Article Per Year (5 Year)
p-Index From 2021 - 2026
3.885
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Journal of Tropical Life Science : International Journal of Theoretical, Experimental, and Applied Life Sciences Berkala Perikanan Terubuk JBIO: jurnal biosains (the journal of biosciences) Biogenesis: Jurnal Ilmiah Biologi Jurnal Biologi Universitas Andalas Jurnal Biologi Tropis Best Journal (Biology Education, Sains and Technology) Indonesian Journal of Laboratory Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat Biodiversitas Journal of Biological Diversity
Dewi Imelda Roesma
Universitas Andalas
Agriculture, Biological Sciences & Forestry Humanities Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences Economics, Econometrics & Finance Education Environmental Science Immunology & microbiology Mathematics Mechanical Engineering Medicine & Pharmacology Physics Public Health Social Sciences Other

Published : 39 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 39 Documents
Search

 1   2   3   4 
DNA primer design for sex identification of Sumatran tiger body samples IKRIMA ASRORI; DJONG HON TJONG; WILSON NOVARINO; MANSYURDIN MANSYURDIN; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240129

Abstract

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.
The importance of DNA barcode reference libraries and selection primer pair in monitoring fish diversity using environmental DNA metabarcoding DEWI IMELDA ROESMA; DJONG HON TJONG; SYAIFULLAH SYAIFULLAH; NOFRITA NOFRITA; MUHAMMAD NAZRI JANRA; FURQAN DWIKI LINTANG PRAWIRA; VIOLA MUTIARA SALIS; DYTA RABBANI AIDIL
Biodiversitas Journal of Biological Diversity Vol. 24 No. 4 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240438

Abstract

Abstract. Roesma DI, Tjong DH, Syaifullah, Nofrita, Janra MN, Prawira FDL,Salis VM, Aidil DR. 2023.The importance of DNA barcode reference libraries and selection primer pair in monitoring fish diversity using environmental DNA metabarcoding. Biodiversitas 24: 2251-2260. Environmental DNA (eDNA) metabarcoding has become an alternative method used for biodiversity monitoring of an ecosystem. The eDNA metabarcoding has advantages compared to the conventional method because it is non-invasive, quick, and requires less cost. However, the effectiveness of the eDNA method is highly dependent on the coverage of the DNA barcode reference and primerpair. A study using the eDNA method was conducted for fish biodiversity monitoring in Singkarak Lake. Two-liter water samples were collected using sterile bottle samples at each sampling site (five sites). The universal primers (Fish FI and Fish R1) used for Next-generation sequencing (GRIDION, Nanopore, Oxford Technologies). The study detected 152 fish species using eDNA metabarcoding. Ten species out of the 30 originally reported in Singkarak Lake were detected using eDNA metabarcoding. The low percentage of fish detected is thought to be due to several factors; incomplete/unavailability of freshwater fish DNA barcodes in Indonesia registered in the database repository, inappropriate primer pair selection, low DNA quality, and the absence of target species DNA in collected water samples. The results demonstrated the significance of correctly registering DNA barcodes to the database and appropriate primer pair selection to identify eDNA metabarcoding. This study provides recommendations using eDNA metabarcoding for monitoring in future work.
Freshwater fish diversity from Siberut Island, a small island in the western part of Sumatra, Indonesia DEWI IMELDA ROESMA; DJONG HON TJONG; DYTA RABBANI AIDIL; FURQAN DWIKI LINTANG PRAWIRA; ANDRI SAPUTRA
Biodiversitas Journal of Biological Diversity Vol. 25 No. 2 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250244

Abstract

Abstract. Roesma DI, Tjong DH, Aidil DR, Prawira FDL, Saputra A. 2024. Freshwater fish diversity from Siberut Island, a small island in the western part of Sumatra, Indonesia. Biodiversitas 25: 836-845. Indonesia is an archipelagic country with thousands of islands, including small islands with a variety of biodiversity, such as freshwater fish. Data and information on the fish biodiversity of small islands in the western part of Sumatra are limited, including Siberut Island. A study on freshwater fish diversity in Siberut Island was carried out using morphological and molecular methods. The study was conducted on seven rivers in the North and South Siberut Districts, Siberut Island. The study obtained 676 individuals, including 34 species, 26 genera, 16 families, and 10 orders. Oxudecidae is the family with the largest species (8), and Rasbora jacobsoni has the highest number of individuals (341). Species richness ranged from 2 to 18 species per site and was highest in the Srilanggai River. Siberut Island has low-moderate freshwater fish diversity. As many as 90 DNA barcodes of individuals from 34 species have been submitted to the Barcode of Life Data System. Freshwater fish groups do not receive enough attention from local communities and the government because of the richness of marine fish on Siberut Island. Apart from functioning as evidence of species richness, the results of this study are also useful for local communities' education.
Systematics molecular investigation of Palo fish (Betta sp.) in the Harau Valley, West Sumatra using the COI gene UMMI KURNIA PUTRI; DEWI IMELDA ROESMA; DJONG HON TJONG
Biodiversitas Journal of Biological Diversity Vol. 26 No. 2 (2025)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d260217

