Article Per Year (5 Year)
p-Index From 2021 - 2026
1.295
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Natural Science: Journal of Science and Technology METAMORFOSA Journal of Biological Sciences Jurnal Natur Indonesia JBIO: jurnal biosains (the journal of biosciences) Jurnal Bioleuser Pendidikan Biologi Jurnal Biologi Universitas Andalas Al Ilmi BioCONCETTA Jurnal Biologi Tropis Jurnal Riset Akuakultur International Journal of Agricultural Sciences Jurnal Pembangunan Nagari Jurnal Pembelajaran dan Biologi Nukleus Jurnal Pengabdian kepada Masyarakat Nusantara Warta Pengabdian Andalas: Jurnal Ilmiah Pengembangan Dan Penerapan Ipteks Berkala Penelitian Hayati
Dahelmi Dahelmi
Laboratorium Taksonomi Hewan, Jurusan Biologi FMIPA Universitas Andalas
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Medicine & Pharmacology Public Health Social Sciences Other

Published : 48 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 48 Documents
Search

 1   2   3   4   5 
Change of Morphological Characters of an Introduced Population of Bilih Fish (Mystacoleucus padangensis Bleeker, Pisces: Cyprinidae) in Toba Lake Nofrita nofrita; Dahelmi dahelmi; Hafrijal Syandri; Djong Hon Tjong
International Journal of Agricultural Sciences Vol 3, No 1 (2019)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/ijasc.3.1.23-29.2019

Abstract

Population of Bilih Fish (Mystacoleucus padangensis) in Singkarak Lake has decreased as the effect of intensive exploitation and changes in water use function. Many appropriate works have been conducted for the fish conservation. One of them is introducing Bilih fish population to a new habitat,  Toba Lake. After nine years of releasing the fish, there was a hypothesis that these fish had undergone some changes on their morphology compared to their original population in Singkarak Lake. The changes could occure in some morphological characters and also the increase or decrease of their growth. This study was aimed at comparing morphology characters between Bilih fish introduced to Toba Lake with the original population in Singkarak Lake. Survey method was used and 400 samples of fish were taken from each Singkarak and Toba Lakes.  Parameters measured were 29 morphological characters. Data were analyzed using Mann Whitney U Test with SPSS 22. The results showed that 27 morphological characters of introduced fish had changed. Characters that had not changed were dorsal fin (anterior end)-anal fin distance (DFAF) and preanal distance (PD). Population of Bilih fish in Toba Lake might keep changing in the process of morphological character differentiation as long as environment factors still support the life of Bilih fish. 
Local Community Perceptions and Attitudes Towards Butterflies and Ecotourism in West Sumatera Hnin Phyu Wai; Henny Herwina; Dahelmi dahelmi; Jasmi Jasmi; Muhammad Nazri Janra
Jurnal Biologi Universitas Andalas Vol 11, No 2 (2023)
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jbioua.11.2.95-102.2023

Abstract

One of the most biodiverse nations in the world, Indonesia is home to a wide variety of butterflies as well as other animals and plants. Butterflies play a significant role in the ecosystem, both in the pollination process and in the process of detecting environmental changes in the ecosystem. One alternate strategy for preserving biodiversity and natural resources while boosting a nation's economy is ecotourism. This study aims to investigate the perceptions and attitudes of local communities in West Sumatera regarding with butterflies and ecotourism. The study was conducted from February to March, 2023 by using two-page questionnaire developed to collect social information regarding with ecotourism and butterflies through in-depth interview with respondents who was currently living in West Sumatra. A total of 30 respondents (15 Male, 15 female) from various background were questioned. According to the survey’s findings, the majority of the population (93%) was passionate about protecting biodiversity and has extensive understanding of ecotourism and butterflies. Additionally, the majority of respondents (93%) mentioned that they would love to join Butterfly Watching Program. The respondents indicated that West Sumatera has a lot of ecotourism destinations. To draw visitors, a more sophisticated ecotourism program centered on beautiful wildlife and flora should be established.
Genetic Population of Hypothenemus hampei Ferarri (Coleoptera: Scolytinae) from Coffee (Coffea spp.) in Sumatra, Indonesia Using The Cytochrome Oxidase Subunit I Gene Sitompul, Aida Fitriani; Dahelmi, Dahelmi; Roesma, Dewi Imelda
HAYATI Journal of Biosciences Vol. 32 No. 2 (2025): March 2025
Publisher : Bogor Agricultural University, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.4308/hjb.32.2.472-483

