastric juice conditions. Besidesthat, those isolates were also tested to convert cholic acid (CA) into deoxycholic acid (DCA). Isolate thatshowed the most potential properties for local probiotic development was identified by 16S rDNA analysisusing following amplification of this sequence with primers of 27F and 520R). The results showed that 12isolates were found to be resistant to low pH conditions and to high level of NaDC (0.6 mM). Three of them(Lactobacillus spp. GMA46, Lactobacillus spp. GMA47 and Lactobacillus spp. GMA50) did not convertcholic acid into deoxy cholic acid, indicating that they are safe for human use. Lactobacillus spp. GMA46showed better performance in the gastric juice (a model of gastic and intestinal juice containing pepsin andpancreatin enzymes at pH 2, 3 and 4) simulation test. This GMA46 isolate was identified as L. caseiATCC 334 and L. paracasei subsp. tolerans strain NBRC 15906 with 100% similarity, in term of its 16srDNA nucleotide sequence. The results of this research indicate that Lactobacillus sp. GMA46 is anIndonesian potential probiotic strain, isolated from milk of etawa goats

MIKROENKAPSULASI PROBIOTIK LACTOBACILLUS RHAMNOSUS FBB81 DAN VIABILITASNYA SELAMA PENYIMPANAN Komang Ayu Nocianitri; I Nengah Sujaya; Yan Ramona
Media Ilmiah Teknologi Pangan (Scientific Journal of Food Technology) Vol 6 No 1 (2019): Scientific Journal of Food Technology (March)
Publisher : Master Program of Food Science and Technology, Faculty of Agricultural Technology, Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar

Lactobacillus rhamnosus FBB81 is a probiotic candidate isolated from healthy infant feces that hasfunctional properties as an antioxidant. Probiotics are made in the form of a dry cell bymicroencapsulation technique to facilitate the application of probiotics in the development of functionalfood products. The purpose of this study was to determine the viability of Lb. rhamnosus FBB81encapsulated with maltodextrin and skim milk during storage. The microencapsulated product wasstored at two storage temperatures namely room temperature and cold temperature. The viability of Lb.rhamnosus FBB81 on the microencapsulated product was observed every 1 week for 8 weeks of storage.The results showed that the types of encapsulan and storage temperature affected the viability of Lb.rhamnosus FBB81 during storage. Skim milk and cold temperatures have a better ability than themaltodextrin and room temperature in maintaining the viability of probiotic Lb. rhamnosus FBB81during storage.

Antioxidant Activity of Lactobacillus spp as for Development of Antioxidantive Probiotic Komang Ayu Nocianitri; I Nengah Sujaya; Yan Ramona
Media Ilmiah Teknologi Pangan (Scientific Journal of Food Technology) Vol 3 No 1 (2016)
Publisher : Master Program of Food Science and Technology, Faculty of Agricultural Technology, Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar

Probiotics are live microorganisms which when administered in adequate amount confer health benefit to the host. Our previous studies revealed that Lactobacillsus spp isolated from infant feces potential to be developed as probiotics. Since the functionality of probiotic is strain specific, it is worth to screen the antioxidant activity of those lactobacilli, which will be developed as antioxidative probiotic. The aim of this study was to screen antioxidant activities of Lactobacillus spp isolated from infant feces. A numbers of 20 Lactobacillus spp strains isolated from infant feces were used in this study. The antioxidant activities was determined in in vitro studies by measuring the lipid peroxidation, hydroxyl radical scavenging activity, and ferrous chelating activity. The result showed that inhibitory activity of lipid peroxidation, hydroxyl radical scavenging activity, and ferrous chelating activity exerted by of Lactobacillus spp was 10.12 - 83.02%, 16,50-46,73%, and 3.94 - 44.52%, respectively. The Lactobacillus sp FBB 60 and Lactobacillus sp FBB 81 showed the high antioxidant activity compared to the others lactobacilli. The antioxidant activity of Lactobacillus sp FBB 60 were 61,20%, 46,37%, 31,54% and the activity of Lactobacillus sp FBB 81 were 57,01%, 29,31% 44,52 for the lipid peroxidation inhibitory activity, hydroxyl radical scavenging activity and ferrous chelating activity, respectively. This finding implied that the Lactobacillus sp FBB 60 and Lactobacillus sp FBB 81 are promising strain to be developed as antioxidative probiotic.

