Article Per Year (5 Year)
p-Index From 2021 - 2026
2.495
P-Index
This Author published in this journals
All Journal Vegetalika Journal of Tropical Life Science : International Journal of Theoretical, Experimental, and Applied Life Sciences Jurnal Natur Indonesia Jurnal Perikanan dan Kelautan AL KAUNIYAH Jurnal Pembangunan dan Alam Lestari Jurnal Biologi Universitas Andalas SEMIRATA 2015 Buletin Kebun Raya Jurnal AGROSAINS dan TEKNOLOGI Jurnal Biologi Tropis Jurnal Iktiologi Indonesia (Indonesian Journal of Ichthyology) Eksakta : Berkala Ilmiah Bidang MIPA Menara Perkebunan Floribunda Jurnal Pembelajaran dan Biologi Nukleus Sainstek : Jurnal Sains dan Teknologi Jurnal Pengabdian kepada Masyarakat Nusantara Warta Pengabdian Andalas: Jurnal Ilmiah Pengembangan Dan Penerapan Ipteks Berkala Penelitian Hayati Makara Journal of Science Buletin Dharmas Andalas Biodiversitas Journal of Biological Diversity
Mansyurdin
Biology Department, Faculty Of Mathematics And Natural Sciences, Universitas Andalas
Religion Agriculture, Biological Sciences & Forestry Astronomy Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Immunology & microbiology Languange, Linguistic, Communication & Media Library & Information Science Materials Science & Nanotechnology Mathematics Mechanical Engineering Medicine & Pharmacology Social Sciences Other

Published : 40 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 40 Documents
Search

 1   2   3   4 
Optimizing Soybean Chlorophyll Content Under Drought Stress: Unveiling the Potential of Biostimulants from Padina minor Yamada with Different Solvent Extraction De Yudanur, Parissa Anandita; Noli, Zozy Aneloi; Mansyurdin, Mansyurdin
Jurnal Biologi Tropis Vol. 24 No. 1 (2024): Januari - Maret
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v24i1.6568

Abstract

Biostimulants are natural compounds that can stimulate plant growth. Biostimulants from Padina minor contain secondary metabolites and growth-regulating substances needed in various plant growth metabolisms, including soybeans (Glycine max L.). Biostimulants also play a role in enhancing drought stress tolerance in plants. Several solvents are used to extract natural compounds found in P. minor. This study aims to investigate the effect of P. minor biostimulant extracted using various solvents on soybeans' chlorophyll content under different drought stress levels. The study used a completely randomized design (CRD) with two factors: a. Solvent (control, aquadest, methanol, and ethanol) and b. Soil field capacity (100%, 75%, 50%, and 25%). Applying P.minor as biostimulant extracted with methanol solvent showed higher average chlorophyll a, b, and total chlorophyll than other solvent types. Imposing stress up to 25% did not significantly affect soybean chlorophyll levels. However, the interaction between soil field capacity and P. minor extract from methanol solvent can trigger resilience response to drought conditions up to 25% soil field capacity and provide the highest average chlorophyll content compared to other treatments during the soybean vegetative period. Methanol is the best solvent for extracting P. minor as biostimulant and can provide the highest average chlorophyll content at 25% soil field capacity.
Effect of Crude Extracts Fern Leaves as Biostimulants on Biomass and Nodulation of Soybean (Glycine max L.) Dilla, Arfa Iskhia; Noli, Zozy Aneloi; Mansyurdin, Mansyurdin
Jurnal Biologi Tropis Vol. 24 No. 1b (2024): Special Issue
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v24i1b.8122