Abstract

Hypothenemus hampei Ferrari, 1867, is a globally significant pest of coffee (Coffea spp.). Genetic information about H. hampei from various locations, including countries in America, Africa, and Asia (Java, Indonesia), is available. However, the data has yet to be available for Sumatra. This research aims to study the genetic population of H. hampei in coffee plants in Sumatra. In this study, a total of 27 mitochondrial cytochrome oxidase subunit 1 (COI) gene sequences were used to estimate the population genetics of H. hampei in Sumatra, collected from C. arabica, C. canephora, and C. liberica at nine locations. The analysis of the COI gene sequences revealed that they contained 236 base pairs (53.76%) of conserved sites, 203 base pairs (46.24%) of variable sites, 153 base pairs (34.85%) of parsimony sites, and 50 base pairs (11.38%) of informative single sites out of a total of 439 base pairs. Haplotype analysis of the COI gene in H. hampei from Sumatra revealed 10 haplotypes, with a haplotype diversity (h) of 0.649 and nucleotide diversity (π) of 0.004. Genetic differentiation (Fst) of H. hampei is low among populations in Sumatra. Genetic variation within populations is higher, and between populations is low. The genetic distance of 0-0.28%, 27 H. hampei sequences from Sumatra are in the same branch, indicating low genetic variation. This information holds great potential for designing sustainable control strategies to manage this pest species in coffee plants, particularly in the Sumatra region.
Potensi Keterlibatan Multipihak dan Pendampingan Perguruan Tinggi berkelanjutan bagi Pengembangan Ekowisata Kapalo Banda dengan Daya tarik Utama Pembudidayaan Lebah Tanpa Sengat (Apidae: Meliponinae). Henny Herwina; Jasmi; Dahelmi; Mansyurdin; Syamsuardi; Jabang Nurdin; Nofrita; Muhammad Nazri Janra; Rita Maliza; Eli Ratni; Muhammad Idris; Putra Santoso; Miftahul Ilmi; Nabilah Rahmachila Azura; Syakira Tiara Rezvi; Elni Fatimah; Fajri Hidayat; Jefrial Santoso
Warta Pengabdian Andalas Vol 32 No 1 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.1.108-119.2025

Abstract

The development of ecotourism in Kapalo Banda, Limau Manis, Padang, has potential to be expanded into agro-ecotourism through multi-stakeholder involvement. Key attractions include the scenic of river flows, agricultural cultivation, and stingless bee keeping, which support environmental sustainability and the local economy. With high vegetation diversity, the potential for stingless bee (galo-galo) breeding as a creative economic initiative offers new opportunities. This program aligns with the West Sumatra Provincial Government’s efforts to establish the area as a honey production center. However, challenges such as low colony production due to limited knowledge of farming techniques and the availability of flowering feed hinder its development. Through community engagement, empowerment activities were conducted from June to September 2024, including socialization, demonstrations, and training in bee farming techniques, supported by expert teams. Education focused on the potential of galo-galo and marketing strategies for local products. The results of this program indicate improved community skills and knowledge, supporting local economic sustainability and biodiversity conservation. Kapalo Banda partners have the potential to serve as a model for community empowerment based on natural resources, effectively enhancing community welfare. Multi-stakeholder involvement in developing Kapalo Banda Ecotourism has resulted in a series of activities ranging from cultivation preparation, colony propagation techniques, harvest preparation, to downstream processing and product marketing.
Alopecia in Bats from Tropical Urban Islands Syamsi, Fauziah; Novarino, Wilson; Dahelmi, Dahelmi; Chairul, Chairul
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 11, No 2: Jurnal Pembelajaran Dan Biologi Nukleus June 2025
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v11i2.7188

