Article Per Year (5 Year)
p-Index From 2021 - 2026
6.455
P-Index
This Author published in this journals
All Journal AL KAUNIYAH Jurnal Ilmu-Ilmu Pertanian Indonesia JURNAL EKONOMI AKUNTANSI DAN MANAJEMEN Biota JINOP (Jurnal Inovasi Pembelajaran) Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Jurnal Ilmiah Mahasiswa Ekonomi Akuntansi JURNAL IQRA´ Al Ishlah Jurnal Pendidikan JBMP (Jurnal Bisnis, Manajemen dan Perbankan) Biosfer: Jurnal Pendidikan Biologi Jurnal Biolokus: Jurnal Penelitian Pendidikan Biologi dan Biologi Jurnal ULTIMA Accounting JURNAL PENDIDIKAN TAMBUSAI ISOQUANT : Jurnal Ekonomi, Manajemen dan Akuntansi EKUITAS (Jurnal Ekonomi dan Keuangan) Akuntansi : Jurnal Akuntansi Integratif Jurnal Aplikasi Dan Inovasi Ipteks SOLIDITAS Jurnal Akademi Akuntansi (JAA) Budimas : Jurnal Pengabdian Masyarakat Journal of Community Service and Empowerment Bioscientist : Jurnal Ilmiah Biologi Prisma Sains: Jurnal Pengkajian Ilmu dan Pembelajaran Matematika dan IPA IKIP Mataram Research and Development in Education (RaDEn) Sejahtera: Jurnal Inspirasi Mengabdi Untuk Negeri Jurnal Pengabdian Masyarakat Bangsa Quagga: Jurnal Pendidikan dan Biologi Journal of Multiperspectives on Accounting Literature Sasambo: Jurnal Abdimas (Journal of Community Service) JIMEKA Green and Tropical Laboratory for Sustainability
Sri Wahyuni
Universitas Muhammadiyah Malang
Religion Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Materials Science & Nanotechnology Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Other

Published : 49 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 49 Documents
Search

 1   2   3   4   5 
Investment yield’s affecting factors in equity crowdfunding Astuti, Sri Wibawani Wahyuning; Sudiyono, Widhiyo; Azzahra, Laras
Journal of Multiperspectives on Accounting Literature Vol. 2 No. 2 (2024): Journal of Multiperspectives on Accounting Literature
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jameela.v2i2.35535

Abstract

Research aims: This research is a quantitative-associative study that aims to analyze the effect of a ratio of company size and NPM on investment yield registered in Santara in 2020. Design/Methodology/Approach: The population in this study is Small and Medium Enterprises (SMEs) registered in Santara and the sample of this study was 40 SMEs with sampling technique using a purposive sampling method. The statistical test in this study uses Multiple Linear Regression and the analysis tool used is SPSS Version 25. Research findings: The results of the test show that (1) company size has no effect on investment yield in SMEs (2) NPM has no effect on investment yield in SMEs. Covid-19 pandemic has made SMEs reluctant to set a Investment Yield that is too high, because it will be dangerous and lead to bankruptcy. Theoretical contribution/Originality:. This study contributes to knowledge of the Equity Crowdfunding Market, how it works. This study also contributes to prove the signal theory in Equity Crowdfunding Market. Practitioner/Policy implication: This research has implications for policy makers to consider determining investment yield based on Size and Net Profit Margin. Research limitation/Implication: The limitation of this study is the minimum of sample. Beside that, this study only focus on one Equity Crowdfunding Platform, so it cannot be generalized to other platforms considering the different policies of each equity crowdfunding platform.
Toxicity profile of jamu sari rapet albumin and creatinine levels in female rats (Rattus norvegicus) Ulfa, Darlah Immaria; Nuryady, Moh. Mirza; Wahyuni, Sri; Susetyarini, Rr Eko; Purwanti, Elly; Ariesaka, Kiky Martha; Fatmawati, Diani
Jurnal Biolokus : Jurnal Penelitian Pendidikan Biologi dan Biologi Vol 6, No 2 (2023): December
Publisher : Universitas Islam Negeri Sumatera Utara

