Claim Missing Document
Check
Articles

Potensi Keterlibatan Multipihak dan Pendampingan Perguruan Tinggi berkelanjutan bagi Pengembangan Ekowisata Kapalo Banda dengan Daya tarik Utama Pembudidayaan Lebah Tanpa Sengat (Apidae: Meliponinae). Henny Herwina; Jasmi; Dahelmi; Mansyurdin; Syamsuardi; Jabang Nurdin; Nofrita; Muhammad Nazri Janra; Rita Maliza; Eli Ratni; Muhammad Idris; Putra Santoso; Miftahul Ilmi; Nabilah Rahmachila Azura; Syakira Tiara Rezvi; Elni Fatimah; Fajri Hidayat; Jefrial Santoso
Warta Pengabdian Andalas Vol 32 No 1 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.1.108-119.2025

Abstract

The development of ecotourism in Kapalo Banda, Limau Manis, Padang, has potential to be expanded into agro-ecotourism through multi-stakeholder involvement. Key attractions include the scenic of river flows, agricultural cultivation, and stingless bee keeping, which support environmental sustainability and the local economy. With high vegetation diversity, the potential for stingless bee (galo-galo) breeding as a creative economic initiative offers new opportunities. This program aligns with the West Sumatra Provincial Government’s efforts to establish the area as a honey production center. However, challenges such as low colony production due to limited knowledge of farming techniques and the availability of flowering feed hinder its development. Through community engagement, empowerment activities were conducted from June to September 2024, including socialization, demonstrations, and training in bee farming techniques, supported by expert teams. Education focused on the potential of galo-galo and marketing strategies for local products. The results of this program indicate improved community skills and knowledge, supporting local economic sustainability and biodiversity conservation. Kapalo Banda partners have the potential to serve as a model for community empowerment based on natural resources, effectively enhancing community welfare. Multi-stakeholder involvement in developing Kapalo Banda Ecotourism has resulted in a series of activities ranging from cultivation preparation, colony propagation techniques, harvest preparation, to downstream processing and product marketing.
Alopecia in Bats from Tropical Urban Islands Syamsi, Fauziah; Novarino, Wilson; Dahelmi, Dahelmi; Chairul, Chairul
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7188

Abstract

Background: Alopecia or alopecic syndrome is a hair loss condition on the body. Alopecia is caused by a wide variety of factors both internal to the individual (i.e. androgen activity, nutritional deficiencies, metabolic stress, hormonal imbalances) and external (i.e. human-induced pressures, allergens, ectoparasites, fungal dermatitis, bacterial, toxicities, environmental contaminant exposure, idiopathic disease, poor habitat conditions, anthropogenic activities, zinc deficiency, and ingestion of plant toxins). Methods: This study was conducted at four locations in Batam City, consisting of two fragmented forests in the city center and two islands far from the city area. Bats were captured using mist nets and harp traps with a total sampling effort of 120 net nights and 120 harp trap nights. Findings: This study captured 417 bats across seven species, with an overall alopecia prevalence of 10.79 %. The highest prevalence was found in Pipistrellus tenuis (100%), Kerivoula pellucida (50 %), and Macroglossus minimus (20 %), likely due to the small sample sizes of these species. Larger sample sizes resulted in lower prevalence rates: Balionycteris maculata (22.2 %), Cynopterus horsfieldii (11.1 %), C. brachyotis (9.2 %), and C. sphinx (6.86 %). The most severe hair loss generally occurs on the shoulders and neck. Some individuals show hair loss on the back, head, chest, abdomen, and other parts of the body. Alopecia is found in both males and females from mild to severe. The prevalence of alopecia in all species was higher in fragmented forests in urban to periurban, and rural areas. This was associated with differences in the level of anthropogenic pressure. Contribution: These findings provide a scientific contribution to understanding the relationship between alopecia in bats and anthropogenic pressures and highlight the importance of habitat conditions in population health in fragmented environments.
Potential of Stingless Beekeeping in Community Empowerment Strategy for Building Sustainable Creative Economy in a Forest Farmer Group of Puncak Labuang, Padang City Herwina, Henny; Jasmi , Jasmi; Dahelmi, Dahelmi; Ratni, Eli; Janra, Muhammad Nazri; Ilmi, Miftahul; Azura, Nabilah Rahmachila; Rezvi, Syakira Tiara
Warta Pengabdian Andalas Vol 32 No 3 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.3.343-356.2025