Abstract

Background: Alopecia or alopecic syndrome is a hair loss condition on the body. Alopecia is caused by a wide variety of factors both internal to the individual (i.e. androgen activity, nutritional deficiencies, metabolic stress, hormonal imbalances) and external (i.e. human-induced pressures, allergens, ectoparasites, fungal dermatitis, bacterial, toxicities, environmental contaminant exposure, idiopathic disease, poor habitat conditions, anthropogenic activities, zinc deficiency, and ingestion of plant toxins). Methods: This study was conducted at four locations in Batam City, consisting of two fragmented forests in the city center and two islands far from the city area. Bats were captured using mist nets and harp traps with a total sampling effort of 120 net nights and 120 harp trap nights. Findings: This study captured 417 bats across seven species, with an overall alopecia prevalence of 10.79 %. The highest prevalence was found in Pipistrellus tenuis (100%), Kerivoula pellucida (50 %), and Macroglossus minimus (20 %), likely due to the small sample sizes of these species. Larger sample sizes resulted in lower prevalence rates: Balionycteris maculata (22.2 %), Cynopterus horsfieldii (11.1 %), C. brachyotis (9.2 %), and C. sphinx (6.86 %). The most severe hair loss generally occurs on the shoulders and neck. Some individuals show hair loss on the back, head, chest, abdomen, and other parts of the body. Alopecia is found in both males and females from mild to severe. The prevalence of alopecia in all species was higher in fragmented forests in urban to periurban, and rural areas. This was associated with differences in the level of anthropogenic pressure. Contribution: These findings provide a scientific contribution to understanding the relationship between alopecia in bats and anthropogenic pressures and highlight the importance of habitat conditions in population health in fragmented environments.
Potential of Stingless Beekeeping in Community Empowerment Strategy for Building Sustainable Creative Economy in a Forest Farmer Group of Puncak Labuang, Padang City Herwina, Henny; Jasmi , Jasmi; Dahelmi, Dahelmi; Ratni, Eli; Janra, Muhammad Nazri; Ilmi, Miftahul; Azura, Nabilah Rahmachila; Rezvi, Syakira Tiara
Warta Pengabdian Andalas Vol 32 No 3 (2025)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat (LPPM) Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jwa.32.3.343-356.2025

Abstract

The Forest Farmer Group of Puncak Labuang (FFGPL) manages a 194-hectare community forest in Limau Manis, Padang, contributing to the livelihood of community through agriculture and ecotourism. The forest productivity comes as high-value commodities such as durian, mangosteen, and coffee, as well as ecotourism activities like camping and hiking; all of which boost local economy while sustaining the surrounding environmental. Having diverse vegetation, the forest presents an opportunity for farming the stingless bee (galo-galo) as a promising innovative economic initiative. This program aligns with the program of West Sumatra Provincial Government to achieve position as production centre for honey. Some challenges such as low production of bee colonies appear from the lack of knowledge in farming techniques and insufficiency of food sources for colonies which hinder the progress. From June to December 2024, a community service program had been implemented to address these challenges. Activities included socialization, demonstrations, and training in bee farming techniques, supported by a team of experts. The education focused on the potential of galo-galo farming and strategies for marketing local products. Additionally, training sessions for Micro, Small, and Medium Enterprises (MSMEs), along with honey product exhibitions, had successfully raised public awareness and improved the competitiveness of local products. As a result of this program, there was a notable improvement in community skills and knowledge, contributing to the sustainability of local economy and preservation of biodiversity. FFGPL has the potential to become a model for community empowerment based on natural resources, leading to significant improvements in community welfare.
Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program Aurora, Dhea Apriano; Novarino, Wilson; Tjong, Djong Hon; Dahelmi, Dahelmi; Syaifullah, Syaifullah; Setiawan, Arum; Roesma, Dewi Imelda
Jurnal Biologi Tropis Vol. 25 No. 1 (2025): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v25i1.8499

Abstract

The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Kolaborasi Lintas Negara: Integrasi Biologi Terapan dan Budaya Minangkabau dalam Pengabdian Masyarakat Internasional di Universiti Malaya Mildawati, Mildawati; Solfiyeni, Solfiyeni; Nurmiati, Nurmiati; Dahelmi, Dahelmi; Audina, Zikkra
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 6 No. 3 (2025): Edisi Juli - September
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.55338/jpkmn.v6i3.6560

