Article Per Year (5 Year)
p-Index From 2021 - 2026
1.984
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Natural Science: Journal of Science and Technology Jurnal Natur Indonesia JBIO: jurnal biosains (the journal of biosciences) Pendidikan Biologi Jurnal Biologi Universitas Andalas Al Ilmi BioCONCETTA Jurnal Biologi Tropis Jurnal Riset Akuakultur International Journal of Agricultural Sciences Jurnal Pembangunan Nagari Jurnal Pembelajaran dan Biologi Nukleus Jurnal Pengabdian kepada Masyarakat Nusantara Warta Pengabdian Andalas: Jurnal Ilmiah Pengembangan Dan Penerapan Ipteks Berkala Penelitian Hayati Jurnal Bioleuser Biodiversitas Journal of Biological Diversity
Dahelmi Dahelmi
Laboratorium Taksonomi Hewan, Jurusan Biologi FMIPA Universitas Andalas
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Medicine & Pharmacology Public Health Social Sciences Other

Published : 52 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 52 Documents
Search

 2   3   4   5   6 
Potensi Keterlibatan Multipihak dan Pendampingan Perguruan Tinggi berkelanjutan bagi Pengembangan Ekowisata Kapalo Banda dengan Daya tarik Utama Pembudidayaan Lebah Tanpa Sengat (Apidae: Meliponinae). Henny Herwina; Jasmi; Dahelmi; Mansyurdin; Syamsuardi; Jabang Nurdin; Nofrita; Muhammad Nazri Janra; Rita Maliza; Eli Ratni; Muhammad Idris; Putra Santoso; Miftahul Ilmi; Nabilah Rahmachila Azura; Syakira Tiara Rezvi; Elni Fatimah; Fajri Hidayat; Jefrial Santoso
Warta Pengabdian Andalas Vol 32 No 1 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.1.108-119.2025

Abstract

The development of ecotourism in Kapalo Banda, Limau Manis, Padang, has potential to be expanded into agro-ecotourism through multi-stakeholder involvement. Key attractions include the scenic of river flows, agricultural cultivation, and stingless bee keeping, which support environmental sustainability and the local economy. With high vegetation diversity, the potential for stingless bee (galo-galo) breeding as a creative economic initiative offers new opportunities. This program aligns with the West Sumatra Provincial Government’s efforts to establish the area as a honey production center. However, challenges such as low colony production due to limited knowledge of farming techniques and the availability of flowering feed hinder its development. Through community engagement, empowerment activities were conducted from June to September 2024, including socialization, demonstrations, and training in bee farming techniques, supported by expert teams. Education focused on the potential of galo-galo and marketing strategies for local products. The results of this program indicate improved community skills and knowledge, supporting local economic sustainability and biodiversity conservation. Kapalo Banda partners have the potential to serve as a model for community empowerment based on natural resources, effectively enhancing community welfare. Multi-stakeholder involvement in developing Kapalo Banda Ecotourism has resulted in a series of activities ranging from cultivation preparation, colony propagation techniques, harvest preparation, to downstream processing and product marketing.
Potential of Stingless Beekeeping in Community Empowerment Strategy for Building Sustainable Creative Economy in a Forest Farmer Group of Puncak Labuang, Padang City Herwina, Henny; Jasmi , Jasmi; Dahelmi, Dahelmi; Ratni, Eli; Janra, Muhammad Nazri; Ilmi, Miftahul; Azura, Nabilah Rahmachila; Rezvi, Syakira Tiara
Warta Pengabdian Andalas Vol 32 No 3 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.3.343-356.2025

