cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota bandung,
Jawa barat
INDONESIA
Articles 497 Documents
Bacterial Contamination at Whiteleg Shrimp (Litopeanaeus vannamei) in Aquaculture -, Mashuri Masri; Sukmawaty, Eka; Nur, Fatmawati; Suriani, Suriani
Jurnal Biodjati Vol 6 No 1 (2021): May
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i1.11812

Abstract

Indonesia has a very high biodiversity, which has later become one of the natural products of interest to the international community, including fishery products. One of the high-demand Indonesian fishery products is whiteleg shrimp Litopeaneus vannamei. However, safety food Exported whiteleg shrimp products must meet the criteria, including free from bacterial contamination such as Escherichia coli, Salmonella, Vibrio cholera. This study attemptted to analyze E. coli, Salmonella, V. cholerae contamination in 3 ponds in Bojo, Cilellang, and Palanro Village in District Malusetasi, Barru Regency, South Sulawesi. Two samplings for each pond were conducted in the morning were pond water and  fresh whiteleg shrimp. SNI 2728-2018 specifies the quality and safety requirements for fresh shrimp. This standard applies to whole or headless fresh shrimp handled from fresh shrimp and does not apply to fresh shrimp that has undergone further processing. Based on SNI 2728-2018, the E. coli test showed positive in Cilellang Village (sample A) with 11 MPN/g, negative in Palanro Village (sample B) and in Bojo village (sample C) with the value of <2 MPN/g. Escherichia coli test showed positive in sample D (Vannamei shrimp in Cilellang Village) and sample E (Vannamei shrimp in Palanro Village) with 2.0 MPN/g, 17 MPN/g, respectively. Only sample F (Vannamei shrimp in Bojo village ) showed a negative result. As for the Salmonella test, positive results showed in sample A, while sample B and sample C showed negative results. The Vibrio cholerae test showed negative at all samples. . This study concludes that Whiteleg shrimp from ponds in Mallusetasi District is classified as safe for consumption.
The Physiological Responses of Zea Mays L. and Cucumis Sativus L. on Drought Stress and Re-Watering Meriem, Selis; Muliyah, Evi; Angio, Melisnawati H.; Triadiati, Triadiati
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.12572

Abstract

Drought leads to deficit water availability and its detrimental effects seriously threaten plant growth. This study assessed the physiological, biochemical, and antioxidant adjustments in different types of photosynthetic plants between Zea mays L. (C4) and Cucumis sativus L. (C3 plant) under response to short-term drought stress. Analyses of relative water content (RWC), proline, and ascorbic acid (AsA) were performed to explore how these plants react to drought. Fifteen-day-old plants were subjected to full irrigation or gradual drought periods for 2-d, 4-d, 6-d, and 8-d following by recovery for 7-d. The results revealed that drought significantly reduces leaf RCW in both plants. Re-watered Z. mays after 8-d drought was higher than C. sativus and reestablished RCW by 23% of stressed plant although remained lower by 9% of the well-watered plant. While, proline and AsA contents in Z. mays were higher than those in C. sativus in drought treatment at 8-d (2.05 µmol/g FW) and 6-d (3174.60 AsA/100 g FW), respectively, that could demonstrate osmotic adjustment ability in this C4 species. The increased proline in both plants also indicates a good strategy for plants to recover. Rewatering gave a decrease AsA and could be expected that plants restore cellular activity after oxidative injury. Based on our study, proline is the most informative biochemical marker to differentiate plant response to drought and Z. mays adjusted defense mechanism to drought rather than C. sativus due to higher accumulation of proline, better antioxidant activity, and improved RCW after recovery.
Phytochemistry Screening and Antioxidant Activities of Extract Pomegranate, Grape, Fig, and Olive in the Various Solvent Savitri, Evika Sandi; Holil, Kholifah; Resmisari, Ruri Siti
Jurnal Biodjati Vol 7 No 1 (2022): May
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v7i1.13424

