Claim Missing Document
Check
Articles

Found 17 Documents
Search

Screening of Amylolytic Bacteria from Mina Padi Aquaculture in Panembangan Village, Cilongok District, Banyumas, Central Java: Screening of Amylolytic Bacteria from Mina Padi Aquaculture Ayal, Esther Lourence Brendha; Kasprijo, Kasprijo; Fitriadi, Ren; Ryandini, Dini; Nurhafid, Mohammad; Riady, Reza Muhammad; Anandasari, Mira Adyla
Journal of Aquaculture and Fish Health Vol. 13 No. 1 (2024): JAFH Vol. 13 No. 1 February 2024
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v13i1.39210

Abstract

Amylolytic bacteria play an important role in the ecosystem, especially as probiotic and bioremediation agents in cultivation, as examples can be found in Mina Padi culture. The purpose of this study was to determine the amylolytic bacteria in the waters of the Mina Padi pond. Bacterial isolation began with bacterial sampling, inoculation and isolation of bacteria, calculation of the total abundance of bacteria, observation of bacterial morphology and bacterial purification, and isolation of amylolytic bacteria. The results of the isolation of amylolytic bacteria obtained 3 bacterial isolates capable of producing amylolytic enzymes, namely BA5, BA6, and BA7. The highest index of amylolytic activity was obtained by isolates of BA6 with a medium category of 2.3 cm, and the lowest index was obtained by BA5 with a weak category of 0.3 cm. The average bacterial abundance from each dilution was 2.5 x 103 CFU/mL.
Application Of Microbubble Technology To Increase Oxygen Content In The Aquaculture Of Tambaqui (Colossoma Macropomum) Fitriadi, Ren; Palupi, Mustika
Journal of Aquaculture and Fish Health Vol. 13 No. 3 (2024): JAFH Vol. 13 No. 3 September 2024
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v13i3.43381

Abstract

The oxygen consumed is used to oxidize food substances to produce energy. Therefore, the metabolic rate is usually indicated by the rate of oxygen consumption per time unit. In most intensive aquaculture systems, oxygen content is widely used due to the high stocking density and maximum feeding rates. This study aimed to evaluate the growth performance of freshwater pomfret (Colossoma macropomum) treated with increased oxygen in two different systems. The study was conducted in a laboratory scale by applying T-test data analysis. The difference of treatment level applied in the comparison of aeration and microbubble consists of two treatments and three replications. The researcher used commercial floating pellets PF0 with 25% protein content, the feeding rate was 5% of the biomass. The feed was given daily during the culture for two times a day. Data of the study were analyzed using T-test on the Statistical Product and Service Solutions (SPSS) software Version 17.0. Results of the study showed that aeration system using microbubble resulted in dissolved oxygen (DO) of 6.5 ± 0.17, 100% pomfret fish survival rate (SR), Survival Growth Rate (SGR) of 1.83 ± 0.24, Feed Conversion Ratio (FCR) of 1.37 ± 0.17, Protein Efficiency Ratio (PER) of 2.79 ± 0.37, Feed Utilization Efficiency (FUE) of 0.67 ± 0.09, Absolute Weight Growth of 52.02 ± 1.60; it was better than using aeration. This study has developed a model of freshwater pomfret fish aquaculture to provide growth value.
Spatial Distribution Of Heavy Metals Cd And Cu In Water, Sediment And Fish (Mugil Sp) In Pelawangan East Segara Anakan Cilacap: Spatial Distribution Of Heavy Metals Cd And Cu In Water, Sediment And Fish Prayogo, Norman Arie; Hidayati, Nuning Vita; Siregar, Asrul Sahri; Sukardi, Purnama; Fitriadi, Ren
Journal of Aquaculture and Fish Health Vol. 13 No. 2 (2024): JAFH Vol. 13 No. 2 June 2024
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v13i2.46862