Abstract

The Forest Farmer Group of Puncak Labuang (FFGPL) manages a 194-hectare community forest in Limau Manis, Padang, contributing to the livelihood of community through agriculture and ecotourism. The forest productivity comes as high-value commodities such as durian, mangosteen, and coffee, as well as ecotourism activities like camping and hiking; all of which boost local economy while sustaining the surrounding environmental. Having diverse vegetation, the forest presents an opportunity for farming the stingless bee (galo-galo) as a promising innovative economic initiative. This program aligns with the program of West Sumatra Provincial Government to achieve position as production centre for honey. Some challenges such as low production of bee colonies appear from the lack of knowledge in farming techniques and insufficiency of food sources for colonies which hinder the progress. From June to December 2024, a community service program had been implemented to address these challenges. Activities included socialization, demonstrations, and training in bee farming techniques, supported by a team of experts. The education focused on the potential of galo-galo farming and strategies for marketing local products. Additionally, training sessions for Micro, Small, and Medium Enterprises (MSMEs), along with honey product exhibitions, had successfully raised public awareness and improved the competitiveness of local products. As a result of this program, there was a notable improvement in community skills and knowledge, contributing to the sustainability of local economy and preservation of biodiversity. FFGPL has the potential to become a model for community empowerment based on natural resources, leading to significant improvements in community welfare.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Kolaborasi Lintas Negara: Integrasi Biologi Terapan dan Budaya Minangkabau dalam Pengabdian Masyarakat Internasional di Universiti Malaya Mildawati, Mildawati; Solfiyeni, Solfiyeni; Nurmiati, Nurmiati; Dahelmi, Dahelmi; Audina, Zikkra
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 6 No. 3 (2025): Edisi Juli - September
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v6i3.6560

Abstract

Kegiatan pengabdian masyarakat internasional ini merupakan bentuk kolaborasi akademik dan sosial antara Universitas Andalas (UNAND) dan Universitas Malaya (UM), yang turut melibatkan komunitas lokal seperti Bundo kanduang Kerapatan Adat Nagari (KAN) Limau Manis dan Ikatan Keluarga Minangkabau Malaysia (IKMM). Tujuan utama kegiatan ini adalah memperkuat hubungan kelembagaan melalui lokakarya biologi terapan dan pertukaran pengetahuan berbasis nilai-nilai budaya Minangkabau. Permasalahan yang diidentifikasi mencakup terbatasnya integrasi pengetahuan biologis dalam konteks lintas budaya dan kurangnya media komunikasi efektif antar komunitas akademik dan masyarakat. Dengan pendekatan partisipatif, kegiatan ini meliputi lokakarya tematik, diskusi ilmiah, serta pertunjukan budaya yang menampilkan artefak tradisional seperti piring hitam yang masih tersimpan dan relevan hingga kini di Museum Universiti Malaya. Hasil kegiatan menunjukkan peningkatan pemahaman peserta terhadap penerapan biologi dalam kehidupan sehari-hari dan penguatan jejaring kerja sama antara institusi pendidikan dan masyarakat adat. Pendekatan berbasis budaya lokal terbukti efektif dalam menjembatani perbedaan dan memperkuat komunikasi ilmiah lintas negara. Kegiatan ini memberikan kontribusi penting dalam mendukung diplomasi akademik, pelestarian budaya, dan pemberdayaan masyarakat melalui ilmu hayati.
Penggunaan Perangkap Feromon dalam Studi Kepadatan Populasi, Kelimpahan, dan Sex Rasio Kumbang Badak Oryctes rhinoceros L. di Perkebunan Kelapa Sawit PTPN 1, Langsa, Aceh Suwarno Suwarno; Tashania Tashania; Alia Rizki; Irvianty Irvianty; Cut Nanda Defira; Zuriana Siregar; Dahelmi Dahelmi
Jurnal Bioleuser Vol. 10 No. 1: April 2026
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24815/jurnalbioleuser.v10i1.1489

Abstract

This study aims to estimate the population density, abundance, and sex ratio of rhinoceros beetles (Oryctes rhinoceros L.) at different growth phases of oil palm in PTPN I plantations, Langsa Baro District. This study was conducted from June to November 2023. The method used was an experimental method. Traps were installed in four sampling blocks, each covering an area of ​​20 Ha, namely immature plants (TBM), sand fruit phase (BP), productive plants aged 4-8 years (TM 4-8) and productive plants aged >10 years (TM >10). A total of eight trap units per plant growth phase were installed systematically with a distance between traps of 400 m. The results of the study obtained 100 individuals of rhinoceros beetles in all growth phases. The average population density was 1.25 individuals/Ha and abundance was 3,125 individuals/trap. Consistent pest management carried out in PTPN I oil palm plantations is suspected to affect the results obtained. The abundance of rhinoceros beetles trapped in the BP phase was the highest (4 individuals/trap) and was significantly different from the TM (4-8) and TM (>10) phases. There were more female rhinoceros beetle imagos trapped than male imagos, with a male:female sex ratio of 1:1.64. Future studies are needed to compare this with community-owned oil palm plantations, especially regarding the population and level of rhinoceros beetle infestation.
Alopecia in Bats from Tropical Urban Islands Fauziah Syamsi; Wilson Novarino; Dahelmi Dahelmi; Chairul Chairul
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7188

