cover
Contact Name
AGRIVITA Editorial Team
Contact Email
agrivita@ub.ac.id
Phone
+62341-575743
Journal Mail Official
agrivita@ub.ac.id
Editorial Address
Jl. Veteran Malang 65145 Jawa Timur, Indonesia
Location
Kota malang,
Jawa timur
INDONESIA
AGRIVITA, Journal of Agricultural Science
Published by Universitas Brawijaya
ISSN : 01260537     EISSN : 24778516     DOI : https://doi.org/10.17503
Core Subject : Agriculture,
AGRIVITA Journal of Agricultural Science is a peer-reviewed, scientific journal published by Faculty of Agriculture Universitas Brawijaya Indonesia in collaboration with Indonesian Agronomy Association (PERAGI). The aims of the journal are to publish and disseminate high quality, original research papers and article review in plant science i.e. agronomy, horticulture, plant breeding, soil sciences, plant protection and other pertinent field related to plant production. AGRIVITA is published three times per year. The Journal has been indexed in SCOPUS, Scimago Journal Ranks (SJR), Emerging Source Citation Index ( ESCI-Web of Science), EBSCO, ProQuest, Google Scholar and others international indexing. AGRIVITA is accredited first grade (Sinta 1/S1) for five years (2018-2023) based on Decree No: 30/E/KPT/2018 by Ministry of Research, Technology and Higher Education (Ristek Dikti), The Republic of Indonesia. We accept submission from all over the world. All submitted articles shall never been published elsewhere, original and not under consideration for other publication.
Arjuna Subject : -
Articles 17 Documents
Search results for , issue "Vol 47, No 1 (2025)" : 17 Documents clear
Assessment on Genetic Diversity and Relationship of 19 Bird Pepper Genotypes Based on Morphological and SSR Markers Rustikawati, Rustikawati; Herison, Catur; Sutrawati, Mimi; Prameswari, Wuri
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4447

Abstract

A comprehensive assessment of genetic diversity offers invaluable insights to breeders. This study aims to analyze the genetic diversity of 19 cayenne pepper genotypes using morphological and SSR markers.  Morphological markers are essential for evaluating visible traits while SSR markers provide deeper insights into genetic variation. Using both morphological and SSR markers provides a more robust, multidimensional approach to understanding genetic diversity. Morphological characterization was conducted on 19 bird pepper genotypes using 30 distinct traits, further divided into 95 sub-traits, to evaluate vegetative and generative growths. Molecular profiling was carried out using 10 SSR primers. The SSR analysis yielded 80 scorable bands, of which 72 were polymorphic. The high polymorphic information content suggests that these markers were effective in differentiating the genotypes.   The genetic diversity within the population was substantially high, providing valuable genetic material for breeding programs. Genetic similarity analysis divided the population into six distinct groups. Among them, Group I (genotype A05 Taiwan) and Group VI (genotype A02, Bengkulu Indonesia) formed unique, solitary groups, distinguishing them from other clusters. This information is highly beneficial for bird pepper cultivar development, emphasizing the importance of incorporating additional traits to align with the cultivar development of high yielding and saline-stress tolerance.
Spodoptera litura F. Immune System Against Exposure to the Biopesticide Mirabilis jalapa L. Maulina, Dina; Sumitro, Sutiman Bambang; Lestari, Sri Rahayu; Djoa, Dominikus Djago
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4351

Abstract

Synthetic insect repellent contributed to increasing farm products. This research studies the influence of an extract of Mirabilis jalapa. It is a vegetative insect repellent. It was applied to the polyphagous pest's cellular and humoral immune reactions, Spodoptera litura. This study targeted the body's resistant reaction to S. litura at the cellular and humoral tiers after contacting biopesticides from M. jalapa extracts. This research examined the process of cellular counteraction by assessing the varieties of hemocytes employing the ANOVA test and a phagocytosis test using percentages. The function of the humoral-resistant counteraction was assessed by phenoloxidase analysis employing the ANOVA test. The results demonstrated that a 0.2% M. jalapa concentrate solution noticeably affected the numbers of prohemocytes, granular cells, oenocytoid cells, and spherules compared to reference samples (p<0.05). Moreover, sub-lethal levels show noticeable kinds in PO enzyme levels (p<0.05), with a notable improvement after one hour of handling. Phagocytosis, on the other hand, demonstrated a drop in the ratio of phagocytic cells at 0.4% dose concentrations contrasted to the control group, suggesting a hidden impact on the pest's resistant response. This research reveals that the ability of M. jalapa extract as a biopesticide with immunosuppressive effects on S. litura.
New Report: Helopeltis cinchonae Mann (Hemiptera: Miridae) Attacking Commercial Hydrangea Flowering Plants in East Java, Indonesia Suputa, Suputa; Sari, Riya Fatma; Tarno, Hagus
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4669