Abstract

Soybean (Glycine max) is a primary food commodity for the people in Indonesia, with most of its needs still dependent on imports. Efforts to increase local production require a sustainable strategy, including by use biostimulants. Natural biostimulants, such as fern leaf extract, is proven to be a solution in increasing the growth of plants. This study aims to evaluate the potential use of fern leaf extract as a biostimulant on biomass and the number of root nodules in soybean plants. The method used in this study was a factorial complete randomized design with 2 factors and 3 replications. Factor A is the source of crude extract of fern leaves, control, Gleichenia linearis, Diplazium esculentum, Nephrolepis exaltata, and Blechnum orientale. Factor B is the frequency of application extracts, namely 1 time and 2 times.The results showed that the application of Diplazium esculentum leaf extract with one application significantly increased the total number of root nodules, the number of effective root nodules and vegetative phase biomass. While in Nephrolepis exaltata with one time application can significantly increase the number of total root nodules and the number of effective root nodules. This increase is indicated by the content of bioactive compounds contained in the extract, so that it can increase the growth of soybean plants by stimulating the activity of soil microorganisms.
Pengembangan ESGP Kelurahan Lambung Bukit Kecamatan Pauh Kota Padang dengan Ikan Hias Mansyurdin, Mansyurdin; Asful, Ferdhinal; Nofrita, Nofrita; Maliza, Rita; Ashrifurrahman, Ashrifurrahman; Herwina, Henny; Nabila, Sylvia; Syabila, Hutri Dinda; Elisa, Tasya Putri Pratama; Kusuma, Hendra
Jurnal Pengabdian kepada Masyarakat Nusantara Vol. 7 No. 1 (2026): Edisi Januari - April
Publisher : Lembaga Dongan Dosen

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Ekowisata Sungkai Green Park (ESGP) terletak di kelurahan Lambung Bukit Kecamatan Pauh Kota Padang. Luas kawasan 4 ha dengan topografi berbukit, dan kekhasan konservasi habitat pohon Sungkai. Bentuk kegiatan ekowisata yang sudah terlaksana yaitu agrowisata dan perkemahan. Jumlah kunjungan masih didominasi oleh peserta kemah, sedangkan destinasi agrowisata belum menjadi daya tarik. Berdasarkan potensi kelurahan, dilakukan pengembangan ESGP dengan ikan hias. Tujuan kegiatan ini yaitu memberikan pengalaman dan keterampilan kepada anggota P4S Sungkai Permai dalam mengembangkan ESGP dengan kolam ikan hias.  Kegiatan pengembangan dilaksanakan dengan metode Participatory Action Research, melibatkan partisipasi aktif dan kolaboratif mitra P4S Sungkai Permai. Pada kawasan ESGP telah dibuat lima kolam yang diisi dengan 24 jenis ikan hias. Berdasarkan evaluasi kelayakan terdapat 12 jenis ikan hias yang layak dikembangkan pada kolam terbuka kawasan ESGP, yaitu Glofish Tetra, Glofish Tiger Barb, Dwarf Gourame, Angle Fish, Guppy, Platy Molly varian Golden Black, Glofih Danio, Komet Slayer, Red Jewel, Blue Jewel, dan Zebra Tilapia.
Monitoring Ekspresi Gen Chalcone Synthase dan Respon Pertumbuhan Lobak Singgalang (Brassica oleracea L.) Akibat Paparan Ultraviolet-B Ekstrem Puti Khairunnajwa Amar; Mansyurdin Mansyurdin; Nova Syafni; Ersa Nur Syafia; Muhammad Idris
Vegetalika Vol 14, No 2 (2025)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/veg.103190

Abstract

Singgalang cabbage (Brassica oleracea L.) is a local vegetable native to West Sumatra, cultivated in highlands around Mount Singgalang, Tanah Datar. Vegetables from Brassica genus are recognized for their high nutritional value and potential as functional foods. Key secondary metabolites in Brassica species, i.e., phenolic compounds and their derivatives, play a crucial role in antioxidant activity and are essential in promoting health. Light exposure, particularly ultraviolet-B (UV-B, 280-315 nm), can enhance biosynthesis of these compounds. UV-B intensity affects various process in plants including the phenylpropanoid pathway involved in secondary metabolite production. This study aimed to assess the expression of the CHALCONE SYNTHASE (CHS) gene under different UV-B intensities (0.3–3.0 µmol·m-2·s-1, 4 h) and examine the effects of two extreme UV-B intensities (0.3 and 3.0 µmol·m-2·s-1, 4h.d-1) in a controlled environment for 14 days. The results showed that increasing UV-B intensity enhanced CHS expression (1.0 and 3.0 µmol·m-2·s-1 showed thicker bands compared to 0.3 µmol·m-2·s-1, with a faint band in the control). Extreme UV-B exposure reduced chlorophyll content by 35–37% compared to the control, while carotenoids remained unaffected. Anthocyanin accumulation increased under low-intensity UV-B, whereas flavonoid levels were higher under high-intensity UV-B, suggesting different functional roles. UV-B exposure also influenced stomatal number and density in leaf. This preliminary study highlights the significant role of UV-B in enhancing specific metabolites in Singgalang cabbage, supporting its potential as a functional food.
Sex-Specific Bands in Dioecious Plant Jernang Rattan (Daemonorops draco) Based on RAPD Markers Amanda Nurhafitri; Mansyurdin Mansyurdin; Djong Hon Tjong; Syamsuardi Syamsuardi; Revis Asra; Muhammad Idris
JURNAL PEMBELAJARAN DAN BIOLOGI NUKLEUS Vol 12, No 1: Jurnal Pembelajaran Dan Biologi Nukleus March 2026
Publisher : Universitas Labuhanbatu