Abstract

Background: Alopecia or alopecic syndrome is a hair loss condition on the body. Alopecia is caused by a wide variety of factors both internal to the individual (i.e. androgen activity, nutritional deficiencies, metabolic stress, hormonal imbalances) and external (i.e. human-induced pressures, allergens, ectoparasites, fungal dermatitis, bacterial, toxicities, environmental contaminant exposure, idiopathic disease, poor habitat conditions, anthropogenic activities, zinc deficiency, and ingestion of plant toxins). Methods: This study was conducted at four locations in Batam City, consisting of two fragmented forests in the city center and two islands far from the city area. Bats were captured using mist nets and harp traps with a total sampling effort of 120 net nights and 120 harp trap nights. Findings: This study captured 417 bats across seven species, with an overall alopecia prevalence of 10.79 %. The highest prevalence was found in Pipistrellus tenuis (100%), Kerivoula pellucida (50 %), and Macroglossus minimus (20 %), likely due to the small sample sizes of these species. Larger sample sizes resulted in lower prevalence rates: Balionycteris maculata (22.2 %), Cynopterus horsfieldii (11.1 %), C. brachyotis (9.2 %), and C. sphinx (6.86 %). The most severe hair loss generally occurs on the shoulders and neck. Some individuals show hair loss on the back, head, chest, abdomen, and other parts of the body. Alopecia is found in both males and females from mild to severe. The prevalence of alopecia in all species was higher in fragmented forests in urban to periurban, and rural areas. This was associated with differences in the level of anthropogenic pressure. Contribution: These findings provide a scientific contribution to understanding the relationship between alopecia in bats and anthropogenic pressures and highlight the importance of habitat conditions in population health in fragmented environments.
Molecular identification of coffee (Coffea arabica) pollinator insects in North Sumatra, Indonesia based on designed COI primers AIDA FITRIANI SITOMPUL; ELIDA HAFNI SIREGAR; DEWI IMELDA ROESMA; DAHELMI DAHELMI; EKO PRASETYA
Biodiversitas Journal of Biological Diversity Vol. 19 No. 5 (2018)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d190539

Abstract

Sitompul FA, Siregar EH, Roesma DI, Dahelmi, Prasetya E. 2018. Molecular identification of coffee (Coffea arabica) pollinator insects in North Sumatra, Indonesia based on designed COI primers. Biodiversitas 19: 1877-1883. Coffee (Coffea arabica L.) is one of the most important economic commodities in the province of North Sumatra, Indonesia. Insects associated with pollination of C. arabica are one of the key factors for successful cultivation of C. arabica, but, the research regarding of these was still limited. The population of coffee plant is scattered across the highlands of Indonesia and the pollination of C. arabica is strongly believed linked to a diverse group of pollinating insects. However, lack of taxonomic identification of insects pollinating these plants has become one of constraints to succeed the cultivation of C. Arabica. This study aimed to analyze types and variations of pollinating insects of C. arabica in the province of North Sumatra, Indonesia, using DNA barcoding. DNA barcoding is now considered an alternative method of molecular identification. Sixteen of C. arabica flower visitors were captured in different planting location in North Sumatra province. Using mtDNA markers, the cytochrome oxidase subunit sequence I (COI), about 12 pollinator insect species were identified based on the COI sequence i.e Amegilla cingulata, Apis dorsata, Apis cerana, Trigona chanchamayoensis, Idiella divisa, Dolichopodidae sp., Allactoneura sp., Stomorhina discolor, Phytomia erratica, Rhiniidae sp., Melipona bicolor, and Hymenoptera sp.
Short Communication: The diversity of butterflies (Superfamily Papilionoidea) as a success indicator of tin-mined land revegetation DINDA WIRANTI; EDDY NURTJAHYA; DAHELMI DAHELMI
Biodiversitas Journal of Biological Diversity Vol. 20 No. 7 (2019)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d200719

