Claim Missing Document
Check
Articles

Nutritional Contents and Bioactive Compounds among Several Variants of Dolichos lablab: Fundamental Facts for Functional Food Development Elly Purwanti; Feri Eko Hermanto; Wahyu Prihanta; Tutut Indria Permana; I Gusti Ngurah Agung Wiwekananda
Journal of Tropical Biodiversity and Biotechnology Vol 8, No 2 (2023): August
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jtbb.81339

Abstract

To date, the data describing various nutritional and secondary metabolites content of Lablab beans is incomplete. Therefore, this study evaluated the nutritional value, secondary metabolites, and antioxidant activity of three different variants of Lablab beans, i.e., brown, black, and cream beans. The results showed that the brown Lablab beans had outperformed other variants according to their nutritional value and flavonoid content with outstanding DPPH scavenging activity. However, the black beans also showed good bioactive contents through their total phenolic percentage with decent reducing activity via the FRAP assay. Those who are keen in developing functional food from Lablab beans should consider this data as a reference. 
Augmented reality in biology education: A systematic literature review Tutut Indria Permana; H. Husamah; Moh Irfan Nurhamdani; Alia Zaskia; Aulia Savitri; Diva Aulia Salsabila
Research and Development in Education (RaDEn) Vol. 4 No. 1 (2024): July
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/raden.v4i1.32636

Abstract

Augmented Reality (AR) has seen extensive utilization in the modern era, driven by rapid technological advancements. The aim of the Systematic Literature Review (SLR) method is to meticulously analyze and assess previous research on a specific phenomenon in a systematic and explicit manner. The search was conducted on the Scopus database using the keyword "Augmented Reality," resulting in 209 relevant articles. Out of this total, 35 articles passed the journal selection criteria and were deemed ready for analysis. The article selection process was carried out using the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) model for inclusion and exclusion purposes. Since 2019, there has been a rising trend in research on augmented reality. The issue of AR can be approached through quantitative, qualitative, mixed-methods, and even development research (R&D). The most prominent author in AR research is NF Saidin. The data shows that the keyword "augmented reality" is strongly associated with "education" and "biology." These keywords are linked to concepts such as teacher training, augmented reality tools, teaching, biology learning, learning performance, e-learning, and virtual reality. Themes related to AR in education focus on teacher training in biology, which applies e-learning or mobile learning based on AR and virtual reality (VR). Articles were published by authors from 28 different countries, with authors predominantly from Asia. There are 15 institutions worldwide that fund AR research and publications. It can be concluded that the focus on AR in biology education will continue to grow, supported by the ongoing emphasis on technology in the modern era. This trend is reflected in the distribution year, research types/methods, instruments, areas of study, authors, keywords, authors’ nationalities, and collaboration patterns.
Knowledge of the Madurese Community-Indonesia Regarding Bioprospection of the Traditional Herb Kamandin Saebo (Glossocardia leschenaultii [Cass.] Veldkamp) Purwanti, Elly; Nuryady, Moh. Mirza; Permana, Tutut Indria; Rachmawati, Hidajah; Anggraeni, Amaliyah Dina
Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Vol. 7 No. 3: November 2023
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/esaintika.v7i3.1403

Abstract

The purpose of this study was to describe the knowledge of the Sumenep Madura community (village elders and gatherers) about the Kamandin Saebo (Glossocardia leschenaultii) plant and its utilization. This study uses observational research that aims to observe a fact at a certain time using a descriptional approach model. The research was conducted in the Sumenep-Madura area, East Java Province. The research was conducted in July 2023-August 2023 by observational method. We discussed the results of information regarding the knowledge of the Sumenep people about the existence and growing areas of Kamandin saebo, a literature search regarding the morphological characterization, benefits, or uses of Kamandin saebo in medicine as conveyed by the gatherers. We also found that Kamandin Saebo is of great value. There are 14 healing functions associated with Kamandin Saebo. The Madurese people believe this plant to have many benefits or even cure all diseases.
Pendampingan Pengelolaan Laboratorium IPA SMP Muhammadiyah Kota Malang Untuk Memfasilitasi Keterampilan Proses Sains Siswa Permana, Tutut Indria; Nuryady, Moh Mirza; Ariesaka, Kiky Martha; Ganes, Tegar; Nazila, Farah
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 2 (2024): June
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i2.1855

