Article Per Year (5 Year)
p-Index From 2020 - 2025
3.048
P-Index
This Author published in this journals
All Journal HAYATI Journal of Biosciences Jurnal Ilmiah Farmasi Natural Science: Journal of Science and Technology Jurnal Farmasi Sains dan Komunitas Jurnal Farmasi Galenika (Galenika Journal of Pharmacy) Adi Widya : Jurnal Pengabdian Masyarakat JSFK (Jurnal Sains Farmasi & Klinis) Jurnal Pengabdian Masyarakat Bangsa Jurnal Pengabdian Farmasi dan Sains Journal of Tropical Pharmacy and Chemistry Jurnal Sains dan Kesehatan
Armini Syamsidi
Jurusan Farmasi, Fakultas MIPA, Universitas Tadulako, Palu, Indonesia
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Earth & Planetary Sciences Economics, Econometrics & Finance Education Energy Health Professions Immunology & microbiology Industrial & Manufacturing Engineering Law, Crime, Criminology & Criminal Justice Mathematics Medicine & Pharmacology Nursing Physics Public Health Social Sciences Other

Published : 16 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 16 Documents
Search

 1   2 
Primer Design and Analysis for Detection of mecA gene Armini Syamsidi; Nuur Aanisah; Reyhan Fiqram; Imanuel Al Jultri
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): J. Trop. Pharm. Chem.
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.297

Abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method
Pemanfaatan Ekstrak Buah Kaktus (Oputian elatior Mill.) sebagai Pewarna Alami pada Sediaan Lipstik Nuur Aanisah; Evi Sulastri; Yusriadi Yusriadi; Friskilla Friskilla; Armini Syamsidi
Jurnal Sains dan Kesehatan Vol. 2 No. 4 (2020): J. Sains Kes.
Publisher : Fakultas Farmasi, Universitas Mulawarman, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Cactus fruit (Opuntia elatior Mill) is a flowering plant of the Cartacae family, which grows in high and dry plateau known to contain betacyanin compound, which is a natural dye of red color. The aim of this research is to identify the physical and chemical characteristics of betacyanin extract of cactus fruit on lipstick ingredients. The examination of physical and chemical characteristics includes organoleptic testing, homogeneity, melting point, pH, lipstick smearing, lipstick hardness and betacyanin levels in the lipstick. Observations were made on the first day and the seventh day of storage. The test results show red lipstick ingredients with a distinctive aroma of the betacyanin extract and densely dispersed homogenous texture. Meanwhile, the melting point test showed lipsticks melt at the temperature of 70°C, with pH value of the first day is 5,86 and the seventh day that is 6,13, polishing evenly and obtained lipstick 90g lipstick hardness level. The result of betacyanin content on the first day is 0.195 mg / 100gram, and on the seventh day is 0.105 mg / 100gram. In conclusion, lipstick produce with betacyanin extract of cactus fruit has good physical stability in accordance with SNI 16-4769-1998 about the ingredients of lipstick (Indonesian National Standard).
In-vitro Sun Protecting Factor of Rice Bran Oil and Its Formulation as Compact Powder Syamsidi, Armini; Sulastri, Evi; Yusriadi, Yusriadi; Putri, Pramita; Aanisah, Nuur
JSFK (Jurnal Sains Farmasi & Klinis) Vol 10 No 1 (2023): J Sains Farm Klin 10(1), April 2023
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.10.1.54-61.2023