Abstract

The active compounds of grape, pomegranate, olive, and fig have anthocyanins that potential as antioxidant are flavonoids. Flavonoids have potential as antioxidant  to prevent and therapy various oxidative stress and related diseases. This study aimed to examine the antioxidant activity of a combination of pomegranate, grape, fig, and olive extracts using the DPPH (diphenyl-2-picrylhydrazyl) method.  The maceration method used was maceration of dry Simplicia with methanol 95% solvent, fresh maceration with 95% methanol and dry Simplicia with 95% ethanol solvent. The results of the phytochemistry test showed several compounds found in the extract combination pomegranate, grapes, fig, and olives such as polyphenol, flavonoid, tannin, steroid/triterpenoid. The result of the antioxidant test showed the fresh maceration 95% methanol showed higher results with the IC50 of 25.22 with a potent antioxidant activity category.
Diversity of Land and Freshwater Snail (Mollusca: Gastropoda) of Laiwangi Wanggameti National Park, Sumba Island, Indonesia Mujiono, Nova; Isnaningsih, Nur Rohmatin
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13521

Abstract

A study on the malacofauna of Laiwangi Wanggameti National Park (LWNP) in Sumba Island has been conducted. This study aims were to reveal the diversity of malacofauna in Sumba and compare it with those in the Lesser Sunda Islands. Observations were made on 20 stations using plots (10 x 10 m) in Wanggameti and Laiwangi. Specimens were collected for two hours in each plot. Twenty families and 44 species have been identified. The overall number of species from Sumba increased from 126 to 143 species. The LWNP represents 31% diversity of malacofauna in Sumba Island. Seventeen species are considered as new records for the island. Five endemic land snail species are still observed inside the park. The diversity and population density tend to be higher in Laiwangi area with lower altitudes than in Wanggameti area with higher altitudes. Two dominant species are Asperitas bimaensis cochlostyloides and Tarebia granifera. Species composition in Sumba is more similar to Bali compared with the other six neighboring islands.
The Morphological and Anatomical Studies of The Aerial Parts of Abroma augusta L. from Semarang Nur Khasanah, Rita Ariyana; Kusumarini, Niken
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13573

Abstract

Abroma augusta L. known as Devil’s cotton belongs to Malvaceae. The exploratory study aimed to study the morphological and anatomical characteristics of the aerial parts of A. augusta L. from Semarang. The transverse section of the aerial parts was made by a simple method (fresh preparation) and then observed under a binocular microscope with an optilab. All characteristics were observed and then compared with the references. The collected data were analyzed descriptively and quantitatively. In summary, the results showed that A. augusta L. was an evergreen shrub (small tree) with orthotropic and plagiotropic branches and polymorphous leaves. The inflorenscence was found in the terminal and axillar plagiotropic branching with bisex, actinomorphic, and pentamerous flowers. The fruit was unique (obconical capsule with a rounded base and truncate-tip with 5 angled wings) including cotton fibers and numerous black seeds. The petiole was composed of epidermis, collenchyma, cortical parenchyma, sclerenchyma, vascular bundle, mucilaginous ducts, and pith. The dorsiventral leaf was composed of upper and lower epidermis, palisade, and spongy parenchyma. The stomata type was ranunculaceous (anomocytic) while the guard cell was kidney-shaped. The stomata density on the abaxial leaf was higher than that of the adaxial leaf. The stellate and unicellular non-glandular trichomes, and capitate glandular trichomes were found abundantly on the petiole and leaf blade. These morphological and anatomical studies are important to support the identification as a part of the conservation effort of the plant. Further studies are recommended to investigate the root morphology and anatomy and also biochemical characteristics of each part of the plant in order to obtain  complete plant identification.
Rafflesia zollingeriana Koord.: a Reinstatement Lestari, Dewi; Mahyuni, Ridha
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13597

Abstract

Rafflesia zollingeriana Koord. was one of Rafflesia that distributed in Java. Although it has been stated as a different species, R. zollingeriana is sometimes still regarded as a synonym of R. patma. In addition, there are several contradictions in description of R. zollingeriana.  Therefore, further investigation is needed. This study attempts presents a full the description of the R. zollingeriana female flower. In this study, a full description of female flower of R. zollingeriana and pictures of important characters such as ramenta, annulus, perigone lobes, disc, processes, bractea are presented. This study is also compared the morphology of R. zollingeriana and R. patma, to confirm their differences in size, opening of diaphragm, blotches and warts pattern on perigone lobes and diaphragm, annulus, and ramenta.
Micropropagation of Three Endemic Begonias Using Various Hormones Concentration and Culture Media Application Ismaini, Lily; Lailaty, Intani Quarta; Efendi, Muhammad
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13769

