Claim Missing Document
Check
Articles

Sumatran tiger identification and phylogenetic analysis based on the CO1 gene: Molecular forensic application ASHRIFURRAHMAN ASHRIFURRAHMAN; SARUEDI SIMAMORA; RUSDIYAN RITONGA; WILSON NOVARINO; DJONG HON TJONG; RIZALDI RIZALDI; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 23 No. 4 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230410

Abstract

Abstract. Ashrifurrahman, Simamora S, Ritonga R, Novarino W, Tjong DH, Rizaldi, Syaifullah, Roesma DI. 2022. Sumatran tiger identification and phylogenetic analysis based on the CO1 gene: molecular forensic application. Biodiversitas 23: 1788-1794. Wild animal hunting, especially in the Sumatran tiger (Panthera tigris sumatrae), has been caused the population decline. Regulation and law enforcement have been implemented even though it does not affect optimal because of the trickery of poachers and illegal traders. Sometimes, the evidence of P. t. sumatrae derivative products, for example, bones, nails, skins, hair, and other body parts, cannot be properly identified to raise the cases. However, genetic markers, such as the CO1 gene, have successfully identified illegal trafficking samples. This study used 20 samples, consisting of seven samples (four preserved hairs, two claws, one bone) that were suspected of P. t. sumatrae collected from illegal wildlife trade cases in West Sumatra, Indonesia. Other thirteen samples were twelve blood and one hair of P. t. sumatrae samples were collected from the Dharmasraya Sumatran Tiger Rehabilitation Center (PR-HSD). All samples were isolated, Polymerase Chain Reaction (PCR), sequenced, and 999 base pairs (bp) of the CO1 gene sequences were analyzed. In addition, National Center for Biotechnology Information (NCBI) data sequences including two P. t. sumatrae sequences, four P. t. altaica sequences, one P. t. amoyensis sequence, one P. t. corbetti sequence, three P. pardus sequences, and one Felis catus sequence were collected for comparison and supporting data. The result confirmed that all samples in this study were P. t. sumatrae. We determined those depending on similarity value which was 99.60%-99.70% with P. tigris reference sequence (NC_010642.1) and 99.90%-100% with P. t. sumatrae (JF357969.1). Phylogenetic analysis supported species identification with average intraspecies sequence divergence was 0 to 0.4% and presented the monophyletic group. This study was the first and most recent report to use seized samples to identify P. t. sumatrae based on the CO1 gene in West Sumatra, Indonesia.
Short Communication: Taxonomic status of Great Argus (Argusianus argus) Sumatra and Borneo based on cytochrome B gene Cynthia Ericca; Djong Hon Tjong; Dewi Imelda Roesma; WILSON NOVARINO; SYAIFULLAH SYAIFULLAH; MUHAMMAD NAZRI JANRA; AADREAN AADREAN
Biodiversitas Journal of Biological Diversity Vol. 23 No. 9 (2022)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d230933

Abstract

Abstract. Ericca C, Tjong DH, Roesma DI, Novarino W, Syafullah, Janra MN, Aandrean. 2022. Short Communication: Taxonomic status of Great Argus (Argusianus argus) Sumatra and Borneo based on cytochrome B gene. Biodiversitas 23: 4670-4676. Great Argus (Argusianus argus) belongs to the bird family Phasianidae. Currently, there are two Great Argus subspecies: A. argus argus in Sumatra and the Malay Peninsula, and A. argus grayi in Borneo. Therefore, this study aims to determine the taxonomic status of Great Argus across its distribution region. Phylogenetic relationships between two Great Argus subspecies were inferred in this study using the mitochondrial cytochrome b gene. DNA was isolated, amplified, and sequenced from the feathers of Great Argus sampled from Kinantan Wildlife and Cultural Park, Bukittinggi, West Sumatra, Indonesia. Phylogenetic relationships were analyzed with Maximum Likelihood methods. The phylogenetic trees show monophyletic relationships between Sumatran Great Argus subspecies. Analysis result shows that Bornean Great Argus has a 3.26-3.80% genetic distance from the Sumatran Great Argus based on analysis using the 789 bp of cyt b gene. Based on the result, it also refers that Bornean Great Argus and Crested Argus (Rheinardia ocellata), have a close relationship, indicated by low genetic distances (5.87-6.73%). This study suggests that Bornean Great Argus is genetically different from Sumatran Great Argus.
Small carnivore diversity in forest patches around oil palm plantation in West Sumatra, Indonesia Inda Dwi Solina; Erizal Mukhtar; Wilson Novarino; Dahelmi Dahelmi
Biodiversitas Journal of Biological Diversity Vol. 24 No. 3 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240358