Abstract

Pengelolaan laboratorium IPA harus didayagunakan secara efektif dan efisien untuk mendukung kegiatan kurikuler secara optimal. Pengelolaan laboratorium IPA yang optimal dapat mendukung tercapainya keterampilan proses sains siswa ketika menggunakan laboratorium pada proses pembelajaran. Namun demikian, tidak semua sekolah sudah memiliki sumber daya yang memadai dan pengelolaan laboratorium IPA yang baik. Seperti halnya yang terjadi di beberapa SMP Muhammadiyah di kota Malang yang mengalami kendala dalam pengelolaan laboratorium IPA di sekolah, seperti belum adanya etiket dan label pada alat bahan, belum adanya Standart Operational Procedure setiap alat, dan juga penataan alat bahan yang tidak aturan. Agar mampu memfasilitasi siswa untuk dapat memiliki keterampilan proses sains, sekolah memang perlu melakukan pengelolaan laboratorium IPA secara optimal untuk mendukung kegiatan akademik maupun non akademik siswa. Pengelolaan laboratorium yang baik akan memudahkan proses pembelajaran laboratorium, sehingga kegiatan pembelajaran praktik dilaboratorium dapat lebih maksimal. Kegiatan pengabdian kepada masyarakat ini bertujuan untuk memberikan pendampingan dalam pengelolaan laboratorium IPA di SMP Muhammadiyah kota Malang. Kegiatan pengelolaan laboratorium ditujukan pada pihak sekolah yang terdiri dari pejabat struktural dan guru mata pelajaran yang berkaitan dengan kegiatan praktikum dalam laboratorium IPA. Kegiatan pengabdian tersusun atas: 1) observasi kondisi laboratorium IPA yang ada di sekolah; 2) sosialisasi dan workshop tentang standar pengelolaan laboratoium IPA; dan 3) pelaksanaan perbaikan managemen pengelolaan laboratorium IPA. Hasil kegiatan pengabdian ini adalah adanya peningkatan pengetahuan guru dalam pengelolaan laboratorium yang sesuai standar dan telah dilakukan perbaikan managemen pengelolaan laboratorium dengan melengkapi SOP yang ada di laboratorium. Lebih lanjut lagi, di laboratorium setiap sekolah mitra telah terdapat poster tatacara praktikum, SOP, etiket dan labelling alat bahan. Dengan demikian kegiatan pengabdian ini akan mewujudkan pengelolaan laboratorium IPA yang memadai untuk mendukung kegiatan akademik dan non akademik siswa yang bertujuan untuk meningkatkan kualitas proses pembelajaran di SMP Muhammadiyah Malang. Assistance in Managing Science Laboratories at Muhammadiyah Junior High Schools in Malang City to Facilitate Students' Scientific Process Skills Abstract The management of science laboratories must be utilized effectively and efficiently to optimally support curricular activities. Optimal management of science laboratories can support the achievement of students' scientific process skills when using the laboratory in the learning process. However, not all schools have adequate resources and good science laboratory management. This is the case in several Muhammadiyah Junior High Schools in Malang city, which face challenges in managing their science laboratories, such as the lack of labels and etiquette on equipment and materials, the absence of Standard Operating Procedures for each piece of equipment, and the disorganized arrangement of equipment and materials. To facilitate students in acquiring scientific process skills, schools indeed need to manage their science laboratories optimally to support both academic and non-academic student activities. Good laboratory management will facilitate the laboratory learning process, making practical learning activities in the laboratory more effective. This community service activity aims to provide assistance in managing science laboratories at Muhammadiyah Junior High Schools in Malang city. The laboratory management activities are aimed at school personnel, including structural officials and subject teachers involved in laboratory practical activities. The community service activities consist of: 1) observing the current condition of science laboratories in the schools; 2) socialization and workshops on standard science laboratory management; and 3) implementing improvements in laboratory management. The results of this community service activity include an increase in teachers' knowledge in managing laboratories according to standards, and improvements in laboratory management by completing the existing SOPs in the laboratories. Furthermore, each partner school's laboratory now has posters on practical procedures, SOPs, etiquette, and labeling of equipment and materials. Thus, this community service activity will result in adequate science laboratory management to support both academic and non-academic student activities, aiming to improve the quality of the learning process at Muhammadiyah Junior High Schools in Malang city.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Moh. Mirza Nuryady; Elly Purwanti; Siti Nur Aldina; Sri Wahyuni; Tutut Indria Permana; Zakiyatul Khoiriyah; Kiky Martha Ariesaka
Al-Kauniyah: Jurnal Biologi Vol 18, No 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Hilirisasi Prototype Diversifikasi Pangan Fungsional Berbasis Koro Lokal dalam Upaya Pengembangan Produk Pangan Sehat Dan Ekonomi Hijau di Sumenep Purwanti, Elly; Warkoyo, W.; Hidayati, Asmah; Nuryady, Moh. Mirza; Permana, Tutut Indria; Lestari, Novi Puji
Lumbung Inovasi: Jurnal Pengabdian kepada Masyarakat Vol. 9 No. 4 (2024): December
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/linov.v9i4.2305