Abstract

Three species of Begonias endemic to Java and Sumatra, namely Begonia leuserensis, Begonia atricha and Begonia scottii, were conserved in Cibodas Botanic Gardens as sources of germplasm for ornamental plant and/or medicines. However, the information on efficient hormones concentration and their culture media application through an in vitro propagation effort is still limited. Therefore, this study aimed to explain the growth response of three species of Begonias using various hormones concentrations and culture media through in vitro propagation. The culture media using Murashige & Skoog (MS) media that combinedwith 6-Benzyladenine (BA) dan Thidiazuron (TDZ) hormones in different concentrations i.e. 0.5 mg/L, 1 mg/L, 2 mg/L, and 3 mg/L. Observation parameter included shoot number, plantlets height, and leaves number. The data were analyzed using analysis of variance (ANOVA) with the F test at a 5% significance level. The results showed that three species of Begonias were observed to have different growth responses in the combination of MS+BA and MS+TDZ media. The combination of MS+TDZ media produces more shoots number, while the combination of MS+BA media influenced higher in leaves number. A concentration of 0.5 mg/L of hormone showed a good regeneration, therefore were recommended for in vitro propagation of Begonia species.
Diversity and Abundance of Insects Pollinator of Chayote (Sechium edule (Jacq.) Swartz Alfawwaz, Muhammad Dzaky; Permana, Agus Dana; Putra, Ramadhani Eka
Jurnal Biodjati Vol 7 No 1 (2022): May
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v7i1.13881

Abstract

Chayote plants (Sechium edule) with monoecious characters require a pollination process. The pollination process requires pollinating agents to increase its productivity, one of which is insects. This research aimed to determine the diversity and abundance of insects pollinator on chayote plants. Observation of diversity and abundance used a scan sampling method. Pollinator insects observations were carried out in 3 time periods, morning, afternoon, and evening on male and female flowers. We measured environmental parameters such as temperature, humidity, wind speed, and light intensity. Eight species of wild insects pollinated chayote flowers, Apis cerana, Apis dorsata, Lasioglossum leucozonium, Polistes sagittarius, Phimenes flavopictus, Campsomeriella annulata, Lucilia sericata, and Musca domestica. The insect pollinators community had moderate diversity (1.23), a relatively dynamic community (0.59), and moderate dominance (0.62), with A. cerana, which had been the dominant insect pollinator with a relative abundance of 61.63%. Musca domestica and L. sericata were (0,58%) the least dominant insect pollinator with a relative abundance of 0.58%. This research concludes that the insects pollinator of chayote has a moderate level of diversity, relatively dynamic community, and average dominance.
Antibiotic Resistance in Escherichia coli Isolated from Feces of Bali Cattle With Reproductive Disorders Kholik, Kholik; Munawaroh, Muhammad; Saputra, Muhammad Rama Imam; Rahmawati, Rahmawati; Srianto, Pudji
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13925

Abstract

Antimicrobial resistance (AMR) has become a global issue in animal, human and environmental health. The AMR profile of Escherichia coli reflects the use of antibiotics in production animals. The purpose of this study was to determine the antibiotic resistance of Escherichia coli bacteria isolated from the feces of female Bali cattle with reproductive disorders. Feces samples were taken purposively using a swab on 4 rectums from 7 Bali cattle with reproductive disorders in June 2021 in Lando Village, East Lombok Regency. Escherichia coli samples were isolated on Eosin Methylene Blue Agar media and identified by biochemical tests. An antibiotic resistance test against Escherichia coli was carried out by the disk diffusion method. The antibiotics used in the test were Penicillin G 10 U, Oxytetracycline 30 g, Gentamicin 10 g, and Tetracycline 30 g, and Cefotaxime 30 g. The results of planting on Eosin Methylene Blue Agar media obtained 4 Escherichia coli which were successfully isolated from 4 samples of Bali cattle feces. Data on the level of Escherichia coli susceptibility level to various antibiotics were analyzed using the chi-square test. The results of the susceptibility test to antibiotics showed that 4 samples of Escherichia coli (100%) were resistant to Penicillin G, (25%) were resistant to Oxytetracycline, (25%) were resistant to Cefotaxime, and (100%) samples of Escherichia coli were sensitive to Gentamicin and Tetracycline. The chi-square test on the level of Escherichia coli susceptibility to various antibiotics was significant with p˂ 0.05 (p-value = 0.012). The results of this study have shown that Escherichia coli from Bali cattle feces experience multidrug resistance which later on might have an impact on human health and the environment.
Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Resmi, Denia Dwi Citra; Hidayat, Topik; Sriyati, Siti
Jurnal Biodjati Vol 6 No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.