Abstract

Formerly, the mirid bug has not been recorded for Hydrangea macrophylla (Thunb.), in Indonesia. Infestation of mirid bug was found on the leaves of Hydrangea in the vegetative growth phase from July 2023 to July 2024 in five hamlet fields at the ornamental farming center in Batu City, East Java. Plant samples were observed diagonally and five plants in each point were selected for samples. On each of the top ten leaves of the sample plants, the percentage of attack symptoms was carefully observed. Nymphs found during the observation were reared to imago, and adults were identified as Helopeltis cinchonae Mann (Hemiptera: Miridae). Insect pests, infestation symptoms, and egg locations were documented during the study. This is the first report of a pest causing significant damage to commercial Hydrangea plants in Batu, East Java, indicating the need to develop an integrated pest management strategy to support increased Hydrangea cut flower production in Batu. 
Effect of Boron Foliar Fertilizer and Mycoseed-Cookies on the Morphological and Seeds Production of Jack Bean (Canavalia ensiformis) Armaji, Yone; Abdullah, Luki; Karti, Panca Dewi Manu Hara; Astuti, Dewi Apri; Nahrowi, Nahrowi
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4423

Abstract

This research identified the effects of foliar application of boron fertilization and arbuscular mycorrhiza in the form of cookies (Miko-SC) on the growth and seed production of Jack bean. Jack bean (Canavalia ensiformis) is a dual-purpose crop that produces seeds and green-biomass as a source of protein for human consumption and animal feed. Boron and Miko-SC significantly influences seed growth and development, and arbuscular mycorrhiza can enhance mineral uptake. This study employed four doses of boron foliar fertilizer (0, 23, 46, and 69 mg/l) and three diameters of Miko-SC (4, 5, and 6 cm). The highest values of plant height, stem diameter, and leaf size were observed in the combination of 46 mg/l boron and 5-cm Miko-SC. The highest number of leaves, pod weight, and grain weight were achieved at 23 mg/l boron combined with 6-cm Miko-SC. Conclusively, the optimal combination of boron and arbuscular mycorrhiza in the form of Miko-SC cookies significantly enhanced the growth of Jack bean, offering valuable insights into cultivation improvement as a forage and food crop.
Mortality and Antifeedant Effects of some Jamu Waste Extract on Larvae of Spodoptera litura Ikawati, Silvi; Silalahi, Fuji Nafratilova; Izzah, Annisa Nurul; Choliq, Fery Abdul; Mustofa, Oki
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4564

Abstract

The amount of herbal waste in Indonesia is quite high, so it needs to be managed to reduce the amount and increase the value of benefits. One way is to utilize it as a botanical insecticide. This study aims to determine the effect and concentration of herbal waste extract that is effective on mortality and inhibition of feeding activity of Spodoptera litura (F.) (Lepidoptera: Noctuidae). Larvae of S. litura are one of the pests in mustard plants. The extraction method used a maceration method with ethanol solvent. Research using four types of herbal waste extracts with a leaf dipping method. The results show that four extracts affect increased mortality and inhibition of the feeding activity of S. litura larvae. The value of LC50 is at 60 HAA, LT50, and the inhibition of eating activity at a concentration of 36% by ginger jamu waste extract is 29%, 27 hours, and 64%. In contrast, curcuma jamu waste extract was 25%, 24 hours, and 68%, respectively. For LC50 at 72 HAA, LT50 and inhibition of eating activity at a 50% concentration of galangal jamu waste extract was 17%, 14 hours, and 43%. While turmeric jamu waste extract was 17%, 16 hours, and 42% respectively.
Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication Rantau, Deritha Ellfy; Noorohmah, Siti; Rahayu, Resa Sri; Syahid, Sitti Fatimah; Hapsari, Betalini Widhi; Wulandari, Dyah Retno; Raihan, Eldrian Daffa; Haz, Aufa Rizqia; Kumala, Ajeng Putri; Yuliawati, Yuliawati; Desriani, Desriani
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4548

