Claim Missing Document
Check
Articles

Found 34 Documents
Search

Penggunaan self cleaning Fotokatalis Tio2 dalam Mendegradasi Ammonium (NHd) Berdasarkan lama waktu penyinaran Ana Hidayati Mukaromah; Muh. Amin; Sri Darmawati
JURNAL KESEHATAN Vol 3, No 1 (2010): Ilmu-Ilmu Kesehatan
Publisher : JURNAL KESEHATAN

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1019.794 KB)

Abstract

Ammonium is NH a ' ions thdt are not colored, smelly and dangerous to health, its concentrqtion determined by spectrophotometric method. Ammonium which is atkalini when exposed i tignt or heat will cause odor, because the smell of ammonia' generated, needed a technologt to reiuce or eliiinate the levels of ammonium. Problems of this research is what percentage of degrqdalion of ammonium (NH4 +) with 20 mg of photocatalyst TiO 2 based on the exposure time?The general obiective of this research is to study the degradation of ammonium (NH 4 +) with TitaniumDiol<sida photocatalyst (TiO 4 20 mg based on exposureiime 30, 60: g0, 120, 240, 360, 480, 600, 900, 1500 minutes. Special purpose in this study are: Peiform initial optimization siudy is determine the optimum concentration of ammonium that can produce the mmimum percent ammonium degradation with the number of photocatalyst TiO 2 Titanium Dioxide 20 mg durig the time of 120 minutes. Doing degradation of ammonium with ammonium concentrqtion optimim withlhe number of photocatalyst TiO 2 2b mg for varying exposure time 30, 60, 90, 120, 240, 360, 480, 600, 900, I500 minures.The research object is a solution of ammonium produced in the chemical laboratory of the concentration of 100 ppm was reduced to 10, 20, i0, 40 ppm and then determined the optimui concentration of ammonium. Percent degradation of ammonium with an optimum concentration wiih the addition of titanium dioxide photocatalyst TiO 2 20 mg with varying exposure time 30, 60, 90, t 20, 240, 360, 480, 600,-900, t 500minutes each performed three times repetition.The results showed that the optimum concentration of ommonium NHr*) with photocatalytic TiO2 20 mg over 120 minutes is 30 ppm. Degradation of the ion (NHr') with the variation ofradiarion SO, AO, g0, 120, 240, 360, 180, 600, 900, and 1500 minutes with the optimum concentration of 3i ppm of ammonium and the number of photocatalyst TiO 2 20 mg is five consecutive, 66ok, 6.06%, 6.64%, Z.iZbZ, A.Otm, g.64%, g.5g%,10.52%o, ll.0B%, 11.40%. The longer the exposure time the greater the percent degradation of the ion (NH4 +)Keywords: Degradation of ammonium, Tio2 Photocatalyst, Irradiation time.
PERBEDAAN VARIASI LAMA SIMPAN TELUR AYAM PADA PENYIMPANAN SUHU ALMARI ES DENGAN SUHU KAMAR TERHADAP TOTAL MIKROBA Idayanti . .; Sri Darmawati; Ulfa Nurullita
JURNAL KESEHATAN Vol 2, No 1 (2009): Pengembangan Ilmu-Ilmu Kesehatan
Publisher : JURNAL KESEHATAN

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (791.183 KB)

Abstract

Abstract Background; Chicken's Egg is one of animal producl coming from poultry livestock and well-known as food materials with high protein source and many people consume it. Chicken's egg quality can be in Influenced by keeping place, temperature, dampness, dirt at handling technique and eggshell. Egg can be hit by microbe pollution coming from pollution result both direct and indirect contamination. Habit of keeping chicken's egg forfew dalts al room temperature can cause the egg is easy lo be contaminated by microbe, so lhat the egg quality is easy to destroy or decay. Besides il is oflen done of keeping egg in refrigerator, expected the egg will be more durable.This research aim stok now the diffirence of keeping variation long that is0,6, l2, and l8 drys at refrigerator lemperature with room lemperature to total microbe. Method : This research is pure experiment using device of One Group Pretest - Postest. Research object counted 42 chicken's eggfor pretest is 0 day with restaling one egg so it needs 6 eggs, then as postest is 3 keeping treatment (6, 12, and l8 days), 2 measurement of lemperature (refrigerator temperature mean 40C with room temperature mean 290C) and 6 times restating. Independen variable is long save variation and temperature, dependent variable is total mikkrobe, Statistic calculation is done with SPSS l4/3 windows program Version 11 .0 using factorial test or Two Way Anova with d 0,05. Result : Mean total of microbe al refrigerator temperature with room temperature depend on keeping variation long to experience of significant dffirence to lolal microbe, P<0,05 depend on value of p seen there is significant difference al keeping variation long of chicken's egg at refrigerator temperature with room temperature to total microbe. Conclusion : Total microbe al keeping varialion long 0, 6, 12, and 18 days progressively increase signiftcantly both at refrigerator or room temperature
HUBUNGAN POLA PERAWATAN GIGI DENGAN KEJADIAN KARIES GIGI PADA ANAK SEKOLAH DI MADRASAH IBTIDAIYAH MANGUNHARJO KECAMATAN TEMBALANG SEMARANG SELATAN Fatikhin -; Vivi Yosafianti Pohan; Sri Darmawati
FIKkeS Vol 5, No 1 (2012): JURNAL KEPERAWATAN
Publisher : FIKkeS