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30821/biolokus.v6i2.3119

Abstract

Married Madurese women routinely consume jamu sari rapet to please their husbands. There is no information on the toxicity test of jamu sari rapet.  The kidney is one of the organs that is targeted by toxic substances that enter the body. One of the parameters controlled is albumin and creatinine. The purpose of this study was to determine the effect on albumin and creatinine levels in white rats (Rattus norvegicus) given jamu sari rapet. This type of research is true experimental with a quantitative approach. This study was conducted for 28 days (subchronic). Data were analyzed using the Kruskal Wallis test. There were 4 groups, namely dose group 1 (1,56 g/gBB), dose group 2 (1,60 g/gBB), dose group 3 (1,66 g/gBB) and the control group. The results of this study showed no significant difference between albumin and creatinine levels compared to the control group. The conclusion shows that jamu sari rapet given to female rats (Rattus norvegicus) for 28 days has no significant effect on albumin and creatinine levels.
Pendampingan Penyusunan Laporan Corporate Social Responsibility CSR) pada Rayz Hotel Malang Astuti, Sri Wibawani Wahyuning; Zubaidah, Siti; Irawan, Dwi
Jurnal Pengabdian Masyarakat Bangsa Vol. 2 No. 6 (2024): Agustus
Publisher : Amirul Bangun Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59837/jpmba.v2i6.1216

Abstract

Corporate Social Responsibility (CSR) menurut Global Reporting Initiative (GRI) adalah pendekatan yang mengintegrasikan tanggung jawab sosial, lingkungan, dan ekonomi dalam aktivitas bisnis perusahaan. Laporan CSR yang disusun mengikuti standar GRI berfungsi untuk memastikan transparansi dan akuntabilitas perusahaan terhadap dampak sosial, lingkungan, dan ekonomi. Penelitian ini berfokus pada upaya pendampingan dalam penyusunan laporan CSR bagi Rayz Hotel, sebuah usaha jasa di bidang penginapan dan makanan. Meskipun Rayz Hotel telah mengeluarkan biaya terkait CSR, mereka belum menyusun laporan formal. Metode pengabdian yang diterapkan meliputi perencanaan, pelatihan, pendampingan, dan pelaporan, yang bertujuan untuk membantu Rayz Hotel dalam menyusun laporan CSR sederhana. Hasil dari pengabdian ini termasuk dokumentasi kegiatan CSR seperti pembersihan lingkungan, sertifikasi HACCP, dan pembersihan masjid. Laporan CSR ini diharapkan dapat meningkatkan kepedulian masyarakat terhadap aktivitas perusahaan dan memberikan nilai tambah serta meningkatkan minat stakeholder terhadap kegiatan positif yang dilakukan oleh Rayz Hotel.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Fleksibilitas Transparansi dan Akuntabilitas dalam Menghindari Penipuan dengan Pendekatan Akuntansi Forensik: Blawi Lamongan Wijaya, Almaira Oktavia; Leniwati, Driana; Wahyuni, Endang Dwi; Astuti, Sri Wibawani Wahyuning; Affan, Muhammad Wildan
Jurnal Ekonomi Akuntansi dan Manajemen Vol. 23 No. 2 (2024)
Publisher : Universitas Jember

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.19184/jeam.v23i2.52377

Abstract

This research aims to find out how a village can flexibly account for its village funds in a transparent manner to minimize acts of fraud by using a forensic accounting approach considering the increasing number of cases related to these acts. Data collection was carried out through in-depth interviews with village officials who were key informants. The method used was snowballing with additional informants. The resulting interview will then be concluded or summarized. Then a triangulation technique was carried out by conducting interviews and checking validity by viewing or observing existing websites so that the data obtained was valid. Based on the results found in the research, it can be concluded that accountability of village funds is needed to minimize this situation, but there are still several factors that make this an opportunity, such as a person's lack of trust in existing temptations and the demands of the people around him who ask him to produce more money. Keywords: Accountability, Forensic Accounting, Flexibility, Fraud
Implementasi PPK Berbasis Kelas Melalui Literasi Pada Masa Pandemi Covid 19 Di SMP Muhammadiyah 1 Malang Sri Wahyuni; Iin Hindun; Yanur Setyaningrum; Masrudi Masrudi
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 2 No. 3: October 2020
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/sasambo.v2i3.315