Antioxidant Activity of Lactobacillus spp as for Development of Antioxidantive Probiotic Komang Ayu Nocianitri; I Nengah Sujaya; Yan Ramona
Media Ilmiah Teknologi Pangan (Scientific Journal of Food Technology) Vol 3 No 1 (2016)
Publisher : Master Program of Food Science and Technology, Faculty of Agricultural Technology, Udayana University

Show Abstract | Download Original | Original Source | Check in Google Scholar

Probiotics are live microorganisms which when administered in adequate amount confer health benefit to the host. Our previous studies revealed that Lactobacillsus spp isolated from infant feces potential to be developed as probiotics. Since the functionality of probiotic is strain specific, it is worth to screen the antioxidant activity of those lactobacilli, which will be developed as antioxidative probiotic. The aim of this study was to screen antioxidant activities of Lactobacillus spp isolated from infant feces. A numbers of 20 Lactobacillus spp strains isolated from infant feces were used in this study. The antioxidant activities was determined in in vitro studies by measuring the lipid peroxidation, hydroxyl radical scavenging activity, and ferrous chelating activity. The result showed that inhibitory activity of lipid peroxidation, hydroxyl radical scavenging activity, and ferrous chelating activity exerted by of Lactobacillus spp was 10.12 - 83.02%, 16,50-46,73%, and 3.94 - 44.52%, respectively. The Lactobacillus sp FBB 60 and Lactobacillus sp FBB 81 showed the high antioxidant activity compared to the others lactobacilli. The antioxidant activity of Lactobacillus sp FBB 60 were 61,20%, 46,37%, 31,54% and the activity of Lactobacillus sp FBB 81 were 57,01%, 29,31% 44,52 for the lipid peroxidation inhibitory activity, hydroxyl radical scavenging activity and ferrous chelating activity, respectively. This finding implied that the Lactobacillus sp FBB 60 and Lactobacillus sp FBB 81 are promising strain to be developed as antioxidative probiotic.

Gut microbiota in stunting children: literature review Putu Nita Cahyawati; I Nengah Sujaya
Bali Anatomy Journal Vol 4 No 1 (2021): Bali Anatomy Journal (BAJ)
Publisher : Department of Anatomy, Medical Faculty, Universitas Udayana, Bali-Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36675/baj.v4i1.51

Background: Stunting is one of the chronic nutritional problems experienced by children around the world. Indonesia currently occupies the top three countries with the highest prevalence of stunting in Southeast Asia. Children who suffer stunting are generally more susceptible to disease and are at risk of developing degenerative diseases. Stunting does not only affect health but can also affect the level of intelligence of children. Review: There was an association between stunting and components of the gastrointestinal microbiota (gut microbiota). The gut microbiota in each child is different. It was influenced by various factors such as age, food consumed, and location of residence. Nutritional status, history of recurrent infections, and chronic inflammation of the intestine play an important role in the differences in gut microbiota in stunting children compared to normal children. Conclusion: Although it was known that there is a link between stunting and the components of the gut microbiota, the exact mechanism still needs further research.

Front Cover & TOC Volume 9 Issue 2 (Agustus 2022) I Nengah Sujaya
ARCHIVE OF COMMUNITY HEALTH Vol 9 No 2 (2022): Agustus 2022
Publisher : Program Studi Sarjana Kesehatan Masyarakat Universitas Udayana Berasosiasi Dengan Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI)

Show Abstract | Download Original | Original Source | Check in Google Scholar

Jurnal Arc. Com. Health merupakan jurnal elektronik (e-journal) resmi yang diterbitkan oleh PSSKM (Program Studi Sarjana Kesehatan Masyarakat) Fakultas Kedokteran Universitas Udayana. Berikut adalah front cover dan table od content dari Volume 9 Issue 2 (Agustus 2022).

Title

Found 40 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 40 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 40 Documents
Search