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (180.688 KB)

Abstract

Pola perawatan gigi yang baik, diantaranya adalah pemeriksaan gigi secara teratur, menyikat gigi (hygiene mulut), pemberian flourida, menggurangi makanan dan minuman manis. Berdasarkan data yang telah diperoleh dari DINKES kota Semarang tahun 2009 didapatkan data bahwa penyakit karies gigi sejumlah 14,88% atau 1060 orang dari 7123 orang. Berdasarkan hasil observasi yang dilakukan pada 102 murid di Madrasah Ibtidaiyah Mangunharjo didapatkan data murid yang memiliki gigi berlubang yaitu 84 anak atau 82,3%. Tujuan penelitianuntuk mengetahui hubungan pola perawatan gigi dengan terjadinya karies gigi pada anak sekolah di Madrasah Ibtidaiyah Mangunharjo Kecamatan Tembalang Semarang Selatan.Metode penelitianini menggunakan metode cross-sectional dengan pemberian kuesioner serta observasi. Sampel pada penelitian ini diambil secara total sampling dengan cara mengambil seluruh anggota populasi anak sekolah yang berada di Madrasah Ibtidaiyah Mangunharjo Kecamatan Tembalang Semarang Selatan. Uji statistik yang digunakan chi-squart bila memenuh syarat dan uji alternatifnya uji Kolmogorov-Smirno. Hasil penelitian sebagian besar ada pada pola perawatan gigi sedang sebesar 70 responden (61,9%), sedangkan kejadian karies gigi sebesar 96 responden (85%) terdapat karies gigi. Hasil analisis data hubungan pola perawatan gigi dengan kajadian karies gigi terdapat hubungan yang signifikan ditunjukkan dengan hasil nilai p-Value = 0,000<0,05.Kata kunci: karies gigi, pola perawatan gigiPustaka:27 (1992-2010)
STUDI DESKRIPTIF DUKUNGAN KELUARGA TERHADAP KEBERSIHAN GIGI DI SD MUHAMMADIYAH 10 SEMARANG UTAR Haris Susena; Vivi Yosafianti Pohan; Sri Darmawati
FIKkeS Vol 5, No 2 (2012): JURNAL KEPERAWATAN
Publisher : FIKkeS

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (105.019 KB)

Abstract

Masalah utama dalam rongga mulut anak adalah karies gigi. Di Negara-negara maju prevalensi karies gigi terus menurun sedangkan di negara-negara berkembang termasuk Indonesia ada kecenderungan kenaikan prevalensi penyakit tersebut. Penyebab timbulnya masalah kesehatan gigi dan mulut pada masyarakat salah satunya adalah faktor perilaku atau sikap mengabaikan kebersihan gigi dan mulut. Hal tersebut dilandasi oleh kurangnya pengetahuan akan pentingnya pemeliharaan gigi dan mulut. Anak masih sangat tergantung pada orang dewasa dalam hal menjaga kebersihan dan kesehatan gigi karena kurangnya pengetahuan anak mengenai kesehatan gigi dibanding orang dewasa. Anak usia antara 6-12 tahun atau anak usia sekolah masih kurang mengetahui dan mengerti memelihara kebersihan gigi dan mulut. Tujuan penelitian adalah untuk mengetahui dukungan orangtua terhadap kebersihan gigi pada anak di Sekolah Dasar Muhammadiyah 10 Semarang Utara. Jenis penelitian ini adalah penelitian deskriptif dengan pendekatan studi survey. Populasi dalam penelitian ini adalah semua siswa SD Muhammadiyah 10 Semarang Utara yang berjumlah 117 anak. Teknik sampling yang digunakan adalah sampel jenuh. Hasil penelitian menunjukkan bahwa sebagian besar orangtua responden memberikan dukungan dalam bentuk informasional sebagai upaya kebersihan gigi anak yaitu 52,1%, dukungan penilaian keluarga responden berimbang antara yang tidak mendukung dan yang mendukung yaitu 49,6% dan 50,4%, dukungan instrumental keluarga responden yang terbesar adalah kategori mendukung yaitu sebanyak 55,6%, dukungan emosional keluarga responden yang terbesar adalah kategori tidak mendukung yaitu sebanyak 53,8%. Berdasarkan hasil tersebut maka diharapkan Siswa SD hendaknya dapat menjaga kebersihan giginya sendiri dengan cara menggosok gigi sedikitnya dua kali sehari, serta mengurangi makan makanan yang manis yang dapat menyebabkan kerusakan pada gigi.Kata Kunci : Dukungan keluarga, kebersihan gigi, anak SD
Klasifikasi Numerik-fenetik Salmonella typhi Asal Jawa Tengah dan Daerah Istimewa Yogyakarta Berdasarkan Hasil Karakterisasi Fenotipik Sri Darmawati; Langkah Sembiring; Widya Asmara; Wayan T. Artama
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 16, No 1 (2011): February 2011
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24002/biota.v16i1.67