Abstract

SMP Muhammadiyah 01 Malang sudah melaksanakan Program Penguatan Pendidikan Karakter (PPK),berbasis kelas, tetapi dalam pelaksanaannya masih perlu ditingkatkan, karena belum memfokuskan pada variasi literasi dalam pembelajarannya. Salah satu cara untuk meningkatkan penerapan PPK adalah melalui literasi. Pengembangan literasi melalui pendekatan PPK Berbasis Kelas di masa pandemic Covid 19 ini dilakukan melalui pembelajaran Daring. Pengabdian ini bertujuan untuk meningkatkan penerapan PPK dengan gerakan literasi di SMP Muhammadiyah 1 Malang. Pengabdian  dilakukan dengan metode pelatihan dan pendampingan. yang mengacu pada analisis situasi program-program yang telah disepakati bersama. Sasaran pengabdian ini meliputi Kepala Sekolah, 20 guru SMP Muhammadiyah 1 Malang Hasil pengabdian ini adalah guru 80% dapat menganalisis konsep PPK dan mengembangkan RPP yang terintegrasi PPK melalui gerakan literasi, 65% guru dapat melaksanakan pembelajaran menggunakan  RPP yang terintegrasi PPK melalui gerakan literasi secara daring. Kesimpulan kegiatan pengabdian ini adalah meningkatnya wawasan dan kompetensi guru dalam menyusun RPP berbasis PPK melalui gerakan literasi, meningkatnya ketrampilan guru dalam melaksanakan pembelajaran di kelas sesuai Kurikulum 2013 yang menerapkan PPK melalui gerakan literasi lebih bervariasi meliputi literasi baca tulis, literasi numerik, literasi science, literasi ICT dan literasi budaya.
Pendampingan Guru Inovatif dan Reflektif Melalui TBLA Berbasis Lesson Study di SMP Muhammadiyah 2 Batu Iin Hindun; Sri Wahyuni; Nurwidodo Nurwidodo
Sasambo: Jurnal Abdimas (Journal of Community Service) Vol. 4 No. 1: February 2022
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/sasambo.v4i1.621

Abstract

Tujuan dari pendampingan ini adalah untuk meningkatkan pemahaman, sikap dan keterampilan guru atas inovasi dan reflektif dalam pembelajaran melalui pemanfaatan TBLA berbasis lesson study.  Metode yang digunakan pada pengabdian ini adalah (1) inclass training melalui langkah Pembekalan (materi konsep pendidikan abad 21, pedagodis modern dan learning community), (2) on the job training melalui langkah workshop penyusunan rencana aksi, penyusunan perangkat pembelajaran (open plan), open class, observasi, refleksi dan tindak lanjut). Sedangkan metode pendampingan dipilih dalam kaitannya dengan implementasi program pengabdian yaitu model SUPIA (School-University Partnership In Action) atau kemitraan dengan aksi setara untuk meraih kualitas pendidikan. Hasil sosialisasi menunjukkan bahwa guru menerima pengetahuan baru terkait dengan guru inovatif dan reflektif dan terdorong untuk mempraktekannya. Hasil workshop pembelajaran kolaboratif meningkatkan pemahaman prinsip pembelajaran kolaboratif dan penyusunan perangkat pembelajaran atau lesson design secara terbuka (open plan) meliputi chapter design dan lesson design merupakan integrasi dari TPACK. Pada Chapter design berisi content knowledge yang menjabarkan dokumenn kurikulum, sedangkan Lesson Design merupakan technological paedogogic yang meliputi sharing task dan jumping task, penugasan dalam porsi individu dan porsi kelompok. Pembelajaran kolaboratif mengimplementasikan teori belajar social  Vigotsky, teori belajar kognitif Jean Piaget dan teori belajar proto/deutro James Bateson. Pembelajaran kolaboratif sebagai salah satu implementasi guru inovatif menghasilkan peningkatan kemampuan berpikir kritis dan keterampilan kolaboratif siswa. Hasil ini telah didukung oleh pemanfaatan TBLA yang dikemas dalam bingkai lesson study dalam rangka mewujudkan predikat guru reflektif. Dapat disimpulkan bahwa pengabdian ini telah menguatkan mindset, cita cita guru inovatif dan reflektif. Guru inovatif diwujudkan dengan kemampuan merancang dan menerapkan pembelajaran kolaboratif, sementara itu guru reflektif diindikasikan dengan pemanfaatan TBLA dalam bingkai lesson study. Pengabdian ini telah mampu mewujudkan peningkatan kualitas proses dan hasil belajar siswa pada mata pelajaran IPA untuk materi Pesawat Sederhana.  Innovative and Reflective Teacher Assistance Through Lesson Study-Based TBLA at SMP Muhammadiyah 2 Batu  The purpose of this assistance is to improve the understanding, attitudes, and skills of teachers on innovation and reflective learning through the use of lesson study-based TBLA. The methods used in this service are (1) in-class training through the detachment (21st-century education concept material, modern pedagogy, and learning community), (2) on the job training through the workshop steps of preparing action plans, preparing learning tools (open plan), open class, observation, reflection, and follow-up). While the mentoring method was chosen in relation to the implementation of the service program, namely the SUPIA (School-University Partnership In Action) model or partnership with equal action to achieve quality education. The results of the socialization show that teachers accept new knowledge and are encouraged to use it in practice to become innovative and reflective teachers. The results of the innovative learning workshop with the collaborative learning model make the target teacher's understanding of the principles of collaborative learning increasingly mastered. The results of the preparation of learning tools or lesson designs in an open (open plan) show that chapter design and lesson design are an integration of TPACK which should be well prepared to realize real collaborative learning. That collaborative learning recognizes task sharing and jumping tasks, recognizes assignments in individual portions and group portions. Collaborative learning implements Vygotsky's social learning theory, Jean Piaget's cognitive learning theory, and James Bateson's proto/deutro learning theory. Collaborative learning as one of the implementations of innovative teachers results in an increase in students' critical thinking skills and collaborative skills. This result has been supported by the use of TBLA which is packaged in a lesson study frame in order to realize the predicate of a reflective teacher. It can be concluded that this dedication has strengthened the mindset, ideals of innovative and reflective teachers. Innovative teachers are manifested by the ability to design and implement collaborative learning, while reflective teachers are indicated by the use of TBLA in the lesson study frame. This service has been able to realize an increase in the quality of the process and student learning outcomes in science subjects for Simple Plane material.
PENGARUH EKSTRAK DAUN SERAI (Cymbopogon citratus (DC.) Stapf) TERHADAP PERKEMBANGBIAKAN KUTU BERAS (Sitophilus oryzae L.) Miftachur Rohma; Moh Mirza Nuryady; Sri Wahyuni
Jurnal Ilmu-Ilmu Pertanian Indonesia Vol 23 No 2 (2021)
Publisher : BPFP Universitas Bengkulu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31186/jipi.23.2.136-145