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36987/jpbn.v12i1.9059

Abstract

Background: Daemonorops draco (Willd.) Blume, or dragon’s blood rattan, is a dioecious species that produces high-value resin but is increasingly threatened by habitat degradation. Effective cultivation and conservation require early identification of male and female plants, which remains challenging at the seedling stage. Although RAPD markers have been used for sex identification in dioecious plants, studies on D. draco are still limited. Therefore, this study aims to screen sex-specific bands in D. draco using the RAPD approach. Methodology: Samples of six male and six female individuals collected from Jambi were analyzed, with DNA isolated using a modified CTAB protocol and amplified using 44 RAPD primers. The products were separated by 2% agarose gel electrophoresis. Bands were considered sex-specific if they consistently appeared only in one sex and were absent in the other. Findings: Out of the 44 primers tested, 39 successfully amplified D. draco DNA, generating a total of 662 bands. Among them, primer OPA-14 (455 bp) and OPC-19 (310 bp) produced male-specific bands that were consistently present in all male individuals, while primer OPB-10 (850 bp) generated a female-specific band detected in all female individuals. The male-specific 455 bp band from OPA-14 and 310 bp from OPC-19, and the female-specific 850 bp band from OPB-10 were identified. These bands are recommended for development into SCAR markers for early sex identification in D. draco. Contributions: The findings support the provision of male and female seedlings to enhance conservation and cultivation programs
Implementasi Praktikum Biologi Berbasis Teknologi untuk Peningkatan Kompetensi Siswa dan Guru di SMU N 15 Padang Rita Maliza; Muhammad Idris; Ashrifurrahman Ashrifurrahman; Arthauly Yopita Sinurat; M.Nazri Janra; Nofrita Nofrita; Muhammad Syukri Fadil; Robby Jannatan; Mansyurdin Mansyurdin; Wilson Novarino; Kurniadi Ilham; Putra Santoso; Henny Herwina; Bramadi Arya; Tasya Putri Pratama Elisa; Reziq Marchellino Irwan
Buletin Dharmas Andalas Vol. 3 No. 1 (2026): Buletin Dharmas Andalas
Publisher : Departemen Budidaya Tanaman Perkebunan, Fakultas Pertanian, Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/bda.v3i1.60

Abstract

This community service activity was conducted on October 27, 2025, at SMA Negeri 15 Padang, with the aim of enhancing the competencies of teachers and students in biotechnology through the integration of modern technology as part of the digital transformation of education. The methods employed included direct training and mentoring, supported by a guidebook entitled “Basic Biology and Biotechnology: From Microscope to DNA.” The activity was organized into several thematic groups, namely plant and animal tissue histology, animal anatomy, plant culture, and DNA isolation. The results demonstrated a significant improvement in participants’ abilities to operate basic biotechnology tools, understand applied biotechnology concepts, and develop innovative practicum activities aligned with the Merdeka Curriculum. In addition, this activity strengthened collaboration among schools, universities, and media in disseminating science learning innovations. In conclusion, the implementation of technology-based biology practicum is effective in improving participants’ competencies and scientific literacy and has strong potential for sustainable development through continued mentoring and the development of digital modules.
Phylogenetic and Genetic Diversity of Local Durian (Durio spp.) from Siberut Island within Southeast Asia: Insights from rbcL and ITS Markers: Phylogenetic and Genetic Diversity of Local Durian from Siberut Island Alponsin; Mansyurdin; Nurainas
Journal of Tropical Life Science Vol. 16 No. 01 (2026)
Publisher : Journal of Tropical Life Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/jtls.16.01.13

