Article Per Year (5 Year)
p-Index From 2020 - 2025
2.727
P-Index
This Author published in this journals
All Journal Journal of Food and Pharmaceutical Science CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Archive of Community Health Jurnal Kimia (Journal of Chemistry) METAMORFOSA Journal of Biological Sciences Buletin Udayana Mengabdi Jurnal Farmasi Udayana INDONESIAN JOURNAL OF BIOMEDICAL SCIENCES Jurnal Veteriner Jurnal Biologi Udayana SIMBIOSIS Journal of Applied Chemical Science Jurnal Farmasi Klinik Indonesia SINTECH (Science and Information Technology) Journal JFIOnline Journal of Health Sciences and Medicine Journal Sport Science, Healt and Tourism of Mandalika (Jontak) COMSERVA: Jurnal Penelitian dan Pengabdian Masyarakat Innovative: Journal Of Social Science Research Prosiding Workshop dan Seminar Nasional Farmasi (WSNF) Journal of Food and Pharmaceutical Sciences Jurnal Global Ilmiah
Sagun Chandra Yowani
Program Studi Sarjana Farmasi, Fakultas Matematika Dan Ilmu Pengetahuan Alam, Universitas Udayana
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Economics, Econometrics & Finance Education Electrical & Electronics Engineering Environmental Science Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Medicine & Pharmacology Neuroscience Public Health Social Sciences Veterinary Other

Published : 54 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 8 Documents
Search
Journal : CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry)

 1 
DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION Luk Ketut Budi Maitriani; I Nengah Wirajana; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (230.013 KB)

Abstract

ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen). Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB) mencakup kodon 94 (nukleotida 280-282). Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077). Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR). Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit) serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), interaksi primer (dimers dan hairpins), stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA) 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.  ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen). The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB) clinical isolates include codon 94 (nucleotide 280-282). Codon 94 of inhA gene is frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077). Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes) with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen) such as: primer length, %GC, Tm (melting temperature), primers interaction (dimers and hairpins), stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA) 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.  
DESAIN DNA PELACAK SECARA IN SILICO SEBAGAI PENDETEKSI MUTASI PADA GEN embB Mycobacterium tuberculosis Ade Ari Sundari; Ni Putu Monica Rosdiana Dewi Paramitha; Sagung Chandra Yowani; Putu Sanna Yustiantara
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 8 No 1 (2020): Volume 8, Nomor 1, 2020
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