Abstract

Abstract. Putri UK, Roesma DI, Tjong DH. 2025. Systematics molecular investigation of Palo fish (Betta sp.) in the Harau Valley, West Sumatra using the COI gene. Biodiversitas 26: 698-705. Palo fish (Betta sp.) is a local ornamental fish in the Harau Valley, Lima Puluh Kota, West Sumatra, Indonesia, which was suspected to be a new species from the Betta of the Pugnax group based on the Cytochrome b gene. Molecular investigations using more reliable genes were needed to validate the taxonomic status of Palo fish and determine the phylogenetic relationship with other Betta species. The cytochrome oxidase I (COI) gene has been recognized for identification at the species level. Liver tissue samples were taken from eight Palo fish individuals from four Rangkak Hill tributaries in Harau Valley. Eight Palo fish and 44 comparison sequences were analyzed using the Aliview, IQ Tree, and MEGA VII programs. The 641 bp COI gene sequences analysis showed that Palo fish from four tributaries in Harau Valley had 100% nucleotide base similarity (identical), which shared the same haplotype. Palo fish have a close relationship with Betta stigmosa and have the least genetic distance to Betta cf. apollon (2.6%), followed by Betta ferox (3.1%) and Betta apollon (3.7%). The genetic distance values show the differences at the subspecies level within the same species. Palo fish from Harau Valley confirmed as Betta cf. stigmosa. Comprehensive studies on Betta species need to be carried out to complete the systematics of the Betta group.
DNA barcoding of Mugilogobius mertoni and M. rambaiae from Siberut and Enggano Islands, the small outermost islands of Sumatra, Indonesia DEWI IMELDA ROESMA; DJONG HON TJONG; SYAIFULLAH SYAIFULLAH; DYTA RABBANI AIDIL
Biodiversitas Journal of Biological Diversity Vol. 26 No. 1 (2025)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d260138

Abstract

Abstract. Roesma DI, Tjong DH, Syaifullah, Aidil DR. 2025. DNA barcoding of Mugilogobius mertoni and M. rambaiae from Siberut and Enggano Islands, the small outermost islands of Sumatra, Indonesia. Biodiversitas 26: 386-395. Siberut and Enggano Islands are the small and outermost islands of Sumatra, Indonesia. These two islands' unique geological history allows evolutionary processes to produce high levels of endemicity. One of the interesting fish genera from the Siberut and Enggano Islands is Mugilogobius. Based on morphological identification, it was estimated there are two Mugilogobius species in the Siberut and Enggano Islands. Molecular identification of Mugilogobius using the Cytochrome Oxidase I gene (known as DNA barcoding) needs to be done to prove it. The liver tissue was used for molecular analysis. The BLAST analysis showed that Mugilogobius from Siberut and Enggano Islands have a similarity range of 97.49%-96.06% with Mugilogobius GenBank. Based on the 558 bp sequence analyzed, Mugilogobius mertoni and Mugilogobius rambaiae from Siberut and Enggano Islands have a low sequence of divergences at 0.0%-0.4%, respectively. M. rambaiae from Siberut and Enggano Islands share the same haplotype. The ability of the species to maintain their genetics and the similarity of conditions between the two islands share their high genetic similarities. M. mertoni and M. rambaiae from Siberut and Enggano Islands have a high sequence of divergences at 3.0-4.6% with M. mertoni and M. rambaiae GenBank, respectively. The long-distance location, the presence of the ocean as a barrier, and differences in habitat conditions contribute to the high variations between Mugilogobius from two islands and other populations. Mugilogobius from Siberut and Enggano Islands has a sequence of divergence at 12.4%-17.3% compared to other Mugilogobius species, supporting their differences at the species level in the same genera. This study contributed to presenting the first molecular data of Mugiologius that can be used as a sequence reference for identification and the sequences became the genetic richness data of fish in the small and outermost islands of Sumatra, Indonesia (Siberut and Enggano Islands).
Morphology and molecular studies to reveal the taxonomic status of endemic fish Barbonymus belinka of Lake Singkarak, West Sumatra, Indonesia VIOLA MUTIARA SALIS; Djong Hon Tjong; Syaifullah Syaifullah; Dahelmi Dahelmi; Aadrean Aadrean; Dewi Imelda Roesma
Biodiversitas Journal of Biological Diversity Vol. 26 No. 2 (2025)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d260203