Abstract

Demam tifoid adalah penyakit endemis yang disebabkan oleh strain bakteri S. typhi, bakteri tersebut dapat dikelompokkan berdasarkan perbedaan mikromorfologi, morfologi koloni, penggunaan sumber karbon, produksi enzim, kemampuan mendegradasi makromolekul. Oleh karena itu penelitian ini bertujuan melakukan klasifikasi numerik-fenetik 4 starin S. typhi asal Jawa Tengah dan 2 strain asal DIY dengan 2 strain acuan S. typhi NCTC 786 dan BLKS berdasarkan karakterisasi fenotipik dengan analisis hubungan similaritas yang didasarkan atas analisis Simple Mattching Coefficient (SSM) serta algoritme UPGMA (unweighted pair group methode with averages) yang kemudian dipresentasikan dalam bentuk dendogram. Hasilnya dapat dikelompokkan menjadi empat klaster, klaster pertama beranggotakan 3 strain berasal dari Jawa Tengah dan 1 strain acuan BLK Semarang (similaritas 100%). Klaster kedua beranggotakan satu strain acuan S. typhi NCTC 786 (similaritas 98,6%) dengan klaster pertama. Klaster ketiga beranggotakan 1 strain MDA dari Jawa Tengah (similaritas 96,8%) dengan klaster pertama dan kedua. Klaster keempat beranggotakan 2 strain S. typhi asal DIY yang memiliki (similaritas 96,4%) dengan ketiga klaster lainnya.
DAYA HAMBAT EKTRAK ETANOL BUAH BELIMBING WULUH (Averrhoa bilimbi L) TERHADAP PERTUMBUHAN Staphylococcus aureus dan Staphylococcus epidermidis SECARA IN VITRO Asri Rahmiati; Sri Darmawati; Ana Hidayati Mukaromah
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2017: Prosiding Seminar Nasional Publikasi Hasil-Hasil Penelitian dan Pengabdian Masyarakat
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (423.051 KB)

Abstract

Acne infection is caused inflammation of pilosebasea accompanied by accumulation of keratin material, caused by S. aureus and S. epidermidis bacteria. The community uses of wuluhstarfruit (Averrhoabilimbi L) as a traditional medicine to treat acne infection. Wuluh starfruit contains flavonoids, alkaloids, tannins, and saponins that act as anti microbial. The aim of this study was to analyze the inhibitory power of wuluh starfruit ethanol extract on the growth of S. aureus and S. epidermidis bacteria. The method used in this research is the diffusion of wells. This research used two types of bacteria. S.aureus and S.epidrmidis, each bacteria of the four treatment groups that is 10%w/v; 20%w/v; 30%w/v; 40%w/v; positive control of Ciprofloxacin, and negative control of sterile aquades. The research results of inhibitory power of ethanol extract of wuluh starfruit with variation of concentration 10 %w/v; 20 %w/v; 30 %w/v; and 40 %w/v successively in S.aureus was 21.6 mm; 27.0 mm; 31.3 mm; And 34.0 mm, whereas in S.epidermidis is 28.6 mm; 31.6 mm; 36.3 mm; And 39.0 mm. Then the positive control of Ciprofloxacin has an inhibit zone of 30.0 mm and 35.0 mm. While the negative control of sterile aquades is not formed inhibit zone. The result ofOne Way Anova statistic test on S. aureus is p=0.000 and S. epidermidis is p=0.000, because (p<0.05) hence result there is significant difference, so it can be concluded that the extract of wuluh starfruit ethanol can inhibit the growth of S. aureus and S. epidermidis and there is a significant difference between the variantconcentration ofethanol extract wuluhstarfruit. Keywords: Staphylococcus aureus, Staphylococcus epidermidis, Ethanol extract of wuluhstarfruit.
Analisis Molekuler Profil Protein Pilli untuk Mengungkap Hubungan Similaritas 26 Strain Salmonella typhi Isolat Jawa Sri Darmawati; Ratih Haribi; Syaiful Anwar
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2012: SEMINAR NASIONAL HASIL PENELITIAN 2012
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (539.181 KB)