ABSTRAK: Terapi lini pertama Tuberkulosis (TB) selalu menggunakan terapi kombinasi yaitu rifampisin, isoniazid, etambutol, dan pirazinamid. Penggunaan etambutol dalam terapi kombinasi TB digunakan untuk mencegah terjadinya resistensi terhadap obat lain namun tingkat resistensi etambutol secara bertahap meningkat. Mutasi pada operon embCAB bertanggung jawab pada resistensi etambutol dengan prevalensi tertinggi terjadi pada kodon 306 gen embB. Mutasi pada gen embB kodon 306 juga dikaitkan dengan adanya kecenderungan resistensi akibat peningkatan konsumsi obat sehingga dijadikan sebagai kandidat potential marker untuk board drug resistance, khususnya untuk MDR-TB. Penelitian ini akan mendesain urutan nukleotida TaqMan probe untuk mendeteksi mutasi M306I menggunakan program Clone Manager Suite 9.2. Hasil rancangan probe DNA kemudian dianalisis berdasarkan kriteria probe secara umum dan berdasarkan kriteria pelabelan TaqMan probe. Rancangan probe DNA mutan menggunakan program menghasilkan 10 probe yang memenuhi kriteria probe secara umum untuk mutasi M306I pada gen embB. Berdasarkan analisa pelabelan TaqMan probe, diperoleh 7 probe (E306MI4, E306MI5, E306MI6, E306MI7, E306MI9, E306MI10, dan E306MI13) untuk deteksi mutasi M306I pada gen embB. Hasil rancangan probe mutan yang telah memenuhi kriteria pelabelan TaqMan probe dapat digunakan untuk mendeteksi adanya mutasi kodon 306 gen embB Mycobacterium tuberculosis. Hasil perancangan TaqMan probe perlu diuji secara eksperimental untuk membuktikan efisiensi kerja dari probe tersebut agar dapat digunakan pada metode Real-Time PCR. ABSTRACT: First-line Tuberculosis (TB) therapy always uses combination therapy, such as rifampicin, isoniazid, ethambutol, and pyrazinamide. Ethambutol was effective for preventing treatment failures caused by Mycobacterium tuberculosis isolates resistant to other anti-TB drugs however, the resistance rate of ethambutol has gradually increased. Mutations in the embCAB operon have been identi?ed to confer resistance to ethambutol, with embB codon 306 being the most frequently affected. embB306 mutations are associated a tendency for resistance due to increasing numbers of antibiotics consumption so it may be a potential marker for broad drug resistance, especially for MDR-TB. This research design the TaqMan probe nucleotide sequence for the M306I spesific mutation using the Clone Manager Suite 9.2 program. The results of the DNA probe design were then analyzed based on probe criteria in general and based on the TaqMan probe labeling criteria. The mutant DNA probes design using the program produced 10 probes thats have met the general probe criteria for the M306I mutation in the embB gene. Based on the TaqMan probe labeling analysis, theres 7 probes (E306MI4, E306MI5, E306MI6, E306MI7, E306MI9, E306MI10 and E306MI13) for the detection of M306I mutations in the embB gene. The results of the mutant probe design that has met the TaqMan labeling criteria can be used to detect mutations in M. tuberculosis embB gene codon 306. The results of the TaqMan probe need to be tested experimentally to prove the working efficiency of the probe so that it can be used in the Real-Time PCR method.
ISOLASI DNA METAGENOMIK DARI SPUTUM PASIEN TUBERKULOSIS DAN AMPLIFIKASI DENGAN PRIMER PROMOTER inhA Ni Made Yustikarini; Sagung Chandra Yowani; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 3 No 3 (2015)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (220.918 KB)

Abstract

 ABSTRAK: Penelitian ini bertujuan untuk memperoleh DNA metagenomik dari sputum pasien tuberkulosis dan mengamplifikasi dengan menggunakan primer promoter inhA. Penelitian ini dilakukan dalam tiga tahap, yaitu: isolasi DNA metagenomik dari sputum pasien tuberkulosis, amplifikasi menggunakan sepasang primer promoter inhA dari M. tuberculosis dengan metode PCR, dan elektroforesis gel agarosa terhadap hasil amplifikasi. Elektroforegram hasil amplifikasi menunjukkan bahwa isolasi DNA metagenomik dari sputum pasien tuberkulosis telah berhasil dilakukan dengan metode modifikasi maupun dengan kit. Ukuran pita fragmen DNA sekitar 284 bp dari hasil amplifikasi (amplikon) yang diperoleh dari DNA metagenomik sputum P.48B, P.46B, dan P.47B  MDR- TB  merupakan ukuran yang sesuai dengan bagaian dari daerah promoter inhA M. tuberculosis. Ukuran amplikon ini sama dengan ukuran amplikon yang sebelumnya telah diperoleh dari amplifikasi terhadap DNA M. tuberculosis oleh peneliti sebelumnya dengan menggunakan primer yang sama.ABSTRACT: The aims of this research were to obtain metagenomic DNA from sputum of tuberculosis patients and to amplify it by using inhA promoter primer. This research was conducted in three steps covering the DNA metagenomic isolation from sputum of tuberculosis patients, amplification of inhA promoter region of M. tuberculosis by using specific primer pair by PCR (Polymerase Chain Reaction) method, and electrophoresis of amplified products using agarose gel. The electrophoregram of amplified products showed that the metagenomic DNA isolation from sputum of tuberculosis patients was successfully carried out both by the modified method and by a kit. The size of DNA fragment bands about 284 bp of amplified products (amplicons) which obtained from the metagenomic DNAs of P.48B, P.46B, P.47B sputum was suitable size with a part of inhA promoter region of M. tuberculosis. The size of these amplicons was the same size with the amplicons from M. tuberculosis DNA reported by other researchers.
OPTIMASI SUHU ANNEALING DAN AMPLIFIKASI 0,3 kb GEN rpoB DI HULU DARI RRDR PADA ISOLAT P16 Mycobacterium tuberculosis MULTIDRUG RESISTANT DI BALI DENGAN METODE POLYMERASE CHAIN REACTION Putu Lita Astriani; Ketut Ratnayani; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 2 No 2 (2014)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (224.578 KB)