Abstract

Kegiatan pengabdian masyarakat internasional ini merupakan bentuk kolaborasi akademik dan sosial antara Universitas Andalas (UNAND) dan Universitas Malaya (UM), yang turut melibatkan komunitas lokal seperti Bundo kanduang Kerapatan Adat Nagari (KAN) Limau Manis dan Ikatan Keluarga Minangkabau Malaysia (IKMM). Tujuan utama kegiatan ini adalah memperkuat hubungan kelembagaan melalui lokakarya biologi terapan dan pertukaran pengetahuan berbasis nilai-nilai budaya Minangkabau. Permasalahan yang diidentifikasi mencakup terbatasnya integrasi pengetahuan biologis dalam konteks lintas budaya dan kurangnya media komunikasi efektif antar komunitas akademik dan masyarakat. Dengan pendekatan partisipatif, kegiatan ini meliputi lokakarya tematik, diskusi ilmiah, serta pertunjukan budaya yang menampilkan artefak tradisional seperti piring hitam yang masih tersimpan dan relevan hingga kini di Museum Universiti Malaya. Hasil kegiatan menunjukkan peningkatan pemahaman peserta terhadap penerapan biologi dalam kehidupan sehari-hari dan penguatan jejaring kerja sama antara institusi pendidikan dan masyarakat adat. Pendekatan berbasis budaya lokal terbukti efektif dalam menjembatani perbedaan dan memperkuat komunikasi ilmiah lintas negara. Kegiatan ini memberikan kontribusi penting dalam mendukung diplomasi akademik, pelestarian budaya, dan pemberdayaan masyarakat melalui ilmu hayati.
Co-Authors - Syaifullah . JASMI . Mansyurdin Aida Fitriani Sitompul Alan Handru Alia Rizki Anna Febry Astuti Armein Lusi Zeswita Arum Setiawan Asih Zulnawati Audina, Zikkra Aurora, Dhea Apriano Azrita Azrita Azrita, Azrita Azura, Nabilah Rahmachila Beni Arengga Chairul Chairul Damanhuri, Harfiandri Deffi Surya Ningsih Dewi Imelda Roesma Dietriech G. Bengen Dilla Saputri Djong Hon Tjong Eka Widya Hanifa Eli Ratni Elida Hafni Siregar Elni Fatimah Elza Safitri Estu Nugroho Estu Nugroho Fadhilah Rahmah Fajri Hidayat Fauzia Risdawati Fauziah Syamsi Fithria Diniyati Gita Herliza Sari Gustina Indriati Hafrijal Syandri Hafrijal Syandri Hasmiwati Henmaidi Henmaidi Henny Herwina Hnin Phyu Wai Ida Ayu Putu Sri Widnyani Irham Falahudin Irham Falahudin, Irham Jabang Nurdin Janra, Muhammad Nazri Jasmi Jasmi Jasmi , Jasmi Jasmi Jasmi Jasmi Jasmi Jefrial Santoso Kiki Martha Puri Larissa Hilmi Mairawita, Mairawita Maliza, Rita Mida Yulia Murni Miftahul Ilmi Miftahul Ilmi, Miftahul Mildawati Mildawati Muhammad Idris Muhammad Nazri Janra Muhammad Nazri Janra Nabilah Rahmachila Azura Nadra Khairiah Nendi Syafrina Nofri Sea Mega Sutra Nofrita Nofrita Nova Hariani Nurmiati Nurmiati Pradani Eka Putri pratiwi, eka ahda Putra Santoso Rahmatika Putri Ranny Ranny Ratna Sari Resti Rahayu Rezvi, Syakira Tiara Riski Andrian Jasmi Rury Makhzuni Silvy Olivia Hanum Siti Salmah Siti Salmah Siti Salmah SITI SALMAH Siti Salmah Siti Salmah Solfiyeni Solfiyeni Suwarno Suwarno Syaifullah Syaifullah Syakira Tiara Rezvi Syami Nilawati Syamsuardi Syamsuardi Syandri, Hafrijal Tri Ambar Wati Uswatun Hasanah Weni Yuliani Weny Bestari Wilson Novarino Wulan Rahfi Madona Yuliana Indah Sari Yusron Ritonga