Abstract

Abstract. Wiranti D, Nurtjahya E, Dahelmi. 2019. Short Communication: The diversity of butterflies (Superfamily Papilionoidea) as a success indicator of tin-mined land revegetation. Biodiversitas 20: 1923-1928. Some former tin-mining areas in Belitung District have been revegetated. With the increase of vegetation age, the environmental quality changes, and so does the diversity of insects living in the vegetated areas. The objective of this study was to propose the use of butterfly diversity as a success indicator of tin-mined land revegetation. The research was conducted at six locations in Belitung District, consisting of one tin-mined land that had not been revegetated, four revegetated tin-mined lands with different ages of vegetation, namely 1-5 years, 5-10 years, 10-20 years, more than 20 years, and primary forest in Gunung Tajam. The research used the Pollard walk method and specimens were obtained using insect nets. The results showed that the highest diversity of butterflies was recorded in primary forest (31 species), followed by vegetated mined lands with the following ages of vegetation: > 20 years (21 species), 10-20 years (15 species), 5-10 years (14 species ), and 1-5 years (7 species), and the lowest diversity was found in tin-mined land that had not been revegetated (2 species). The Shannon-Wiener diversity index in tin- mined land that had not been revegetated was low, namely 0.56 while in the revegetated tin mined land was medium, i.e., 1.47 – 2.96 and in primary forest was high, i.e., 3.2. The diversity of butterflies in revegetated land increased with the increasing age of vegetation, and the community similarity index between revegetated land and forest also increased with the increasing age of vegetation. Therefore, the diversity of butterflies may be used as a success indicator of revegetation in former tin mining areas.
Small carnivore diversity in forest patches around oil palm plantation in West Sumatra, Indonesia Inda Dwi Solina; Erizal Mukhtar; Wilson Novarino; Dahelmi Dahelmi
Biodiversitas Journal of Biological Diversity Vol. 24 No. 3 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240358

Abstract

Abstract. Solina ID, Mukhtar E, Novarion W, Dahelmi. 2023. Small carnivore diversity in forest patches around oil palm plantation in West Sumatra, Indonesia. Biodiversitas 24: 1824-1832. The accelerating rates of forest conversion into agricultural land are the main driver for biodiversity loss. How biodiversity, particularly secondary consumers, can adapt to different agricultural schemes is critical to conservation planning. Currently, small forests within oil palm plantations should receive more attention, especially as they are habitats for small carnivores, and it is still unknown how they respond to habitat change. We analyzed camera trap data from 2015 to 2018 in key High Conservation Value (HCV) forests in South Solok, West Sumatra: Kencana Sawit Indonesia company (forest patch A) and Tidar Kerinci Agung company (forest patches B and C). LecoS is used to collect landscape metrics data then evaluated using the Generalized Linear Models (GLM) to assess the impact of fragmentation on the presence of small carnivores in forest patches. The model with the lowest Akaike Information Criterion (AIC) value was the one we regarded to be the most acceptable. We found 12 species of small carnivores belonging to 4 families; six species were identified in patch A, ten in patch B, and only three in patch C. We identified that land covers are the most important parameter on the presence of small carnivores in oil palm plantations in West Sumatra based on GLM results. Due to the importance of forested regions to small carnivore diversity, we recommend increasing forest connectivity into and across oil palm landscapes.  
Co-occurrence of ectoparasites on wild rodents in Sipora Island, Mentawai, Indonesia with the zoonotic potential review MAIRAWITA MAIRAWITA; AHMAD MURSYID; DAHELMI DAHELMI; FITHRIA DINIYATI; DELA LIDIA; NOVIKA PUTRI; MARSHA M. ARIFA; JEFRIAL JEFRIAL; RYAN M. MAULANA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 11 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d241162