Abstract

The Forest Farmer Group of Puncak Labuang (FFGPL) manages a 194-hectare community forest in Limau Manis, Padang, contributing to the livelihood of community through agriculture and ecotourism. The forest productivity comes as high-value commodities such as durian, mangosteen, and coffee, as well as ecotourism activities like camping and hiking; all of which boost local economy while sustaining the surrounding environmental. Having diverse vegetation, the forest presents an opportunity for farming the stingless bee (galo-galo) as a promising innovative economic initiative. This program aligns with the program of West Sumatra Provincial Government to achieve position as production centre for honey. Some challenges such as low production of bee colonies appear from the lack of knowledge in farming techniques and insufficiency of food sources for colonies which hinder the progress. From June to December 2024, a community service program had been implemented to address these challenges. Activities included socialization, demonstrations, and training in bee farming techniques, supported by a team of experts. The education focused on the potential of galo-galo farming and strategies for marketing local products. Additionally, training sessions for Micro, Small, and Medium Enterprises (MSMEs), along with honey product exhibitions, had successfully raised public awareness and improved the competitiveness of local products. As a result of this program, there was a notable improvement in community skills and knowledge, contributing to the sustainability of local economy and preservation of biodiversity. FFGPL has the potential to become a model for community empowerment based on natural resources, leading to significant improvements in community welfare.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Kolaborasi Lintas Negara: Integrasi Biologi Terapan dan Budaya Minangkabau dalam Pengabdian Masyarakat Internasional di Universiti Malaya Mildawati, Mildawati; Solfiyeni, Solfiyeni; Nurmiati, Nurmiati; Dahelmi, Dahelmi; Audina, Zikkra
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 6 No. 3 (2025): Edisi Juli - September
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v6i3.6560

Abstract

Kegiatan pengabdian masyarakat internasional ini merupakan bentuk kolaborasi akademik dan sosial antara Universitas Andalas (UNAND) dan Universitas Malaya (UM), yang turut melibatkan komunitas lokal seperti Bundo kanduang Kerapatan Adat Nagari (KAN) Limau Manis dan Ikatan Keluarga Minangkabau Malaysia (IKMM). Tujuan utama kegiatan ini adalah memperkuat hubungan kelembagaan melalui lokakarya biologi terapan dan pertukaran pengetahuan berbasis nilai-nilai budaya Minangkabau. Permasalahan yang diidentifikasi mencakup terbatasnya integrasi pengetahuan biologis dalam konteks lintas budaya dan kurangnya media komunikasi efektif antar komunitas akademik dan masyarakat. Dengan pendekatan partisipatif, kegiatan ini meliputi lokakarya tematik, diskusi ilmiah, serta pertunjukan budaya yang menampilkan artefak tradisional seperti piring hitam yang masih tersimpan dan relevan hingga kini di Museum Universiti Malaya. Hasil kegiatan menunjukkan peningkatan pemahaman peserta terhadap penerapan biologi dalam kehidupan sehari-hari dan penguatan jejaring kerja sama antara institusi pendidikan dan masyarakat adat. Pendekatan berbasis budaya lokal terbukti efektif dalam menjembatani perbedaan dan memperkuat komunikasi ilmiah lintas negara. Kegiatan ini memberikan kontribusi penting dalam mendukung diplomasi akademik, pelestarian budaya, dan pemberdayaan masyarakat melalui ilmu hayati.
Co-Authors - Syaifullah . JASMI . Mansyurdin Aida Fitriani Sitompul Alan Handru Alia Rizki Anna Febry Astuti Armein Lusi Zeswita Arum Setiawan Asih Zulnawati Audina, Zikkra Aurora, Dhea Apriano Azrita Azrita Azrita, Azrita Azura, Nabilah Rahmachila Beni Arengga Chairul Chairul Damanhuri, Harfiandri Deffi Surya Ningsih Dewi Imelda Roesma Dietriech G. Bengen Dilla Saputri Djong Hon Tjong Eka Widya Hanifa Eli Ratni Elida Hafni Siregar Elni Fatimah Elza Safitri Estu Nugroho Estu Nugroho Fadhilah Rahmah Fajri Hidayat Fauzia Risdawati Fauziah Syamsi Fithria Diniyati Gita Herliza Sari Gustina Indriati Hafrijal Syandri Hafrijal Syandri Hasmiwati Henmaidi Henmaidi Henny Herwina Hnin Phyu Wai Ida Ayu Putu Sri Widnyani Irham Falahudin Irham Falahudin, Irham Jabang Nurdin Janra, Muhammad Nazri Jasmi Jasmi Jasmi , Jasmi Jasmi Jasmi Jasmi Jasmi Jefrial Santoso Kiki Martha Puri Larissa Hilmi Mairawita, Mairawita Maliza, Rita Mida Yulia Murni Miftahul Ilmi Miftahul Ilmi, Miftahul Mildawati Mildawati Muhammad Idris Muhammad Nazri Janra Muhammad Nazri Janra Nabilah Rahmachila Azura Nadra Khairiah Nendi Syafrina Nofri Sea Mega Sutra Nofrita Nofrita Nova Hariani Nurmiati Nurmiati Pradani Eka Putri pratiwi, eka ahda Putra Santoso Rahmatika Putri Ranny Ranny Ratna Sari Resti Rahayu Rezvi, Syakira Tiara Riski Andrian Jasmi Rury Makhzuni Silvy Olivia Hanum Siti Salmah Siti Salmah Siti Salmah Siti Salmah SITI SALMAH Siti Salmah Solfiyeni Solfiyeni Suwarno Suwarno Syaifullah Syaifullah Syakira Tiara Rezvi Syami Nilawati Syamsuardi Syamsuardi Syandri, Hafrijal Tri Ambar Wati Uswatun Hasanah Weni Yuliani Weny Bestari Wilson Novarino Wulan Rahfi Madona Yuliana Indah Sari Yusron Ritonga