Abstract

Abstract. Salis VM, Tjong DH, Syaifullah, Dahelmi, Aadrean, Roesma DI. 2025. Morphology and molecular studies to reveal the taxonomic status of endemic fish Barbonymus belinka of Lake Singkarak, West Sumatra, Indonesia. Biodiversitas 26: 536-550. Species identification is very important in taxonomy and conservation. There are some cases where the distinctive morphological characters of a species show minor differences; for example, the Balingka fish (Barbonymus belinka), endemic to Lake Singkarak, West Sumatra, Indonesia and the Kapiek fish (Barbonymus schwanefeldii). The local community around Lake Singkarak gives two names to the Balingka fish based on size (the larger ones are called Balingka, and the smaller ones are called Kapiek), it can affect the taxonomy and validity of biodiversity data. The lack of comprehensive information on B. belinka has led to the species being classified as Data Deficient (DD) on the IUCN Red List. Additionally, the presence of a DNA barcode for Balingka fish in the BOLD system, listed under a different species name than in GenBank (NCBI), raises concerns about potential species misidentification and data inconsistencies. A thorough taxonomy review of Balingka fish (B. belinka) is necessary, utilizing both morphological and molecular approaches. This study aims to clarify the taxonomy and investigate the phylogenetic relationships of the two fish species through morphological and molecular analyses, utilizing Cytochrome Oxidase-I and Cytochrome b gene sequences. Individual samples were used for morphological identification, while liver tissue was used for molecular analysis. The results showed morphometric variations, but meristic traits confirmed that both fishes belong to the same species, B. schwanefeldii. Molecular analysis shows a genetic distance of 0-1.4% for Cytochrome Oxidase-I gene and 0-2.3% for Cytochrome b gene, indicating the same species. Two specific bases at 585 bp of the Cytochrome Oxidase-I gene and four specific bases at 599 bp of the Cytochrome b gene are also found unique to B. schwanefeldii from Lake Singkarak, suggesting that these two fishes may represent the same species.
Mitochondrial COI gene-based phylogenetic and haplotype analysis of Manouria emys from Sumatra, Indonesia ASHRIFURRAHMAN ASHRIFURRAHMAN; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA; DJONG HON TJONG; INDRI LESTARI
Biodiversitas Journal of Biological Diversity Vol. 26 No. 12 (2025)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d261224

Abstract

Abstract. Ashrifurrahman, Syaifullah, Roesma DI, Tjong DH, Lestari I. 2025. Mitochondrial COI gene-based phylogenetic and haplotype analysis of Manouria emys from Sumatra, Indonesia. Biodiversitas 26: 6224-6231. Genetic and phylogenetic analyses are essential for understanding the evolutionary relationships and genetic variation of the critically endangered Manouria emys, particularly in Indonesia, where molecular data remain limited. This study aimed to determine the phylogenetic placement and haplotype diversity of M. emys from Sumatra, Indonesia representing the first COI record from this region. A single sample collected from West Sumatra was analyzed through DNA extraction, PCR amplification of the COI (Cytochrome Oxidase Subunit I) gene, and sequencing. An 886 bp COI gene fragment was confirmed as M. emys through sequence similarity analysis and subsequently aligned with 29 global reference sequences for phylogenetic and haplotype analyses. Phylogenetic analysis using the Maximum Likelihood method showed that the Sumatran sample clustered within the M. emys emys clade, together with sequences from Borneo and the Taipei Zoo. Three subclades were observed within M. emys, corresponding to M. emys emys, M. emys phayrei, and one distinct genetic lineage of unconfirmed subspecies status. The analysis showed low genetic divergence within each subspecies but relatively high differentiation between M. emys and the outgroup. Haplotype analysis identified three main haplogroups, with the Sumatran sample showing close genetic affinity to M. emys emys from Borneo. The presence of multiple M. emys emys haplotypes reported from India may reflect population movement or human mediated translocation, highlighting the need for broader regional studies. This study provides the first molecular evidence of M. emys from Sumatra, offering a valuable genetic reference for future research, conservation management, and monitoring of wildlife trade involving this critically endangered tortoise.
Five microsatellite loci for preliminary kinship analysis and implications for conservation in Sumatran Tigers (Panthera tigris sumatrae) IKRIMA ASRORI; WILSON NOVARINO; DJONG HON TJONG; PATRICK FLAGGELLATA; YOLI ZULFANEDI; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 27 No. 5 (2026)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d270533