Abstract

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.
Specific Primer Design for Detection and Quantification of Entomopathogenic Fungi Metarhizium anisopliae using Quantitative PCR (qPCR) in Soil and Cocoon Samples Saragih, Syaiful Amri; Takemoto, Shuhei; Kamata, Naoto
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4644

Abstract

The information on the abundance and dynamics of entomopathogenic fungus Metarhizium anisopliae on the soil is limited by the existence of insect hosts. In this study, to detect and quantify specifically for M. anisopliae from extract of soil DNA, a culture-independent approach based on DNA and employing quantitative Polymerase Chain Reaction (qPCR) was developed. Primer pairs were designed and tested for their specificity to get a specific primer pair. The best primer pair was determined to be MA6071F/MA6218R. Two standard curves were created using 10 concentration levels (101 to 1010) by qPCR. Standard curves for genomic DNA showed a strong relationship and good fitting (R2 > 0.980). Six levels were obtained to generate standard genomic DNA (R2= 0.98, E = 1.05). Eight levels (R2= 0.9854, E = 0.91) were created for standard soil DNA. By qPCR, M. anisopliae was not found in all soil samples, possibly due to the samples' low fungal density. However, 13 dead cocoon samples out of 80 showed positive for M. anisopliae. To successsfully detect and quantify M. anisopliae in soil, the method of DNA extraction and soil sampling should be enhanced.
Unveiling Yield Potential in Pakistani Bread Wheat Through Genotype x Environment Interactions Ullah, Rafi; Khan, Fahim Ullah; Ullah, Inam
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4667

Abstract

This research investigates the interplay of genotypes and year on yield and related traits in bread wheat. Two hundred wheat genotypes, including commercial varieties and landraces were evaluated at Hazara University, Pakistan during 2020-2021 and 2021-2022 crop seasons. Analysis of variance revealed significant differences among genotypes, years, and genotype × year interactions (G × Y) for traits like tillers per square meter, grain weight per spike, grains per spike, 1000-grain weight, biological yield, and grain yield. Descriptive statistics outlined the range and mean values for these traits over two years. Noteworthy genotypes, such as Milat-2011 (maximum tillers), Khirman (heaviest grain weight per spike), NIFA-Aman (most grains per spike), and Pakistan-13 (heaviest 1000-grain weight), showed superior performance. Tandojam-83 led in biological yield, and Punjab-1 excelled in grain yield. Principal Component Analysis (PCA) identified biological yield and grain yield as major contributors to genetic variation. Cluster analysis revealed significant variability, grouping genotypes like Punjab-1, Tandojam-83, Punjab-96, Ufaq, and others into distinct clusters. Significant positive correlations were found between tillers per square meter with both biological yield and grain yield. This study offers valuable insights into G × Y interactions and genetic diversity, aiding wheat breeding programs aimed at improving yield and stability.
Evaluation of the Resistance of Some Maize Varieties to Rot Diseases Caused by Different Strains of Fusarium verticillioides (Sacc.) Nirenberg Akanmu, Akinlolu Olalekan; Sobowale, Ayodele Adegboyega; Odebode, Adegboyega Christopher; Babalola, Olubukola Oluranti
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.3917

Abstract

Maize ear rot, caused by Fusarium verticillioides, is a significant concern due to its impact on grain contamination and yield reduction. The virulence of this pathogen varies markedly among different strains. This study aimed to assess the pathogenicity of ten F. verticillioides strains; EKT 06, AKR 05, IBD 06, ILH 03, IGH 06, SAK 03, ERW 06, IGB 06, IJB 02, and ILR 05 across three maize varieties: SWAM-1-SR-Y, DMR LSR Y, and BR 9943-DMR-SR-W. A screen-house pathogenicity test was conducted, arranged in a complete randomized design (CRD) with four replications. Inoculation with standardized spore suspensions was conducted through the silk channel in the 7th week after planting (WAP). Among the strains, AKR 05 exhibited the highest virulence, with ear rot severity of 52.8%, followed by ILR 05 (48.6%), ERW 06 (47.3%), and IBD 06 (46.1%). In contrast, SAK 03 (31.4%) and ILH 03 (37.8%) demonstrated the lowest severity levels. The growth parameters of BR 9943-DMR-SR-W were significantly higher than those of SWAM-1-SR-Y and DMR-LSR-Y. The BR 9943-DMR-SR-W variety showed the greatest resistance to the fungal strains, suggesting it is a promising option for cultivation in environments prone to ear rot. Further field trials are necessary to validate these findings.
Evaluation of BiomeFert Biofertilizer for Growth and Yield Improvement in Glycine max L. Varieties Dega-1 Fatimah, Fatimah; Putri, Elsha Nadya Marchelia; Salsabila, Syarifah; Rahayuningtyas, Nazil Dwi; Soelistyo, Anastasya Nabila Putri; Arneni, Wanda Dya; Febrionny, Princessa Nandita; Supriyanto, Agus; Nimatuzahroh, Nimatuzahroh; Geraldi, Almando
AGRIVITA Journal of Agricultural Science Vol 47, No 1 (2025)
Publisher : Faculty of Agriculture University of Brawijaya in collaboration with PERAGI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17503/agrivita.v47i1.4672