Abstract

Kegiatan ini bertujuan untuk melakukan hilirisasi prototipe diversifikasi pangan fungsional berbasis kacang koro lokal dalam rangka pengembangan produk pangan sehat dan ekonomi hijau di Sumenep. Program ini dilaksanakan dengan menggunakan pendekatan Triple Helix yang melibatkan tiga komponen utama: Universitas Muhammadiyah Malang (UMM) sebagai pemegang inovasi, Kemendikbudristek sebagai pemberi dana, dan mitra industri rumah tangga (IRT) di Sumenep, yaitu CV Bunga Anggrek dan CV Akancatani, sebagai penerima manfaat utama. Sinergi antara akademisi, pemerintah, dan industri ini bertujuan untuk mendorong inovasi yang mampu meningkatkan kesejahteraan masyarakat melalui pengembangan ekonomi hijau. Kegiatan hilirisasi ini dilakukan melalui Focus Group Discussion (FGD), sosialisasi, dan pendampingan intensif oleh tim UMM kepada mitra IRT, dengan fokus pada peningkatan kualitas dan kuantitas produk berbasis koro. Selain itu, pelaksanaan Kuliah Kerja Nyata (KKN) di Desa Grujugan, Sumenep, turut memperkuat upaya ini dengan program kerja yang mengembangkan potensi desa dan memperluas akses pasar produk koro. Secara keseluruhan, kegiatan ini tidak hanya mendukung keberlanjutan usaha IRT berbasis koro, tetapi juga memperkuat daya saing produk di pasar yang lebih luas, mendukung ekonomi lokal dengan adanya peningkatan pendapatan, dan membangun keterampilan masyarakat dalam pengelolaan bisnis yang berkelanjutan. Kegiatan ini juga dapat menjadi inspirasi bagi pengembangan ekonomi hijau di wilayah lain di Madura dan Indonesia. Downstreaming of Functional Food Diversification Prototype Based on Local Koro in an Effort to Develop Healthy Food Products and a Green Economy in Sumenep Abstract This activity aims to downstream a prototype of functional food diversification based on local koro beans in order to develop healthy food products and a green economy in Sumenep. This program is implemented using the Triple Helix approach involving three main components: the UniversitAS Muhammadiyah Malang (UMM) as the innovation holder, the Ministry of Education, Culture, Research and Technology as the funder, and home industry partners (IRT) in Sumenep, namely CV Bunga Anggrek and CV Akancatani, as the main beneficiaries. The synergy between academics, government, and industry aims to encourage innovation that can improve community welfare through the development of a green economy. This downstream activity is carried out through Focus Group Discussions (FGD), socialization, and intensive mentoring by the UMM team to IRT partners, with a focus on improving the quality and quantity of koro-based products. In addition, the implementation of the Real Work Lecture (KKN) in Grujugan Village, Sumenep, also strengthens this effort with a work program that develops village potential and expands market access for koro products. Overall, this activity not only supports the sustainability of koro-based IRT businesses, but also strengthens product competitiveness in the wider market, supports the local economy with the increase in income, and builds community skills in sustainable business management. This activity can also be an inspiration for the development of a green economy in other regions in Madura and Indonesia.
Pendampingan Penulisan Karya Ilmiah Remaja untuk Meningkatkan Kreativitas dan Literasi Permana, Tutut Indria; Fatmawati, Diani
International Journal of Community Service Learning Vol. 3 No. 3 (2019): August 2019
Publisher : Universitas Pendidikan Ganesha