Abstract

This study examined the genetic diversity and phylogenetic relationships of Durio species from Siberut Island, Indonesia, within the broader Southeast Asian context, utilizing two molecular markers: rbcL and ITS. Leaf samples underwent DNA sequencing, followed by genetic distance estimation, phylogenetic reconstruction, and haplotype network analysis. The ITS marker exhibited high discriminatory power, effectively differentiating species and revealing distinct haplotype variation among populations, while resolving distinct clades with strong bootstrap support. Conversely, the rbcL marker, being highly conserved, provided reliable resolution at the genus level but was inadequate for distinguishing closely related species. A significant finding is the close genetic affinity between the wild variety Toktuk Geta from Siberut and D. singaporensis, a species previously recorded in Peninsular Malaysia. This association may indicate an unrecognized lineage or historically disjunct distribution, although confirmation necessitates broader sampling and additional markers. Substantial genetic differentiation was observed among D. zibethinus populations across Southeast Asia (FST = 0.49293), aligning with restricted gene flow among geographically distinct populations. These findings suggest that ITS is a suitable marker for species-level phylogenetics in Durio, whereas rbcL is more appropriate for genus-level identification. The unique genetic composition of Durio germplasm on Siberut Island highlights the conservation value of this region for plant genetic resources in the Mentawai Archipelago.
The study of genetic diversity of Daemonorops draco (Palmae) using ISSR markers REVIS ASRA; SYAMSUARDI SYAMSUARDI; MANSYURDIN MANSYURDIN; JOKO RIDHO WITONO
Biodiversitas Journal of Biological Diversity Vol. 15 No. 2 (2014)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d150201

Abstract

Asra R, Syamsuardi, Mansyurdin, Witono JR. 2014. The study of genetic diversity of Daemonorops draco (Palmae) using ISSR markers. Biodiversitas 15: 109-114. The genetic diversity in five populations of Daemonorops draco (Willd.) Blume (Jernang: in Bahasa Indonesia) was analyzed using Inter Simple Sequence Repeat (ISSR) markers. The screening results from using 15 ISSR primers showed that only 5 of ISSR primers had clear and reproducible bands. Based on the data from the matrix binary analyzed using POPGENE version 3.2, the highest genetic diversity was found in the Sepintun population at 0.0969 average heterozygosis (H) and 0.146 average Shannon Index (I). The heterozygosis calculation of the total population (HT) was 0.2571. The heterozygosis value within a population (HS=0.0704) was smaller than that between populations (DST=0.1867). Using the clustering analysis program Pastversion 32 on 43 individuals of D. draco, we found that there were three groups of D. draco. Group A consisted of 8 individuals in the Bengayoan population, group B consisted of 9 units in the Nunusan population and group C consisted of three populations; Tebo, Sepintun and Mandiangin consisted of 10, 8 and 8 individuals. The genetic similarity varied among all populations with the values between 0.07-0.93.
DNA primer design for sex identification of Sumatran tiger body samples IKRIMA ASRORI; DJONG HON TJONG; WILSON NOVARINO; MANSYURDIN MANSYURDIN; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240129

Abstract

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.
Plant species composition and diversity in traditional agroforestry landscapes on Siberut Island, West Sumatra, Indonesia GUSMARDI INDRA; ERIZAL MUKHTAR; SYAMSUARDI SYAMSUARDI; CHAIRUL CHAIRUL; MANSYURDIN MANSYURDIN
Biodiversitas Journal of Biological Diversity Vol. 25 No. 3 (2024)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d250345