Abstract

Abstract. Solina ID, Mukhtar E, Novarion W, Dahelmi. 2023. Small carnivore diversity in forest patches around oil palm plantation in West Sumatra, Indonesia. Biodiversitas 24: 1824-1832. The accelerating rates of forest conversion into agricultural land are the main driver for biodiversity loss. How biodiversity, particularly secondary consumers, can adapt to different agricultural schemes is critical to conservation planning. Currently, small forests within oil palm plantations should receive more attention, especially as they are habitats for small carnivores, and it is still unknown how they respond to habitat change. We analyzed camera trap data from 2015 to 2018 in key High Conservation Value (HCV) forests in South Solok, West Sumatra: Kencana Sawit Indonesia company (forest patch A) and Tidar Kerinci Agung company (forest patches B and C). LecoS is used to collect landscape metrics data then evaluated using the Generalized Linear Models (GLM) to assess the impact of fragmentation on the presence of small carnivores in forest patches. The model with the lowest Akaike Information Criterion (AIC) value was the one we regarded to be the most acceptable. We found 12 species of small carnivores belonging to 4 families; six species were identified in patch A, ten in patch B, and only three in patch C. We identified that land covers are the most important parameter on the presence of small carnivores in oil palm plantations in West Sumatra based on GLM results. Due to the importance of forested regions to small carnivore diversity, we recommend increasing forest connectivity into and across oil palm landscapes.  
DNA primer design for sex identification of Sumatran tiger body samples IKRIMA ASRORI; DJONG HON TJONG; WILSON NOVARINO; MANSYURDIN MANSYURDIN; SYAIFULLAH SYAIFULLAH; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 24 No. 1 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240129

Abstract

Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.
Bird diversity and mangrove forest as potential ecotourism destinations in Kapo-kapo Bay, Cubadak Island, West Sumatra, Indonesia WILSON NOVARINO; ERIZAL MUKHTAR; AYU SMARNIA PUTRI; PUTRI LISYA ANGGRAINI
Biodiversitas Journal of Biological Diversity Vol. 24 No. 6 (2023)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d240658

Abstract

Abstract. Novarino W, Mukhtar E, Putri AS, Anggraini PL. 2023. Bird diversity and mangrove forest as potential ecotourism destinations in Kapo-kapo Bay, Cubadak Island, West Sumatra, Indonesia. Biodiversitas 24: 3583-3591. Mangrove forests play an important role in the management of the coastal ecosystem of Indonesia. Research on bird diversity has been carried out to support ecotourism attractions in the mangrove area of  Kapo-kapo Bay, West Sumatra. The objective of this study is to determine the bird diversity and mangrove plant diversity in the mangrove kapo-kapo Bay area, West Sumatra, using the point count method and transect method. Mangrove plants have been found in three families, five genera, and six species. The vegetation composition on this research site is lower than that on Sumatra's east coast. The composition of mangrove trees and tree diversity was lower on the west coast of Sumatra than on the east coast. The composition and diversity of birds at the study sites were not significantly different between the mangrove forests on Sumatra's west and east coasts. Rhizophora apiculata Blume species dominate the mangrove forests in Kapo-kapo Bay, while Collocalia esculenta species dominate the birds. The analysis of the suitability of mangrove ecotourism in Kapo-kapo Bay obtained a score of 111 or 92.5%, placing it in the Very Suitable category (S1) to be developed as an ecotourism area. The presence of birds and bird habitat use in mangroves are all interesting ecotourism attractions.  
The study of diversity and distribution of bats in several fragmented forests and small adjacent islands in Batam City, Riau Island, Indonesia FAUZIAH SYAMSI; WILSON NOVARINO; DAHELMI DAHELMI; CHAIRUL CHAIRUL
Biodiversitas Journal of Biological Diversity Vol. 26 No. 1 (2025)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d260123