Abstract

Heavy metals are widely known pollutants with bioaccumulative nature, so they can be transferred and accumulated in biota, such as mullet fish (Planiliza subviridis). The heavy metals Cd and Cu have different anthropogenic and natural sources. Heavy metals have the potential to absorb existing biota such mullet fish. Fish absorb metals from the water in the body through gills, skin surface and food. This study aims to identify Cd and Cu metals in distribute water, sediment and mullet fish in the Plawangan Timur, Segara Anakan lagoon, Cilacap, Central Java, and the relationship between aquatic media and sediment and mullet fish. The study used a research method with a targeted random sampling method at five stations with four replications. The survey was conducted from April to September 2020. Descriptive data analysis, F-test, regression and correlation. The results showed in water, sediment and mullet fish the heavy metal content of Cd and Cu varied between stations. The correlation between the Cd and Cu metals in water, sediment and mullet fish showed a positive correlation. The content of heavy metal Cd in mullet fish media in Plawangan Timur Segara Anakan Cilacap has exceeded the specified quality standard, while for heavy metal Cu in mullet fish is still below the specified quality standard.
Activity of Cellulolytic Bacteria Isolated From The Digestive Tract Of Jerbung Shrimp (Feneus marguensis) Fitriadi, Ren; Sabdaningsih, Aninditia; Budi Prayitno, Slamet; Soedibya, Petrus Hary Tjahja; Sarjito, Sarjito; Subagiyo, Subagiyo
Journal of Aquaculture and Fish Health Vol. 14 No. 1 (2025): JAFH Vol. 14 No. 1 February 2025
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v14i1.66897

Abstract

Bacteria found in the digestive tract of shrimp mostly play a major role in nutrient absorption. One of the nutritional contents that is quite difficult for shrimp to absorb is fiber. Bacteria that can degrade fiber content are known as cellulolytic bacteria. This study aimed to determine the activity index of cellulolytic bacteria found in the digestive tract of shrimp. The research method includes sampling shrimp with three different categories based on average length and weight, divided into three categories such as large (22.2 g ± 87.3 cm), medium (17.1 g ± 36.7 cm), and small (13.4 g ± 18.8 cm) taken from the north coast waters of Pemalang and the south coast waters of Cilacap. Furthermore, bacterial isolation, morphological observation, calculation of bacterial abundance, and testing of cellulolytic activity were carried out. The results showed that 150 bacteria were successfully isolated from both locations at different sizes and a total of 68 bacterial isolates had cellulolytic activity. There were 22 potential isolates from each coastal water that had a great cellulolytic activity index, ranging from 1.4 to 7.0. Moreover, the most potential activities were performed by 8 bacterial isolates encoded with GM.1, GM.2, GM.3, GM.4, GM.5, GM.6, GM.7, and GM.8 with a range of cellulolytic index obtained ranging from 3.0-7.0. The high activity index of the cellulolytic bacteria obtained is a fairly promising potential as a probiotic candidate that plays a role in degrading fiber in food found in the digestive tract of shrimp so that it can accelerate its growth.
Assistance in Independent Fish Feed Production at POKDAKAN Mina Mandiri, Panembangan Village Banyumas: Pendampingan Pembuatan Pakan ikan Mandiri Pada POKDAKAN Mina Mandiri Desa Panembangan Banyumas Purnama Sukardi; Mustika Palupi; Rudy Wijaya; Fitriadi, Ren; Kothoh Syuraikhanah; Indra Hariman; Ufianah, Ufianah
Dinamisia : Jurnal Pengabdian Kepada Masyarakat Vol. 8 No. 1 (2024): Dinamisia: Jurnal Pengabdian Kepada Masyarakat
Publisher : Universitas Lancang Kuning