Abstract

ABSTRAK: Mutasi di hulu dari RRDR diindikasikan sebagai adanya low level resistence [1].   Untuk mendapatkan titik mutasi di hulu dari RRDR maka perlu dilakukan amplifikasi fragmen DNA target. Tujuan dari penelitian ini adalah untuk mengetahui suhu annealing optimum untuk mengamplifikasi daerah hulu dari RRDR menggunakan  isolat P16 Multidrug Resistant Tuberculosis (MDR-TB) yang didapatkan dari RSUP Sanglah. Proses isolasi DNA dilakukan dengan metode Boom  termodifikasi. Deteksi  produk PCR dilakukan dengan elektroforesis gel agarosa 1,5% b/v dan divisualisasi pada alat UV Transiluminator. Hasil dari penelitian ini diketahui bahwa dengan proses PCR menggunakan sepasang primer FrL2 dan RevL2 dengan suhu annealing optimum 580C dapat mengamplifikasi daerah hulu dari RRDR berukuran 0,3 kb.  ABSTRACT: Mutations at the upstream of RRDR indicated as the presence of low level resistance [1].  To find a point mutation at the upstream of RRDR it is necessary to amplify of the target DNA fragment. The aim of this research was to determinate the optimum annealing temperature to amplify the upstream  region of the RRDR using isolate from Sanglah Hospital. Isolation DNA procesed by Boom  modification  method. Product PCR detected using agarosa gel 1,5% b/v and was visualisation by UV Transiluminator. The results of this research, by PCR method using the pairs primer FrL2 and RevL2 with optimum annealing temperature 580C, can amlplify 0,3 kb the upstream region of RRDR.
AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION Devita Kusdianingrum; Sanna Yustiantara; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 2 No 2 (2014)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (236.542 KB)

Abstract

ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’). Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT) pada posisi -15 isolat 134 MDR-TB ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR) technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog by 99% of M. tuberculosis H37Rv. The mutation of cytosine to thymine (CàT) was found occurring at position -15 of isolate 134 MDR-TB.  
DESAIN PELACAR DNA SECARA IN SILICO SEBAGAI PENDETEKSI RESISTENSI FLUOROQUINOLONE PADA ISOLAT MULTI DRUG RESISTANT TUBERCULOSIS Sagung Chandra Yowani; Jennifer Tamara; Ayu Nyoman Chandra Yustiana; Putu Sanna Yustiantara
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 7 No 2 (2019): volume 7, Nomor 2, 2019
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (498.244 KB)