Abstract

Biofertilizer application can potentially reduce chemical residues in soil from synthetic fertilizers. This study investigates the effects of varying doses and application frequencies of biofertilizers on the growth, productivity, and Relative Agronomic Effectiveness (RAE) of Glycine max L. A Completely Randomized Design was employed, with 9 treatment combinations and 2 control groups (positive and negative), each replicated three times. The biofertilizer doses tested were 5, 10, and 15 ml per plant (B5, B10, B15), and application frequencies included 1 week after planting (WAP) (F1), at 1 and 4 WAP (F2), and at 1, 4, and 8 WAP (F3). The negative control received no biofertilizer, while the positive control received NPK (5 g/plant). Plant growth was assessed by measuring height and leaf number, and productivity was evaluated based on the number of pods, pod weight, dry seed weight, and weight per 100 seeds. Data were analyzed using one-way ANOVA. The results indicated that the treatment with 10 ml of biofertilizer applied twice (B10F2) significantly improved the growth and productivity of Glycine max L., achieving an RAE value of 169.70%.

Page 1 of 2 | Total Record : 17


Filter by Year

2025 2025


Filter By Issues
All Issue Vol 48, No 1 (2026) Vol 47, No 3 (2025) Vol 47, No 2 (2025) Vol 47, No 1 (2025) Vol 46, No 3 (2024) Vol 46, No 2 (2024) Vol 46, No 1 (2024) Vol 45, No 3 (2023): IN PRESS Vol 45, No 3 (2023) Vol 45, No 2 (2023) Vol 45, No 1 (2023): IN PRESS Vol 45, No 1 (2023) Vol 44, No 3 (2022) Vol 44, No 2 (2022) Vol 44, No 1 (2022) Vol 43, No 3 (2021) Vol 43, No 2 (2021): ARTICLE IN PRESS Vol 43, No 2 (2021) Vol 43, No 1 (2021) Vol 42, No 3 (2020) Vol 42, No 2 (2020) Vol 42, No 1 (2020) Vol 41, No 3 (2019) Vol 41, No 2 (2019) Vol 41, No 1 (2019) Vol 40, No 3 (2018): OCTOBER Vol 40, No 2 (2018): JUNE Vol 40, No 1 (2018): FEBRUARY Vol 39, No 3 (2017): OCTOBER Vol 39, No 2 (2017): JUNE Vol 39, No 1 (2017): FEBRUARY Vol 38, No 3 (2016): OCTOBER Vol 38, No 2 (2016): JUNE Vol 38, No 1 (2016): FEBRUARY Vol 37, No 3 (2015): OCTOBER Vol 37, No 2 (2015): JUNE Vol 37, No 2 (2015) Vol 37, No 2 (2015): JUNE Vol 37, No 1 (2015): FEBRUARY Vol 37, No 1 (2015) Vol 36, No 3 (2014) Vol 36, No 3 (2014) Vol 36, No 2 (2014) Vol 36, No 2 (2014) Vol 36, No 1 (2014) Vol 36, No 1 (2014) Vol 35, No 3 (2013) Vol 35, No 3 (2013) Vol 35, No 2 (2013) Vol 35, No 2 (2013) Vol 35, No 1 (2013) Vol 35, No 1 (2013) Vol 34, No 3 (2012) Vol 34, No 3 (2012) Vol 34, No 2 (2012) Vol 34, No 2 (2012) Vol 34, No 1 (2012) Vol 34, No 1 (2012) Vol 33, No 3 (2011) Vol 33, No 3 (2011) Vol 33, No 2 (2011) Vol 33, No 2 (2011) Vol 33, No 1 (2011) Vol 33, No 1 (2011) Vol 32, No 3 (2010) Vol 32, No 3 (2010) More Issue