Abstract

This study aims to determine the effective concentration of rice bran oil which can protect against ultraviolet (UV) rays as well as formulate it in compact powder preparation followed by determination of its Sun Protecting Factor (SPF) value. Rice bran samples were extracted using the Soxhlet extraction method with n-hexane: ethanol (1:1) as the solvent. Further identification of the γ-oryzanol in rice bran oil was carried out using TLC silica gel GF254 with eluent of n-hexane:ethyl acetate (3:1). The obtained γ-oryzanol in rice bran oil was used as the ingredient to develop the compact powder which is made into five formulas with 0,05 %-0,25 % concentration. All formulas were characterized, including homogeneity, adhesion and crack test. UV-Visible spectrophotometry was used to determine the SPF value of rice bran oil and its compact powder. The identification results demonstrated a positive presence of the chemical γ-oryzanol in the rice bran oil. At concentrations of 500, 1000, 1500, 2000, and 2500 ppm, rice bran oil may protect against UV rays with SPF values ranging from 1.741 to 11.884. The result showed that all formulas dispersed homogeneously, performed well in terms of compactness, and had no breaks or cracks discovered. Meanwhile, the SPF values of all formulas are found to be 1.390 and 1.274. The results indicate that the SPF values are shallow and are included in the minimal SPF category (2-4) in protecting against UV rays.
Formulation and Antioxidant Activity of Clay Mask of Tomato (Solanum lycopersicum L.) Lycopene Extract with Variation of Concentration of Kaoline and Bentonite Bases): Formulasi dan Aktivitas Antioksidan Masker Clay Ekstrak Likopen Tomat (Solanum lycopersicum L.) dengan Variasi Konsentrasi Basis Kaolin dan Bentonit Syamsidi, Armini; Syamsuddin, Alifah Magfirah; Sulastri, Evi
Jurnal Farmasi Galenika (Galenika Journal of Pharmacy) (e-Journal) Vol. 7 No. 1 (2021): (March 2021)
Publisher : Universitas Tadulako

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22487/j24428744.2021.v7.i1.15462

Abstract

Free radicals can cause damage to human skin, so antioxidants are needed to counteract the negative effects of these free radicals, for example preparations in the form of face masks. Tomatoes (Solanum lycopersicum L.) contains nutritious substances, namely lycopene which can be useful as an antioxidant for the skin. This study aims to determine the effect of variations in kaolin and bentonite bases on physical characteristics and antioxidant activity of tomato lycopene extract clay mask, and to determine the best formula. Tomato lycopene extract was modified into a microemulsion preparation to maintain the stability of antioxidant activity. Kaolin and bentonite used as bases had various concentrations in each formula, namely F1: 15% and 2%, F2: 20% and 1.5%, F3: 25% and 1%, F4: 30% and 0.5%. The results showed that the four clay mask preparations were homogeneous and no change in color, shape and aroma. The pH test on the four formulas was F1: 4.33 ± 0.35, F2: 5.58 ± 0.24, F3: 6.48 ± 0.22, and F4: 7.34 ± 0.08. The viscosity test on the four formulas was F1 : 20213.3 ± 140.4, F2: 24133.3 ± 83.26, F3 29080 ± 105.83, F4 33293.3 ± 378.06. The spreadability test was F1 6.59 ± 0.24, F2 5.59 ± 0.16, F3 4.85 ± 0.11, F4 7.84 ± 0.05. The test time for the preparation to dry was F1 19.02 ± 0.36, F2 15.33 ± 0.54, F3 11.27 ± 0.42, F4 8.24 ± 0.50. F1 and F2 are very easy to clean. Meanwhile, F3 and F4 are easy to clean. The best formula for clay masks is the F3 preparation where the concentration of kaolin is 25% and bentonite is 1%. It also showed the lower antioxidant activity (741.34 µg/mL) than other formulas.
Sosialisasi Penggunaan Kosmetik Aman Bagi Generasi- Z di Lab School Palu sebagai paya Mencegah Dampak Negatif Produk Ilegal Sejak Dini Sulaiman , Sri Sulistiana; Sulastri, Evi; Syamsidi, Armini; Sultan, Asriana; Sharon, Nela; Aanisah, Nuur
Jurnal Pengabdian Masyarakat Bangsa Vol. 3 No. 7 (2025): September
Publisher : Amirul Bangun Bangsa