Abstract

ABSTRAK: Resistensi fluoroquinolone (FQ) pada Multi Drug Resistant Tuberculosis (MDR-TB) umumnya disebabkan oleh adanya sejumlah mutasi pada beberapa gen yang mengkode sensitivitas Mycobacterium tuberculosis dan sebagian besar terjadi pada gen gyrA. Mutasi pada kodon 94 gen gyrA merupakan mutasi yang paling sering terjadi dengan 7 variasi perubahan asam amino. Resistensi FQ dapat dideteksi menggunakan DNA probe yang spesifik agar dapat memberi terapi yang tepat pada pasien. Penelitian ini akan mendesain urutan nukleotida TaqMan probe menggunakan program Clone Manager Suite 9.2. Hasil rancangan DNA probe kemudian dianalisis dalam 2 tahap. Tahap pertama berdasarkan kriteria probe secara umum yaitu panjang (18-30 basa), %GC (40-60%), Tm (5-10°C lebih tinggi dibanding Tm primer), runs (? 4), repeats (? 4), dimer (? 4), dan tidak terbentuk hairpin. Selanjutnya tahap kedua berdasarkan kriteria pelabelan TaqMan probe, yaitu tidak terdapat basa G pada 2 nukleotida di ujung 5’ dan jumlah basa C ? G. Rancangan DNA probe mutan menggunakan program menghasilkan 1 probe untuk mutasi spesifik D94G. Probe tersebut dianalisa dengan kriteria probe secara umum dan kriteria pelabelan TaqMan probe. Kesimpulan dari penelitian ini yaitu hasil rancangan probe mutan A94MG1 dengan urutan 5’ – TCGATCTACGGCAGCCTGGT – 3’ telah memenuhi kriteria pelabelan TaqMan probe dan dapat digunakan untuk mendeteksi adanya mutasi pada kodon 94 gen gyrA Mycobacterium tuberculosis. Kata kunci: MDR-TB, gen gyrA, in silico, TaqMan probe, Real-Time PCR ABSTRACT: Fluoroquinolone (FQ) resistance in Multi Drug Resistant Tuberculosis (MDR-TB is generally caused by some mutations in several genes that encode the sensitivity of Mycobacterium tuberculosis and most of them occur in gyrA gene. Mutations in codon 94 gyrA gene are the most common mutations with 7 variations in amino acid changes. FQ resistance can be detected using a spesific DNA probe to provide the precise therapy for the patient. This research will design the TaqMan probe nucleotide sequence using the Clone Manager Suite 9.2. program. The results of designing DNA probes were then analyzed by 2 stages. The first stage is based on criteria of the probe in general which is length (18-30 bases), GC% (40-60%), Tm (5-10°C higher than primer Tm), runs (? 4), repeats (? 4), dimer (? 4), and hairpin is not formed. Second stage is examination based on the labeling criteria for TaqMan, that is no G base at 2 nucleotides at the end of 5’ and the amount of bases C ? G. The mutant DNA probe design using the program produced 1 probe for the D94G specific mutation. The probe was analyzed with general criteria and TaqMan probe labeling. The conclusion of this study is A94MG1 mutant probe design have met the TaqMan probe labeling criteria and can be used to detect mutations in the Mycobacterium tuberculosis gyrA gene codon 94.
DESAIN DNA PRIMER SECARA IN SILICO SEBAGAI PENDETEKSI MUTASI GEN gyrA Mycrobacterium tuberculosis UNTUK METODE POLYMERASE CHAIN REACTION Luh Vida Sasmitha; Putu Sanna Yustiantara; Sagung Chandra Yowani
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 6 No 1 (2018): Volume 6, Nomor 1, 2018
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (388.339 KB)