Abstract

Abstract. Indra G, Mukhtar E, Syamsuardi, Chairul, Mansyurdin. 2024. Plant species composition and diversity in traditional agroforestry landscapes on Siberut Island, West Sumatra, Indonesia. Biodiversitas 25: 1286-1296. The research conducted on Siberut Island, situated in the western part of Sumatra, focuses on traditional communities practicing an agroforestry land management system. This study aimed to identify the plant species within agroforestry land, their respective uses, and techniques for adapting these species to the landscape in two villages, Matotonan in South Siberut District and Bojakan in North Siberut District, Mentawai Islands. Data collection involved direct observation, unstructured interviews for plant species utilization, and transects with a 10m width along contour lines for landscape data. The findings revealed that Siberut's traditional agroforestry land, known as "Pomunean," is divided into Tinugglu and Mone categories based on land slope, proximity to riverbanks, and planted species. Plant species in agroforestry land served nine primary purposes, including staple and additional food, construction, furniture, medicine, firewood, traditional rituals, and commercial activities. Tinugglu land exhibited a higher Landscape Utilization Value Index (LUVI) at 57% compared to Mone land (43%). Regarding specific plant types, Metroxylon sago (Bojakan) and Durio zybethinus (Matotonan) had the highest LUVI values. These findings shed light on the vital role that traditional ecological knowledge and sustainable land management play in maintaining the delicate balance between human livelihoods and the preservation of natural ecosystems.
Co-Authors ', Mardinus . Chairul . Yastori A.A. Ketut Agung Cahyawan W Ahmad Taufiq Aliya Ningsih Alponsin Amanda Nurhafitri Amar, Puti Khairunnajwa Amri Bakhtiar Anthoni Agustien Antonie Agustien Anzharni Fajrina Ardinis Arbain Arifa Setriani Arthauly Yopita Sinurat Asful, Ferdhinal Ashrifurrahman Ashrifurrahman Ashrifurrahman, Ashrifurrahman Aszareta, Muhammad Andoni Aziz, M. Abdul Bramadi Arya Catur Hermanto Chaidir P. Pulungan Chaidir P. Pulungan Chairul Dahelmi Dahelmi De Yudanur, Parissa Anandita Dewi Imelda Roesma Dilla, Arfa Iskhia Djoko Santoso Djong Hon Tjong Efrizal Efrizal Eli Ratni Elisa, Tasya Putri Pratama Elni Fatimah Elza Safitri Ema Susiana Enjelina, Weni Erizal Muchktar Erizal Mukhtar Ersa Nur Syafia Fadil, Muhammad Syukri Fajri Hidayat Fitri Handayani GUSMARDI INDRA Gusmardi Indra Hanifah - Aini Hendra Kusuma Henny Herwina Herwita Idris IKRIMA ASRORI Indra Junaidi Zakaria Jabang Nurdin Janra, Muhammad Nazri Jasmi Jefrial Santoso JOKO RIDHO WITONO Joko Ridho Witono Joko Ridho Witono Joko Ridho Witono Kurniadi Ilham M. Idris M.Nazri Janra Maliza, Rita Mayta Novaliza Isda Miftahul Ilmi Mildawati Mildawati Moralita Chatri Muhammad Idris Muhammad Idris Muhammad Idris Muhammad Idris Musliar Kasim Nabila, Sylvia Nabilah Rahmachila Azura Netty W Surya Nofrita Nofrita Nofrita Nofrita Nova Syafni Nurainas Nurainas Nurainas Nurmansyah Nurmansyah Perri Adnadi Pratama, Raihan Anugrah Puti Khairunnajwa Amar Putra Santoso Putri, Syntia Mai REVIS ASRA Revis Asra Revis Asra Revis Asra Reziq Marchellino Irwan Ridho, Muhammad Syifa'ur Riki Rinaldi Rikinovtian Burlis Robby Jannatan Rudi Febriamansyah Sjahridal Dahlan Solfiyeni Solfiyeni Suci Rahma Nita Sukendi Sukendi Suwirmen, Suwirmen Syabila, Hutri Dinda Syafia, Ersa Nur SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah Syakira Tiara Rezvi Syamsuardi Syamsuardi Tasya Putri Pratama Elisa Tesri Maideliza Tesri Meideliza Tetty CHAIDAMSARI Tri Susanti TRIMURTI HABAZAR Wilson Novarino Yulia Sandri Yulmira Yanti Zaini Zaini Zozy Aneloi Noli