Abstract

Abstract. Mairawita, Mursyid A, Dahelmi, Diniyati F, Lidia D, Putri N, Arifa MM, Jefrial, Maulana RM. 2023. Co-occurrence of ectoparasites on wild rodents in Sipora Island, Mentawai, Indonesia with the zoonotic potential review. Biodiversitas 24: 6369-6376. A complex interaction between human existence and synanthropic rodents can facilitate the spillover of zoonotic diseases. This research provides valuable data regarding Rodentia species distribution, ectoparasites, and the potential for zoonotic transmission. In linked habitats, rodents were collected systematically using 70 live traps over 3 days. A total of 54 Rodentia individuals were assessed, belonging to 7 species: Mus musculus, Rattus tanezumi, R. tiomanicus, R. rattus, R. argentiventer, R. norvegicus, and Leopoldamys siporanus. Additionally, 7 species of ectoparasites (mites, ticks, and fleas) were identified, including Laelaps echidninus, Leptotrombidium delicense, Haemaphysalis longicornis, Ornithonyssus bacoti, Culicoides sp., Hoplopleura pasifica, and Polyplax spinulosa. Various ectoparasites infested all the captured rats. Laelaps echidninus showed the highest prevalence and relative abundance in plantation habitats (81.25% and 68.81) and human dwellings (72.73% and 89.73). Spearman correlation analysis revealed a strong positive correlation between prevalence-abundance of species ectoparasite (?. 0.955; p-value <0.01), while positive correlations between habitat types-prevalence (?. 0.439; p-value <0.01) and habitat types-abundance of species ectoparasite (?. 0.426; p-value <0.01). Negative correlations between ectoparasites species-prevalence (?. -0.273; p-value <0.05) and ectoparasites species-abundance of species ectoparasites (?. -0.309; p-value <0.05). These findings emphasize the need to assess zoonotic risks and take effective control measures in island regions for public health and conservation.
Co-Authors - Syaifullah . JASMI Aadrean Aadrean AHMAD MURSYID Aida Fitriani Sitompul AIDA FITRIANI SITOMPUL Alan Handru Alia Rizki Alia Rizki Anna Febry Astuti Armein Lusi Zeswita Arum Setiawan Asih Zulnawati Audina, Zikkra Aurora, Dhea Apriano Azrita Azrita Azrita, Azrita Azura, Nabilah Rahmachila Beni Arengga Chairul Cut Nanda Defira Damanhuri, Harfiandri Deffi Surya Ningsih DELA LIDIA Dewi Imelda Roesma Dietriech G. Bengen Dilla Saputri DINDA WIRANTI Djong Hon Tjong EDDY NURTJAHYA Eka Widya Hanifa EKO PRASETYA Eli Ratni Elida Hafni Siregar ELIDA HAFNI SIREGAR Elni Fatimah Elza Safitri Erizal Mukhtar Estu Nugroho Estu Nugroho Fadhilah Rahmah Fajri Hidayat Fauzia Risdawati FAUZIAH SYAMSI Fauziah Syamsi FITHRIA DINIYATI Fithria Diniyati Gita Herliza Sari Gustina Indriati Hafrijal Syandri Hafrijal Syandri Hasmiwati Henmaidi Henmaidi Henny Herwina Hnin Phyu Wai Ida Ayu Putu Sri Widnyani Inda Dwi Solina Irham Falahudin Irham Falahudin, Irham Irvianty Irvianty Jabang Nurdin Janra, Muhammad Nazri Jasmi Jasmi Jasmi , Jasmi Jasmi Jasmi Jasmi Jasmi JEFRIAL JEFRIAL Jefrial Santoso Kiki Martha Puri Larissa Hilmi Mairawita, Mairawita Maliza, Rita Mansyurdin MARSHA M. ARIFA Mida Yulia Murni Miftahul Ilmi Miftahul Ilmi, Miftahul Mildawati Mildawati Muhammad Idris Muhammad Nazri Janra Muhammad Nazri Janra Nabilah Rahmachila Azura Nadra Khairiah Nendi Syafrina Nofri Sea Mega Sutra Nofrita Nofrita Nova Hariani NOVIKA PUTRI Nurmiati Nurmiati Pradani Eka Putri pratiwi, eka ahda Putra Santoso Rahmatika Putri Ranny Ranny Ratna Sari Resti Rahayu Rezvi, Syakira Tiara Riski Andrian Jasmi Rury Makhzuni RYAN M. MAULANA Silvy Olivia Hanum Siti Salmah Siti Salmah Siti Salmah SITI SALMAH Siti Salmah Siti Salmah Solfiyeni Solfiyeni Suwarno Suwarno Suwarno Suwarno Syaifullah Syaifullah Syaifullah Syaifullah Syakira Tiara Rezvi Syami Nilawati Syamsuardi Syamsuardi Syandri, Hafrijal Tashania Tashania Tri Ambar Wati Uswatun Hasanah VIOLA MUTIARA SALIS Weni Yuliani Weny Bestari Wilson Novarino Wulan Rahfi Madona Yuliana Indah Sari Yusron Ritonga Zuriana Siregar