Abstract

[THE EFFECT OF LEMONGRASS (Cymbopogon citratus (DC.) Stapf) LEAVES EXTRACT ON RICE WEEVIL (Sitophilus oryzae L.) REPRODUCTION]. Rice weevil (Sitophilus oryzae) is the most destructive pest of rice. S. oryzae can be controlled with lemongrass (Cymbopogon citratus). C. citratus leaves extract can be used as pests control because it contains potential active compounds. This study aims to determine the effect of the several concentrations of C. citratus extract from fresh and dry leaves on S. oryzae reproduction. This study was used factorial RAL with two factors. The first factor was concentrations which were divided into 5%, 10%, 20%, as well as the positive control group (alfamethrin 1%) and the negative control group (aqua dest). The second factor was the use of C. citratus leaves which were divided into fresh and dry leaves. Parameters observed were the repellent of S. oryzae, the number of new adults, the damaged rice percentage, and the rice organoleptic. The rice organoleptic was conducted to observe color, texture, smell, and taste. The data were analyzed using a two-way ANOVA test. The best result has been found in the concentration of 20% from fresh C. citratus treatment with an average repellency of 68.50±14.45%, the number of new adults of 29±4.99, and the damaged rice percentage of 24.75±4.113%. The result of the organoleptic test with the highest average value was found in the concentration 5% from fresh C. citratus treatment. The results of the organoleptic test with Kruskal-Wallis showed that there were no significant differences in the color, texture, smell, and taste of rice. The conclusion of this study showed that C. citratus can be used effectively against S. oryzae.
Analysis of Environmental, Social and Corporate Governance Impact of Carnival Activities on Village Sustainability Adi Maulana, Bimo; Driana Leniwati; Sri Wibawani Wahyuning Astuti
Akuntansi: Jurnal Akuntansi Integratif Vol. 10 No. 1 (2024): Volume 10 Nomor 1 April 2024
Publisher : Prodi Akuntansi UIN Sunan Ampel Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29080/jai.v10i1.1555