Abstract

ABSTRAK: Penelitian ini bertujuan untuk mendesain DNA primer yang digunakan untuk mengamplifikasi gen gyrA dengan metode PCR. Gen gyrA bertanggung jawab dalam resistensi fluorokuinolon yang merupakan inti regimen dari MDR-TB. Resistensi fluorokuinolon merupakan penanda terjadinya Extensively Drugs Resistance Tuberculosis (XDR-TB). XDR-TB merupakan tuberkulosis yang terjadi akibat adanya resistensi terhadap isoniazid, rifampisin dan fluorokuinolon serta terhadap salah satu obat anti tuberkulosis lini kedua dalam bentuk injeksi (amikasin, kanamisin dan kapreomisin). Pada penelitian ini desain primer dilakukan secara in silico dengan menggunakan program Clone Manager Suite 6 (University of Groningen). Urutan nukleotida gen gyrA Mycrobacterium tuberculosis yang digunakan sebagai cetakan (template) diakses dari website www.ncbi.nlm.niv.gov (GenBank : AL123456.3). Primer dipilih berdasarkan kriteria dari Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), stabilitas, repeats, runs, interaksi primer (dimers dan hairpins) dan false priming. Hasil penelitian mendapatkan sepasang primer dengan panjang masing-masing 19 basa, yaitu primer forward 5’-GCAGCTACATCGACTATGC-3’ (3-S1) dan primer reverse 5'-GGCTTCGGTGTACCTCATC-3’ (4-S1). Pasangan primer ini mampu mengamplifikasi sekuens gen gyrA sebesar 320 pb (nukeotida 90-380) dengan kondisi PCR pada suhu 95°C selama 15 menit untuk proses predenaturasi, diikuti 40 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 58°C selama 1 menit 20 detik, elongasi pada suhu 72°C selama 2 menit) serta proses elongasi akhir dilakukan pada suhu 72°C selama 10 menit. Kata kunci: Primer, in silico, gyrA, PCR ABSTRACT: The aim of this study is to design DNA primer that amplifying gyrA gene using PCR method. The gyrA gene is responsible to fluoroquinolone resistance which is the main drug of MDR-TB regimen. Fluoroquinolone resistance is marker of Extensively Drugs Resistance Tuberculosis (XDR-TB). XDR-TB is a type of tuberculosis (TB) that is resistant to at least isoniazid, rifampicin and fluoroquinolone and/or to second-line anti-tuberculosis drugs (amykacin, kanamycin and capreomycin). In this study, primer design were reconstruct in silico using Clone Manager Suite 6 program (University of Groningen). Nucleotide sequence of gyrA accessed from www.ncbi.nlm.niv.gov (GenBank: AL123456.3). The primer was chosen based on the criteria of Clone Manager Suite 6 (university of Groningen), including primer length, %GC, Tm (melting temperature), stability, repeats, runs, primer interaction (dimers and hairpins) and false priming. The result of this research were a pair of primers which each length is 19 bases, e.g. forward primer 5’-GCAGCTACATCGACTATGC-3’ and reverse primer 5’-GGCTTCGGTGTACCTCATC 3’. PCR product of these primers is 320 pb (nucleotide 90-380), in predenaturation at 95°C for 15 minutes and followed by 40 cycles of amplificarion (denaturation at 94°C for 1 minutes, annealing at 58°C for 1 minutes 20 seconds, and extension at 72°C for 2 minutes) with final extension at 72°C for 10 minutes.
DETEKSI MUTASI KODON 510 dan 511 DAERAH RRDR GEN rpoB PADA ISOLAT KLINIK Mycobacterium tuberculosis MULTIDRUG RESISTANT DI BALI DENGAN PCR-RESTRICTION FRAGMENT LENGHT POLYMORPHISM Made Rai Dwitya Wiradiputra; Sagung Chandra Yowani; I Nengah Wirajana
CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry) Vol 4 No 2 (2016)
Publisher : Magister Program of Applied Chemistry, Udayana University, Bali-INDONESIA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (481.671 KB)