Abstract

Abstract. Asrori I, Novarino W, Tjong DH, Flaggellata P, Zulfanedi Y, Roesma DI. 2026. Five microsatellite loci for preliminary kinship analysis and implications for conservation in Sumatran Tigers (Panthera tigris sumatrae). Biodiversitas 27 (5): d270533. https://doi.org/10.13057/biodiv/d270533. Microsatellite markers are widely used in wildlife pedigree analysis due to their high polymorphism and ability to assist in the determination of kinship relationships. Accurate pedigree information is crucial for effective population management and prevention of inbreeding in Sumatran tigers (Panthera tigris sumatrae), particularly in captive breeding programs. Fifteen microsatellite loci in the Felidae family were selected from previous studies and tested in 20 individuals, including six individuals with known kinship relationships, to identify informative and reliable markers for kinship analysis of Sumatran tigers. Amplification results showed that nine loci were consistently amplified in all samples with relatively high polymorphism. These loci were then evaluated for the number of alleles (Na), observed heterozygosity (Ho), polymorphic information content (PIC), amplification consistency, and genotyping error rate. Five loci showed consistent amplification and high levels of heterozygosity and polymorphism, with three loci (FCA279, FCA304, and FCA391) showing an error rate of 0.00, while two loci (FCA441 and 6HDZ700) had a lower error rate. Therefore, these five loci were selected as candidate markers for the Sumatran tiger pedigree analysis. Meanwhile, the other four loci (FCA008, 6HDZ463, 6HDZ170, and FCA220), although showing high Na, Ho, and He values, also had high error rates. Therefore, these four loci were excluded from further analysis. Cumulative probability of identity (PID) and PIDsibs estimates indicated that the selected panel of five loci had greater discriminatory power than only three loci. Kinship analysis using the selected loci yielded the expected relationships among known individuals, although the software's analysis model does not explicitly define parent-offspring relationships. Therefore, these results are preliminary and require further validation before broader application, given the limited sample size and incomplete representation of pedigree relationships.
DIVERSIFIKASI OLAHAN PISANG MELALUI PENGABDIAN MASYARAKAT: MEWUJUDKAN KEMANDIRIAN EKONOMI BERBASIS NAGARI DI DESA SAUREINU, SIPORA SELATAN Mairawita; Solfiyeni; Dewi Imelda Roesma; Mildawati; Vera Pujani; Taufik Rahman; Salsa Fauzania
Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat Vol. 4 No. 1 (2025): Jurnal Abdi Inovatif : Pengabdian kepada Masyarakat
Publisher : Universitas Nusa Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31938/jai.v4i1.793