Abstract

Variasi dan hubungan similaritas 26 strain Salmonella typhi Isolat Jawa merupakanawal untuk melacak protein sub unit pilli spesifik yang memiliki aktivitas hemaglutinasi.Tujuan penelitian analisis molekuler profil protein pilli untuk mengungkap hubungansimilaritas 26 Strain S. typhi Isolat Jawa.Analisis dilakukan terhadap 26 strain yang berasal dari Surabaya, Madiun,Malang, Salatiga, Magelang, Bandung, Bogor, Jakarta, Yogyakarta dengan elektroforesisSDS-PAGE. Analisis hubungan similaritas digunakan program MVSP, untukmengkonstruksi dendogram yang mencerminkan klasifikasi dari 26 strain S. typhi IsolatJawa berdasarkan nilai indeks similaritas (S SM ) dengan algoritma UPGMA.Hasil analisis profil protein pili menunjukkan (1) Jumlah pita protein sub unitpilli bervariasi : 8-17 pita, BM tertinggi 200 kD, terendah 10 kD, dengan 20 karakter. (2)Protein 100 kD, 50 kD, 45 kD dan 40 kD adalah protein sub unit pilli yang dimiliki oleh26 strain S. typhi Isolat Jawa. (3) Dari 26 strain S. typhi Isolat Jawa terdiri dari duakelompok besar yang mempunyai indeks similaritas 61,2%. Kelompok pertama adalahstrain S. typhi Isolat Jawa Tengah dan Jawa Timur, dan kelompok ke dua adalah strain S.typhi Isolat Jawa Barat dan DKI. Pita 14 (12,5 kD) dan 15 (78kD) dari protein sub unitpilli hanya dimiliki strain S. typhi dari Surabaya. Pita 18(35kD) dan 20 (72kD) dariprotein sub unit pilli hanya dimiliki oleh Strain S. typhi dari DKI Jakarta.
DETEKSI GEN Coa PADA Staphylococcus aureus YANG DIISOLASI DARI SUSU SAPI MURNI Rizka Ayu Wahyuni; Sri Darmawati; Muhammad Evy Prastiyanto
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2017: Prosiding Seminar Nasional Publikasi Hasil-Hasil Penelitian dan Pengabdian Masyarakat
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (441.423 KB)

Abstract

Tujuan penelitian ini untuk mendeteksi gen Coa pada S. aureus yang diisolasi dari susu sapi murni di Kelurahan Gedawang. Jenis penelitian ini adalah penelitian deskriptif. Bakteri S. aureus di isolasi dari 15 sampel susu sapi murni. Deteksi gen Coa S. aureus menggunakan primer spesifik  Forward (5´-ATAGAGATGCTGGTACAGG-´3) dan primer Coa Reverse (5´GCTTCCGATTGTTCGATGC-3´).Jumlah isolat S. aureus yang didapatkan dari Isolasi Bakteri sebanyak 3 sampel positif yang memiliki gen Coa dengan hasil produk 756 bp. Hasil pada penelitian ini menunjukkan hasil positif gen Coa sebesar 100%.   Keywords: Staphylococcus aureus, Susu, gen Coa
PROFIL PROTEIN TIGA JENIS DAGING YANG DILUMURI SERBUK DAUN PEPAYA BERBASIS SDS-PAGE Nevi Kustia; Sri Darmawati; Fandhi Adi Wardoyo
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2017: Prosiding Seminar Nasional Pendidikan, Sains dan Teknologi
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (364.495 KB)

Abstract

Papaya leaves contain protease enzymes (protein decomposers), namely papain and kimopapain. Both of these enzymes have the ability to break bonds in protein molecules so that proteins break down into polypeptides and dipeptides. If working on the meat can be decomposed so that the meat becomes tender. The purpose of this study was to determine protein profiles in three types of meat before and after smeared with papaya leaf powder with 60 minutes of immersion. The protein profile of three meat types was analyzed using the SDS-PAGE method. The design of this research is descriptive research with the object of research are goat meat, buffalo and cow covered with papaya leaf powder. The result of this research shows that there are meat of buffalo, goat and cow there are many major and minor ribbon, while in buffalo meat, goat and cow which has been smeared with papaya powder there are many minor protein bands. These results indicate that papain enzyme contained in papaya leaves are powdered to break peptide bonds in meat proteins to proteins in the form of minor bands (micromolecules) and show that the higher concentration of papaya leaf powder the more denatured the protein that is on 20% concentration has only 3 protein bands.Keywords: Meat, Papaya Leaf, Protein Profile, SDS-PAGE
Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study Stalis Norma Ethica; Sri Darmawati; Sri Sinto Dewi; Nurrahman Nurrahman; Ayu Rahmawati Sulistyaningtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (576.394 KB) | DOI: 10.15578/squalen.v15i1.416

Abstract

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.