Abstract

Abstract. Syamsi F, Novarino W, Dahelmi, Chairul. 2025. The study of diversity and distribution of bats in several fragmented forests and small adjacent islands in Batam City, Riau Island, Indonesia. Biodiversitas 26: 223-232. Bats are ecologically and taxonomically diverse and crucial in tropical ecosystems, including on islands. This study compares bat diversity in fragmented forests on urban islands and adjacent islands connected by bridges to assess the impact of urbanization on bat populations, providing insights for conservation and habitat management. We sampled bats across four sites in Batam City, Indonesia, including two secondary forests (SF1 and SF2) and two small islands (SI1 and SI2). Using 120 harp trap nights and 120 net nights, we captured 429 bats representing 15 species and 4 families. Our findings revealed moderate bat diversity (H' 1.02 to 1.66), with SF1 being the most stable habitat, showing balanced species richness, evenness (0.72), and low dominance (0.24), indicating an evenly distributed community. The Bray-Curtis Similarity index indicated that SF1 had a distinct bat community with only 58% similarity to other habitats. Notably, two near-threatened species were found in SF1, emphasizing its ecological significance. The study suggests that fragmented forests with healthy vegetation and habitat complexity surrounding urban areas are more supportive of bat populations than small islands with limited resources. These results highlight the need for targeted conservation efforts in forest fragments surrounding urban areas to preserve bat diversity in Batam City, Riau Island, Indonesia.
Five microsatellite loci for preliminary kinship analysis and implications for conservation in Sumatran Tigers (Panthera tigris sumatrae) IKRIMA ASRORI; WILSON NOVARINO; DJONG HON TJONG; PATRICK FLAGGELLATA; YOLI ZULFANEDI; DEWI IMELDA ROESMA
Biodiversitas Journal of Biological Diversity Vol. 27 No. 5 (2026)
Publisher : Society for Indonesian Biodiversity

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.13057/biodiv/d270533

Abstract

Abstract. Asrori I, Novarino W, Tjong DH, Flaggellata P, Zulfanedi Y, Roesma DI. 2026. Five microsatellite loci for preliminary kinship analysis and implications for conservation in Sumatran Tigers (Panthera tigris sumatrae). Biodiversitas 27 (5): d270533. https://doi.org/10.13057/biodiv/d270533. Microsatellite markers are widely used in wildlife pedigree analysis due to their high polymorphism and ability to assist in the determination of kinship relationships. Accurate pedigree information is crucial for effective population management and prevention of inbreeding in Sumatran tigers (Panthera tigris sumatrae), particularly in captive breeding programs. Fifteen microsatellite loci in the Felidae family were selected from previous studies and tested in 20 individuals, including six individuals with known kinship relationships, to identify informative and reliable markers for kinship analysis of Sumatran tigers. Amplification results showed that nine loci were consistently amplified in all samples with relatively high polymorphism. These loci were then evaluated for the number of alleles (Na), observed heterozygosity (Ho), polymorphic information content (PIC), amplification consistency, and genotyping error rate. Five loci showed consistent amplification and high levels of heterozygosity and polymorphism, with three loci (FCA279, FCA304, and FCA391) showing an error rate of 0.00, while two loci (FCA441 and 6HDZ700) had a lower error rate. Therefore, these five loci were selected as candidate markers for the Sumatran tiger pedigree analysis. Meanwhile, the other four loci (FCA008, 6HDZ463, 6HDZ170, and FCA220), although showing high Na, Ho, and He values, also had high error rates. Therefore, these four loci were excluded from further analysis. Cumulative probability of identity (PID) and PIDsibs estimates indicated that the selected panel of five loci had greater discriminatory power than only three loci. Kinship analysis using the selected loci yielded the expected relationships among known individuals, although the software's analysis model does not explicitly define parent-offspring relationships. Therefore, these results are preliminary and require further validation before broader application, given the limited sample size and incomplete representation of pedigree relationships.
Turtle Nesting and Conservation Management in Amping Parak, West Sumatra Zettyra Sandova; Firly Widuri; Aulia Rizky; Fauri Yatul Irfan Yanti; Jabang Nurdin; Wilson Novarino; Aprizal Aprizal
Jurnal Biologi Tropis Vol. 26 No. 3 (2026): Juli - September
Publisher : Biology Education Study Program, Faculty of Teacher Training and Education, University of Mataram, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29303/jbt.v26i3.12294