Abstract

Abstract Saureinu is a village located in the interior of Sipora Island, Mentawai Islands Regency. The majority of the village's population works as banana farmers. This community service activity aims to build the Saureinu Village community's capacity to manage banana potential into high-value products, support the village's economic independence, and strengthen the community-based economy. The methods used include a participatory approach with stages of potential and problem surveys, technical training on banana product diversification, and training in small business management and marketing through digital platforms. The results of this program show significant success in improving the skills of the Saureinu Village community in processing bananas into various innovative products with economic value. Products such as banana chips with multiple flavors, banana jam, nuggets, and frozen bananas ready to fry are the main results of the training and mentoring provided. These products have been successfully developed and marketed locally and through a wider distribution network, opening up new market opportunities for the community. In addition, this program positively impacts community income due to the sale of processed banana products. Participants also gain a deeper understanding of small business management, from raw material management to marketing strategies, including digital marketing relevant to current market needs. With the increase in skills and knowledge, the community is more confident in developing businesses based on local potential, which ultimately supports the creation of community-based economic independence. This program proves that processing local agricultural products can effectively improve community welfare in a sustainable manner. Keywords: Saureinu Village, marketing, banana products, small businesses Abstrak Saureinu merupakan salah satu desa yang terletak di pedalaman Pulau Sipora, Kabupaten Kepulauan Mentawai. Mayoritas penduduk desa ini berprofesi sebagai petani pisang. Kegiatan pengabdian kepada masyarakat ini bertujuan membangun kapasitas masyarakat Desa Saureinu dalam mengelola potensi pisang menjadi produk bernilai jual tinggi, mendukung kemandirian ekonomi nagari, serta memperkuat ekonomi berbasis komunitas. Metode yang digunakan meliputi pendekatan partisipatif dengan tahapan survei potensi dan permasalahan, pelatihan teknis diversifikasi produk pisang serta pelatihan manajemen usaha kecil dan pemasaran melalui platform digital. Hasil program ini menunjukkan keberhasilan signifikan dalam meningkatkan keterampilan masyarakat Desa Saureinu dalam mengolah pisang menjadi berbagai produk inovatif yang bernilai ekonomis. Produk-produk seperti keripik pisang aneka rasa, selai pisang, nugget dan pisang beku siap goreng menjadi hasil utama dari pelatihan dan pendampingan yang diberikan. Produk-produk tersebut tidak hanya berhasil dikembangkan, tetapi juga telah dipasarkan baik di tingkat lokal maupun melalui jaringan distribusi yang lebih luas, membuka peluang pasar baru bagi masyarakat. Selain itu, program ini memberikan dampak positif berupa peningkatan pendapatan masyarakat sebagai hasil dari penjualan produk olahan pisang. Peserta juga mendapatkan pemahaman yang lebih mendalam tentang manajemen usaha kecil, mulai dari pengelolaan bahan baku hingga strategi pemasaran, termasuk pemasaran digital yang relevan dengan kebutuhan pasar saat ini. Dengan adanya peningkatan keterampilan dan pengetahuan tersebut, masyarakat lebih percaya diri dalam mengembangkan usaha berbasis potensi lokal, yang pada akhirnya mendukung terciptanya kemandirian ekonomi berbasis komunitas. Program ini membuktikan bahwa pengolahan hasil pertanian lokal dapat menjadi solusi yang efektif untuk meningkatkan kesejahteraan masyarakat secara berkelanjutan. Kata Kunci:  Desa Saureinu, pemasaran, produk pisang, usaha kecil
Co-Authors - Syaifullah Aadrean Aadrean Aadrean Aadrean, Aadrean ADA CHORNELIA ADA CHORNELIA Agesi, Anugrah Viona AHMAD MURSYID AIDA FITRIANI SITOMPUL Aida Fitriani Sitompul Aidil, Dyta Rabbani ANDRI SAPUTRA Annisya Fitri ANUGRAH VIONA AGESI Anugrah Viona Agesi Arum Setiawan Ashrifurrahman Ashrifurrahman Asrori, Ikrima Aurora, Dhea Apriano Cynthia Ericca Dahelmi Dahelmi Dahelmi Dian Juliadmi Djong Hon Tjong Dwinda K Fitri DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL DYTA RABBANI AIDIL Dyta Rabbani Aidil DYTA RABBANI AIDIL DYTA RABBANI AIDIL EKO PRASETYA Elida Hafni Siregar ELIDA HAFNI SIREGAR FURQAN DWIKI LINTANG PRAWIRA FURQAN DWIKI LINTANG PRAWIRA Huda, Nadyatul Khaira IKRIMA ASRORI IKRIMA ASRORI Indra Junaidi Zakaria INDRI LESTARI Jabang Nurdin Janra, Muhammad Nazri Mairawita, Mairawita Mansyurdin Mida Yulia Murni Mildawati Mildawati MISTAR KAMSI Nadyatul Khaira Huda Nofrita Nofrita Nofrita Nofrita Nurul Aida PATRICK FLAGGELLATA Prawira, Furqan Dwiki Lintang Putra Santoso Rizaldi Rizaldi RUSDIYAN RITONGA Salis, Viola Mutiara Salsa Fauzania SARUEDI SIMAMORA Sidik, Muhamad Rayhan Silvia Indra Solfiyeni Solfiyeni Syaifullah Syaifullah Syaifullah SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah Taufik Rahman Tjong, Djong UMMI KURNIA PUTRI Usio, Nisikawa Vera Pujani VIOLA MUTIARA SALIS VIOLA MUTIARA SALIS WARNETY MUNIR WILA KARLINA Wilson Novarino YOLI ZULFANEDI Yuliwan Saputra Yusron Ritonga Zainal Zainal Zulkarnain, Alivia