Abstract

ABSTRAK: Tujuan penelitian ini adalah untuk melakukan deteksi mutasi daerah RRDR gen rpoB Mycobacterium tuberculosis khususnya pada kodon 510 dan 511 dari isolat klinis Multidrug Resistant Tuberculosis (MDR-TB) di Bali dengan metode Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR-RFLP). Isolat M. tuberculosis H37Rv digunakan sebagai kontrol bakteri yang tidak mengalami mutasi dan empat isolat klinis MDR-TB digunakan sebagai sampel pada penelitian ini. Proses PCR-RFLP meliputi dua tahap, yaitu amplifikasi (PCR) dan digesti. Produk PCR hasil amplifikasi didigesti dengan enzim PvuII (New England Biolabs) melalui proses inkubasi pada suhu 37oC selama 3 jam diikuti dengan inaktivasi ice shock pada suhu -20oC selama 5 menit. Hasil penelitian ini menunjukan bahwa enzim restriksi PvuII dapat mendeteksi mutasi kodon 510 dan 511 daerah RRDR gen rpoB M. tuberculosis dengan teknik PCR-RFLP. Pada isolat 134 diketahui terdapat mutasi pada kodon 510 dan/atau 511 sedangkan pada isolat P10, P11, dan P16 tidak ditemukan adanya mutasi pada kodon 510 dan 511. Berdasarkan hasil penelitian sebelumnya, diketahui pula bahwa mutasi yang terjadi pada isolat 134 adalah mutasi kodon 510 (CAG?CTG).   ABSTRACT: The objective of this study is to detect mutation in the region of RRDR of rpoB gene Mycobacterium tuberculosis particularly at codon 510 and 511 from MDR-TB clinical isolates in Bali using Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR-RFLP) method. Isolate of M. tuberculosis H37Rv was used as control of non-mutated bacteria, and four MDR-TB clinical isolates were used for sample in this study. PCR-RFLP was conducted in two steps which were amplification (PCR) and digestion. PCR products were digested using PvuII restriction enzyme (New England Biolabs) through incubation at 37oC for 3 hours followed by ice shock inactivation at -20oC for 5 minutes. The result of this study showed that PvuII restriction enzyme could detect mutation of codon 510 and 511 in the region of RRDR of rpoB gene M. tuberculosis using PCR-RFLP. In isolate 134, mutation at codon 510 and/or 511 was found while there were no mutation of codon 510 and 511 detected in isolate P10, P11, and P16. Based on previous research, it was found that the mutation occurred in isolate 134 was at codon 510 (CAG?CTG).
Co-Authors A. W. Dwiputri Ade Ari Sundari Ade Ari Sundari Amelia Putri, Ni Luh Dian Saptari Arifani Siswidiasari Asmara A. A. R. Astuti, M.A.P. Ayu Nyoman Chandra Yustiana Ayu Putu Chika Iswari Anjani, Sang Cista Dewi, Ni Putu Fiona Dek Pueteri Dewi Suryani Deniariasih, N.W. Devi, Ni Wayan Antika Sri Devita Kusdianingrum Dewa Ayu Swastini Dewi Andayani Farmawati Dwicandra, N.M.O. Dyah Subadrika Warma Dewi Endang Kumolosasi Gede Bayu Surya Ekayana, I Heni Pujiastuti I Gede Ketut Sajinadiyasa I Gusti A. A. Santhi Rahmaryani I Gusti Ayu Agung Septiari I Ketut Juniarta I Ketut Tunas I Made Dira Swantara I Nengah Wirajana I Nyoman Gede Budiana I Wayan Kasa Ida Ayu Gendari Ida Ayu Ratih Dwi Nugraha Putri Ida Bagus Nyoman Putra Dwija Indra Juana Adikara Jennifer Tamara Jennifer Tamara Kadek Ratna Sari Dewi Kadek Widya Yuli Hartati Ketut Ratnayani Ketut Widyani Astuti Liangky Syane S Luh Vida Sasmitha Luk Ketut Budi Maitriani M. A. Pratiwi Made Dharmesti Wijaya Made Rai Dwitya Wiradiputra Marfu'ah, Nurul Marlia Singgih Wibowo Mirawati N.K.W. Ni Kadek Ari Cipta Pratiwi Ni Kadek Ariani Ni Ketut Sri Anggreni Ni Komang Sasi Ani Ni Made Febrianti Ni Made Yustikarini Ni Nyoman Pradnya Utari Ni Putu Ariantari Ni Putu Intan Satya Dewi Ni Putu Monica Rosdiana Dewi Paramitha Ni Wayan Sukma Pramitha Sari1 Osamu Iitsuka Pradnyaniti, D.G Putri, Ni Kadek Sri Adnyani Alit Putu Ayu Indrayathi Putu Lita Astriani Rasmaya Niruri Ratna Sari Dewi, Kadek Rini Noviyani Sang Ayu Putu Chika Iswari Anjani Saputra, Gusti Nyoman Oka Sari Dewi, Kadek Ratna Sudarma, I Wayan Ari Syamsul Arifin Tasya Pramiswari Tirtawati, Ni Putu Ayu Wijayakusuma, I Gusti Ngurah Lanang Yayanasri Yustiantara, Putu Sanna