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (740.814 KB) | DOI: 10.23887/ijcsl.v3i3.20867

Abstract

Pengabdian ini bertujuan untuk melakukan pendampingan untuk penulisan karya ilmiah remaja pada siswa MA Muhammadiyah 1 Malang. Subjek pengabdian berjumlah 10 orang yang terdiri dari 4 orang guru dan 6 orang siswa. Kegiatan pengabdian dilaksanakan selama 4 bulan. Instrumen untuk mengambil data terdiri dari soal pilihan ganda, soal essay beserta rubrik penilaian, dan kamera untuk dokumentasi. Hasil pengabdian menunjukkan bahwa pemahaman subyek pengabdian terkait metode ilmiah secara umum cukup tinggi (di atas 50%). Sedangkan kemampuan berpikir kreatif masih cukup rendah yakni 33% pada dua indikator (“dapat diterapkan” dan “keterjangkauan biaya”) meskipun indikator “kemanfaatan” cukup tinggi (83%). Pada aspek kemampuan literasi, mayoritas (83%) subyek pengabdian juga menunjukkan kemampuan pada level paling redah yakni nominal, sedangkan 17% lainnya pada level fungsional. Berdasarkan hasil pengabdian, maka disarankan untuk memberikan pendampingan dengan frekwensi yang lebih intensif kepada siswa MA Muhammadiyah 1 Malang dengan memberikan fokus yang lebih tegas pada berbagai aspek kemampuan yang masih rendah. Kata Kunci: Kreativitas, literasi penulisan karya ilmiah,.
Pembentukan Karakter Wirausaha Anak Panti Asuhan Aisyiyah Dinoyo Malang melalui Batik Celup Permana, Tutut Indria; Qibtiyah, Siti Mariyatul; Rohmah, Ladysyah Fitri; Hidayat, Nur Hadi; Rahmawati, Hanifa Rizky; Setyaningsih, Yeni; Rochani, Aning
International Journal of Community Service Learning Vol. 5 No. 1 (2021): February 2021
Publisher : Universitas Pendidikan Ganesha

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (320.239 KB) | DOI: 10.23887/ijcsl.v5i1.30025