Abstract

Sea turtles are protected marine animals that play a crucial role in maintaining the balance of coastal and marine ecosystems. This study aims to examine the nesting behavior of sea turtles and evaluate the management of the conservation area in Amping Parak, Pesisir Selatan Regency. Conducted from April 15 to May 28, 2026, this research employed a qualitative descriptive method utilizing observation and literature reviews. The results indicate that turtles nest at night, with an incubation period of 45–60 days, which is strongly influenced by nest temperature and humidity. Although Amping Parak has high potential as a nesting habitat, its management is hindered by limited funding and resources. Therefore, optimizing conservation efforts requires nest protection, semi-natural hatchery practices, and community education to ensure the sustainability of sea turtle conservation.
Co-Authors - Fitri - Junaidi - Rizaldi . Merry Aadrean Aadrean Aadrean Abda Abda Agung Nugroho Ahmad Rizaldy Fanbudy Aini, Wardahtul Ainul Mardiah Aldino Fauzil Fanani Anas Salsabila Anas Salsabila Ani Mardiastuti Antika Fardilla Aprizal Aprizal Aprizon Putra Arba, Risqi Mutia Ardinis Arbain Arthauly Yopita Sinurat Arum Setiawan Asferi Ardiyanto Asferi Ardiyanto Asful, Ferdhinal Ashrifurrahman Ashrifurrahman Ashrifurrahman, Ashrifurrahman Asrori, Ikrima Astuti Astuti Aszareta, Muhammad Andoni Aulia Rizky Aurora, Dhea Apriano Ayu Andira AYU SMARNIA PUTRI Aziz, M. Abdul Baqi, Ahmad Iqbal Boby Hariadi Boby Hariadi Bramadi Arya Chairul Cynthia Ericca Dahelmi Dahelmi Damanhuri, Harfiandri Dedi Hermon Dewi Chandrarini Surya Dewi Imelda Roesma Diana Sari Diana Sari Diana Sari Djong Hon Tjong DYAH PERWITASARI-FARAJALLAH Efrita Ruswenti Efrizal Efrizal Elsa Yolarita Erik Marlius Erizal Mukhtar Eti Yerizel fachrul reza, fachrul Fadil, Muhammad Syukri Fadillah Fardilla, Antika Farid Azel Fauri Yatul Irfan Yanti FAUZIAH SYAMSI Fauziah Syamsi Fikri, Husnul Fikriya - Rahma Firjatullah, Fadhilah Firly Widuri Gita Herliza Sari Hadi Addaha, Hadi Hadi Kurniawan Hamdi Ibrahim, Muhammad Hanif Fadly Helmi Helmi Hendra, Jon hendrita, juli Henny Herwina Hiroshi Kobayashi Idris, Muhamma IKRIMA ASRORI IKRIMA ASRORI Ilham Samudra, Muhammad Inda Dwi Solina Inda Dwi Solina Indang Dewata Indra Junaidi Zakaria Indra Junaidi Zakaria, Indra Irvan Fadli Wanda Jabang Nurdin Janra, M. Nazri Janra, Muhammad Nazri Jarulis . Jarulis Jarulis Jarulis Jarulis Kamilah, Santi N Karmelia Kontesa Kevin Origia Kevin Origia Khairini, Ridha Kurniadi Ilham Laksono Trisnantoro Lilik B. Prasetyo Lilik B. Prasetyo Lintang Yodhy M. Nazri Janra M. Silmi M. Syafrie M.Nazri Janra Mahdi Mahdi Mahdi Mahdi Mahfud Huda Maliza, Rita Mansyurdin Marchellino Irwan, Reziq Muhammad Afif MUHAMMAD AZHARI AKBAR Muhammad Idris Muhammad Idris Muhammad Silmi Mukhta, Erizal Nazri Janra, Muhammad Nindy Ladyfandela Nofrita Nofrita Nofrita Nofrita Nova Adri Yanti Novita, Aulya Nur Halimah Rangkuti Nur Insani PATRICK FLAGGELLATA Pratama Elisa, Tasya Putri Pratama, Raihan Anugrah Putra Santoso PUTRI LISYA ANGGRAINI Putri Pratama Elisa, Tasya Putri, Syntia Mai Rahmi Fitri Ratna Juwita T Reviany Widjakusuma Reziq Marchellino Irwan Richard Noske Richard Noske Ridho, Muhammad Syifa'ur Rifta Septiavi Risqi Mutia Arba Risqi Mutia Arba Rizaldi Rizaldi Rizaldi Rizaldi Rizaldi, . Rizaldi, Rizaldi Rizka Sefmaliza Robby Jannatan RUSDIYAN RITONGA Rusdiyan p. Ritonga Santi N Kamilah SARUEDI SIMAMORA Semeidi Husrin Silmi, M. Sinurat, Arthauly Yopita Sugeng Santoso Suparno . Syafrie, M. SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH SYAIFULLAH Syaifullah Syaifullah Tasya Putri Pratama Elisa Taufiq Afdhal Tjong, Tjong Hon Tofrizal, Alimuddin Tomi Kasayev Try Al Tanto Uswatul Hasana Utami, Radila Widjakusuma, Reviany Widodo, Febri Anggriawan YAMATO TSUJI Yeni A. Mulyani YOLI ZULFANEDI Yunila Berliana Yusni Handayani Zaini Zaini Zettyra Sandova