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.59837/jpmba.v3i7.3118

Abstract

Kegiatan pengabdian masyarakat dengan tema Sosialisasi Penggunaan Kosmetik Aman bagi Generasi-Z di Lab School Palu sebagai Upaya Mencegah Dampak Negatif Produk Ilegal Sejak Dini” telah dilaksanakan pada 6 Agustus 2025 dan diikuti oleh 40 siswa kelas XII. Kegiatan ini bertujuan meningkatkan literasi kosmetik aman, membekali peserta agar mampu membedakan produk legal dan ilegal, memahami dampak kesehatan dari kosmetik berbahaya, serta memperkenalkan cara praktis memeriksa legalitas produk dengan mengecek nomor izin edar kosmetik melalui situs maupun aplikasi resmi BPOM. Metode pelaksanaan mencakup survei awal, koordinasi dengan mitra kegiatan, penyusunan media edukasi berupa leaflet, pemaparan materi, simulasi interaktif, serta evaluasi melalui pretest dan posttest. Hasil kegiatan menunjukkan peningkatan kesadaran siswa tentang pentingnya menggunakan kosmetik yang aman dan legal serta adanya peningkatan pengetahuan siswa sebesar 22,13% dengan antusiasme tinggi selama pelaksanaan. Hasil ini menegaskan bahwa sosialisasi efektif dalam membangun kesadaran generasi muda terhadap pentingnya memilih kosmetik aman, sekaligus menjadi langkah preventif untuk mencegah dampak negatif produk ilegal sejak dini.
PELATIHAN PEMBUATAN KOSMETIK MOISTURIZING LIPCREAM SEBAGAI UPAYA PENINGKATAN KETERAMPILAN DAN KEWIRAUSAHAAN DI SLB HUNTAP PALU Aanisah, Nuur; Sulastri, Evi; Syamsidi, Armini; Sultan, Asriana; Sulaiman, Sri Sulistiana
Adi Widya : Jurnal Pengabdian Masyarakat Vol 9 No 2 (2025): Adi Widya: Jurnal Pengabdian Masyarakat
Publisher : Lembaga Penelitian dan Pengabdian Masyarakat

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33061/awpm.v9i2.13492

Abstract

Kegiatan pengabdian kepada masyarakat berupa Pelatihan Pembuatan Kosmetik Moisturizing Lipcream sebagai Upaya Peningkatan Keterampilan dan Kewirausahaan bagi Siswa/i di SLB Huntap Palu telah dilaksanakan pada 5 Agustus 2025, dengan melibatkan guru-guru SLB Huntap Palu sebagai peserta. Program ini bertujuan untuk meningkatkan kompetensi guru agar mampu mengajarkan keterampilan pembuatan lipcream kepada siswa, sehingga mereka memperoleh bekal keterampilan praktis sekaligus peluang berwirausaha. Metode pelaksanaan meliputi koordinasi dengan mitra, penyampaian materi dan brosur, demonstrasi, praktik langsung, serta evaluasi menggunakan instrumen pretest dan posttest. Hasil kegiatan menunjukkan adanya peningkatan pengetahuan peserta sebesar 24,67% serta keterampilan yang baik dalam menghasilkan lipcream dengan kualitas tekstur, warna, dan kemampuan melembapkan yang optimal. Peserta juga menunjukkan antusiasme tinggi selama kegiatan berlangsung. Temuan ini menegaskan bahwa program pelatihan efektif dalam meningkatkan pengetahuan dan keterampilan guru, serta membuka peluang di masa depan bagi pengembangan keterampilan siswa berkebutuhan khusus melalui pendampingan para guru yang telah mengikuti pelatihan.
Co-Authors Abd. Rahman Razak Abd. Rasyid Syamsuri Agustinus Widodo Akhmad Khumaidi Anindyajati Anindyajati Anita Artarini Arisca, Windhy Nur Arni Fitriyanti Asriana Sultan Debbie S. Retnoningrum Djaleha, Helena Fransisca Evi Sulastri Friskilla Friskilla Iklima Imanuel Al Jultri Indriani, Meri Feki Ismail, Ihwan Khildah Khaerati Muhammad Sulaiman Zubair Musyahidah Musyahidah Nandiska Maladjili Nela Sharon Nurul Ambianti Nuur Aanisah Pramita Putri Pramita Putri Primadia, Rizki Putri, Ayu Dinawati Raymond R. Tjandrawinata Reyhan Fiqram Ritha Pratiwi Sri Sulistiana Sulaiman , Sri Sulistiana Sulaiman, Sri Sulistiana Syamsuddin, Alifah Magfirah Syaputra, Gunawan Syariful Anam Tunreng, Muh. Fadil Usman Yuliet Yuliet Yusriadi Yusriadi