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31849/dinamisia.v8i1.15989

Abstract

The purpose of this activity is to improve the competence of fish feed manufacturing and can increase fish sales production. The approach method carried out in this activity is a participatory Participatory Rural Appraisal (PRA) approach starting with a survey and problem identification, socialization and counseling training on making fish meal, training and direct technical guidance on making feed formulations, and assistance in making fish feed. The result of this dedication is that partners know the technology of making feed using available and abundant ingredients so as to reduce production expenditure in fish farming. Counseling and training activities in community service received good enthusiasm from members and partners of direct participants in making fish feed. The result of service activities is that partners gain knowledge and skills in making independent fish feed from waste and local raw materials. Making independent feed is able to increase production profits by reducing production costs incurred. The potential for developing activities can encourage productivity and provision of skills that can be disseminated to the wider community.
Specific Primer Design for Characterization and Expression of the Metallothionein (MT) Gene Pilsbryoconcha exilis Rahayu, Sata Yoshida Srie; Fikriyyani, Alya Fairuz; Hadiarto, Toto; Fitriadi, Ren
Journal of Aquaculture and Fish Health Vol. 15 No. 1 (2026): JAFH Vol. 15 No. 1 February 2026
Publisher : Department of Aquaculture

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jafh.v15i1.77996

Abstract

Mussels (Pilsbryoconcha exilis) have a defense mechanism against high heavy metal concentrations in water. This mechanism probably involves the expression of the metallothionein gene. However, information regarding the MT gene in this species is limited. Thus, characterization of the gene is necessary, beginning with the identification of the presence of the MT gene. Specific degenerate primers need to be designed for PCR amplification of the gene. This study aimed to design specific primers for the MT P. exilis gene. The research methods included exploring the MT gene sequence from GenBank NCBI. The primers were designed manually and analyzed with a Multiple Primer Analyzer and confirmed in silico. The results generate several primer pairs. When paired with reverse primer R1: 5'-GCTGCACTTCACCTTGCAATT-3' or R2: 5'- GCTGCACTTCACCTTGCAATT-3', forward primer F2: 5'- ATGGGCGACCCATGTAACTGT -3' has the potential to produce PCR product(s) from locus NC_044124 P. exilis gene PilExi_F mitochondrion, which has a complete genomic sequence of 16168bp under the suggested PCR parameters. This amplicon is likely to be a strong candidate for the MT gene in P. exilis.
Pendampingan Pembuatan Pakan Mandiri dan Aplikasi Pemberian Probiotik pada Budidaya Ikan Bawal (Colossoma macropomum) di Desa Pandak, Baturaden Fitriadi, Ren; Hary Tjahja Soedibya, Petrus; Sukardi, Purnama; Kasprijo, Kasprijo; Fikriyya, Nabela; Kurnia, Adinda; Zainudin, Muhammad; Ikhwan Ihtifazhuddin, Muhammad; Maslihah, Inayati
Artha Imperium: Jurnal Pengabdian Kepada Masyarakat Vol. 4 No. 1 (2026): 2026
Publisher : PT. Artha Genetikalab Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.62521/pr3d2b54

Abstract

Desa pandak dialiri perairan dari sungai pelus dan saluran irigasi parikesit untuk pertanian. Saat ini saluran irigasi parikesit yang biasa digunakan untuk pengairan pesawahan sudah berubah menjadi lahan pemukiman. Debit saluran irigasi yang sangat besar menjadi perhatian para warga masyarakat Desa Pandak untuk dapat dimanfaatkan sebagai sumber air bagi kolam ikan yang sekarang dikelola oleh kelompok budiaya ikan (POKDAKAN) Parikesit. Permasalahan yang dialami oleh mitra belum memahami penerapan Cara Budidaya Ikan yang Baik (CBIB) dan rendahnya pertumbuhan dan sintasan ikan budidaya. Tujuan dari PKM ini untuk mengembangkan usaha POKDAKAN sehingga meningkatkan produksi dan pendapatan anggota kelompok. Target kegiatan ini adalah Kelompok budiaya ikan (POKDAKAN) Parikesit. Metode kegiatan pendekatan yang dilakukan dalam kegiatan ini adalah pendekatan partisipatif (PRA/Participatory Rural Appraisal) dengan cara sosialisasi dan penyuluhan. Hasil kegiatan pengabdian bahwa khalayak mitra dapat memahami mengenai Cara budidaya ikan yang baik (CBIB) dan mampu meningkatkan jumlah produksi setelah penerapan probiotik.