Abstract

Penanaman karakter wirausaha sejak dini dinilai penting untuk menciptakan karakter wirausahawan yang kreatif dan inovatif, terutama pada anak-anak panti asuhan seperti di Panti Asuhan Aisyiyah Dinoyo. Kondisi finansial panti asuhan yang tidak menentu menyebabkan anak-anak panti harus membantu menambah income panti sekaligus sebagai tabungan pribadi. Oleh sebab itu program PKM-M ini bertujuan untuk membentuk karaker wirausaha anak Panti Asuhan Aisyiyah dengan memberikan pelatihan pembuatan batik celup. Pelaksanaan program dilakukan secara daring menggunakan platform WhatsApp dan GoogleMeet.  Materi pelatihan diberikan dalam bentuk video tutorial dan buku pedoman yan diberikan secara daring kepada mitra. Kegiatan pelatihan terdiri dari empat kegiatan daring. Hasil kegiatan PKM-M menunjukkan bahwa mitra telah mendapatkan wawasan baru terkait pembuatan batik celup dan cara pemasarannya. Selain itu program ini juga memberikan tahapan dasar untuk merintis usaha kecil yang bias dilakukan dari hasil produk batik celup.
Optimalisasi Keterampilan 4C Siswa Melalui Pendampingan Karya Ilmiah di SMAN 1 Tumpang Permana, Tutut Indria; Nuryady, Moh. Mirza
Jurnal SOLMA Vol. 14 No. 1 (2025)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v14i1.18089

Abstract

Background: Enhancing 4C skills (Critical Thinking, Creativity, Collaboration, and Communication) is one of the primary goals of 21st-century education. Schools play a crucial role as the main environment for developing these skills, fostered through a scientific writing mentorship program for students. This program was designed by a dedicated team to provide intensive guidance to 28 students of SMA Negeri 1 Tumpang in crafting and presenting high-quality scientific works. Through this process, students were trained to critically analyze problems, create innovative solutions, collaborate effectively within teams, and communicate their research findings. Methods: The approach employed consisted of interactive workshops, mentoring sessions, and continuous evaluation. Results: The evaluation included measuring 4C skills through tests, which revealed a high average score (93.21) with a low standard deviation (SD=5.808), indicating a homogeneous distribution of scores. The outcome of this community engagement activity was the establishment of a student extracurricular scientific writing group comprising 28 members with guidance from a teacher mentor. Conclusions: This program successfully enhanced students' academic skills while also preparing them to face future challenges with greater confidence and competence. Moreover, this learning approach serves as an inspirational model for developing 21st-century skills among the younger generation.
Global research trends in biodiversity conservation strategies: A bibliometric analysis Husamah, H.; Zafira, Aulia Mahdiyatul Dwi; Dalifah, Umrohatul; Permana, Tutut Indria; Rahardjanto, Abdulkadir; Lestari, Nurdiyah
Biological Environment and Pollution Vol. 5 No. 1 (2025)
Publisher : Association for Scientific Computing, Electronics, and Engineering (ASCEE)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31763/bioenvipo.v5i1.870