Abstract

This research aims to find out whether the ESG concept can only be used in a company or can also be used to analyze an activity, where this activity can have an impact on society. By using an interpretive paradigm, this researcher tries to interpret the impact that occurs on carnival activities in terms of the ESG concept. Data was obtained using in-depth interviews with the organizing committee, activity participants and also local businesses involved in the activity who were key informants. The method used is a snowballing system where interview results are grouped and data reduction is carried out before being analyzed and conclusions drawn or verified. Triangulation was also carried out using different question techniques asked to ensure the validity of the data to key informants. By using triangulation techniques, researchers ensure that the data obtained is valid. The results of this research found that there are many impacts that occur in carnival activities which are reviewed with the ESG concept which can later be used as something for the sustainability of the village and can also be a reason in making decisions for the sustainability of the village and also for the sustainability of this activity. In other cases The impact resulting from the concept that has been applied to this activity can be seen from the environmental, social and environmental impacts of this activity also governance.
ANALISIS KINERJA KEUANGAN PAJAK DAERAH MENGGUNAKAN METODE VALUE FOR MONEY Putri, Cyntia Johannes; Wahyuning Astuti, Sri WIbawani
Jurnal Ilmiah Mahasiswa Ekonomi Akuntansi Vol 6, No 2 (2021): Mei 2021
Publisher : Accounting Departement Economics and Business Faculty Syiah Kuala University

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This study aims to determine how the level of economy, effectiveness, and efficiency of local tax financial performance in Ponorogo Regency. The object of this research is Ponorogo Regency. This research uses a descriptive method. Data collection techniques through documentation which can be done by re-recording, photographing, photocopying or buying. The type of data used is in the form of government published financial reports, namely local tax revenue reports and Ponorogo Regency regional income budget data. The results showed that the financial performance of local taxes measured using economic ratios was in the economic category, the efficiency ratio was in the very efficient category. The results of the effectiveness ratio show that the financial performance of local taxes is very effective.
Co-Authors Abdul Karim Ibrahim Adi Maulana, Bimo Adolf Bastian Ahmad Fauzi Ahmad Juanda Ainur Rofieq Ajizatunnisa Ajizatunnisa Alfreda Divia Rachma Aliffian Nisa Cholida Aliffian Nisa’ Cholida Alvin Dewa Yanuar Amira Salsabilla Ariella Junes Egalita Arlita Ariyani Puspitasari Atok Miftachul Hudha Atok Miftachul Hudha Auberta Myra Ardelia Aviani Widyastuti Azzahra, Laras Cantia Putri Chasan Bisri Cyntia Johannes Putri Dance Bobia Mesah Dhiga Agung Sasongkojati Diani Fatmawati Diani Fatmawati Diani Fatmawati Driana Leniwati Dwi Irawan Eko Susetyarini Eko Susetyarini Eko Susetyarini Eko Susetyarini Eko Susetyarini Elfi Anis Saati Elly Purwanti Elly Purwanti Endang Dwi Wahyuni Endrik Nurrohman Farida Indirahma Fatmawati, Diani Firda Ayu Amalia Firdiani Yuliana Fuad Jaya Miharja Hari Sunaryo Husamah Husamah Iin Hindun Iin Hindun Iin Hindun Iin Hindun Iin Hindun In’am, Akhsanul Isna Putri Arifa Jamroji Jamroji Kiky Martha Ariesaka Kurnia Ayu Miranti Lika Dwi Apriani Liliek Triani Lud Waluyo M. Mashuri Masrudi Masrudi Miftachur Rohma Moch. Agus Krisno Budiyanto Mochammad Wachid Moh Miftachul Fadhli Moh. Mirza Nuryady Moh. Mirza Nuryady Moh. Syaifuddin Qomar MP Editor, Ir. Dian Indratmi, MP Muhammad Wildan Affan N. Nurwidodo N. Nurwidodo N. Nurwidodo Nur Afifah Nur Fauziah Nurfadilah Yusri Nurul Mahmudati Nurwidodo Nurwidodo Purwanti, Elly Putri, Cyntia Johannes Ravena Puspitasari Ribut Wahyu Eryanti Riris Dewi Retnowati Roimil Latifa Roimil Latifa Roimil Latifa Roro Eko Susetyarini Roro Eko Susetyorini Rr. Eko Susetyarini Siti Nur Aldina Siti Zaenab Siti Zubaidah Siti Zubaidah Sudiyono, Widhiyo Sukarsono Sukarsono Susetyarini, Rr Eko Triani Liliek Tutut Indria Permana Ulfa, Darlah Immaria Ulul Shintia Rabumi Umigati Umigati Wahyu Prihanta Wijaya, Almaira Oktavia Yanur Setyaningrum Yuni Pantiwati Yuni Pantiwati Yurike Fransischa Trisnaningrum Zakiyatul Khoiriyah