Abstract

This study presents a bibliometric analysis of biodiversity conservation efforts to identify key research trends, themes, and gaps. Using the Scopus database with VOSviewer and RStudio, we analyzed publication trends, co-authorship networks, keyword co-occurrence, and citation patterns. The results reveal a significant surge in publications since 2019, peaking in 2022 and reflecting heightened global focus. The research is highly interdisciplinary, dominated by environmental sciences (35.9%) and agricultural and biological sciences (10.6%). Journals such as Biodiversity and Conservation and Biological Conservation serve as key publication venues. Geographically, Australia, India, and the United States lead in research output, with significant contributions from China and Brazil. Thematic analysis highlights strategic methodologies, ecosystem services, and conservation management as primary research drivers. This study underscores the necessity of international collaboration and interdisciplinary approaches for effective conservation. The insights provide a foundation for future research and offer strategic direction for academics and policymakers to enhance global biodiversity conservation initiatives.
Co-Authors Abdulkadir Rahardjanto Abdulkadir Rahardjanto Abdulkadir Rahardjanto Abdulkadir Rahardjanto, Abdulkadir Agustin, Jihan Ully Ahmad Adnan Mohd Shukri Ahmad Adnan Mohd Shukri Ahmad Fauzi Ainur Rofieq Ainur Rofieq Aldina, Siti Nur Alia Zaskia Alimatul, Zada Amaliyah Dina Anggraeni Andini, Tri Eka Anka Mohammad Dinindra Ardiani Samti Nur Azizah Ardiani Samti Nur Azizah Artha Ayu Mei Shinta Artha Ayu Mei Shinta Asmah Hidayati Atok Miftachul Hudha Aulia Savitri Ayu, Putri Azizah, Jalilah Cahyono, Shafa Rimbi Riskia Citra Lesmana Dalifah, Umrohatul Dhiga Agung Sasongkojati Dian Ika Kusumaningtyas Diani Fatmawati Diani Fatmawati Diani Fatmawati Dina Ria Pramesti Dina Ria Pramesti Dinindra, Anka Muhammad Diva Aulia Salsabila Dwi Listyorini Dwi Setyawan Elly Purwanti Etty Nurmala Fadillah Fadli, Rahman Farida Rachmawati, Farida Fatchur Rohman Fauzi Ahmad Muda Ganes, Tegar Gunarta Gunarta Hadi Suwono Hajriani Hi.Padu Hajriani Hi.Padu Hanik Fitrotul Azizah Hasan, Aso Hameed Hasmiati Hasmiati Hermanto, Feri Eko Hidajah Rachmawati Hidayat, Nur Hadi Husamah Husamah I Gusti Ngurah Agung Wiwekananda I Ketut Suada Iin Hindun Iin Hindun Ikmal Reza Fahlevy Indrawan Prasetyo Ivan Ardiansyah Jalilah Azizah Janufian, Fairus Athar Jazilah Azizah Jihan Ully Agustin Juliana, Imelda Khilma Vita Nurmayasari Khilma Vita Nurmayasari Khoiriyah, Zakiyatul Kiky Martha Ariesaka Kiky Martha Arieska Kurnia Ayu Miranti Kurnia Ayu Miranti Lestari, Novi Puji Levina Levina, Levina Ludwick Satria Romadoni Lutfi, Muhammad Ahman Maghfiroh, Adinda Zahwatun Marina Nur Fitriyaningsih Marina Nur Fitriyaningsih Mimien Henie Irawati Miza Nina Adlini Moh Irfan Nurhamdani Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Moh. Mirzha Nuryady Muhammad Ahman Luthfi Setiawan Muhammad Dheo Refaldo Wahyudi Muliana GH Munica Dwi Febriyanti Munica Dwi Febriyanti Nazila, Farah Ndzani Latifatur Rofi’ah Ndzani Latifatur Rofi’ah Nomleni, Fransina Thersiana Norizhati Nur Ilmi Dwi Sasmitasari Nurdiyah Lestari Nuryady, Mohamad Mirza Putri Ayu Irrodah Qibtiyah, Siti Mariyatul Rahmawati, Hanifa Rizky Ramadhan, Rizki Sabilul Alif Rochani, Aning Rofi'ah, Ndzani Latifatur Rohmah, Ladysyah Fitri Roimil Latifa Roimil Latifa Romadoni, Ludwick Satria Rr. Eko Susetyarini Rr. Eko Susetyarini Saleh Hidayat Saleh Hidayat Samsun Hadi Samsun hadi Sanjaya, Andika Wahyu Bagus Sasmitasari, Nur Ilmi Dwi Savitri, Aulia Shukri, Ahmad Adnan Mohd Siti Mariyatul Qibtiyah Siti Nur Aldina Siti Zaenab Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Tri Eka Andini Vivi Indriani Wahyu Prihanta Wahyu Prihanta Warkoyo, W. Y. Oikawa Yanur Setyaningrum Yasmine Salsabila Muninda Yeni Setyaningsih Yuni Pantiwati Yuni Pantiwati Zada Alimatul Mu’azah Zafira, Aulia Mahdiyatul Dwi Zakiyatul Khoiriyah Zaskia, Alia