Article Per Year (5 Year)
p-Index From 2021 - 2026
5.313
P-Index
This Author published in this journals
All Journal Jurnal Veteriner AL KAUNIYAH Jurnal Sains dan Teknologi Jurnal Kesehatan Masyarakat Biosfer: Jurnal Tadris Biologi Tadris: Jurnal keguruan dan Ilmu Tarbiyah Jurnal Pendidikan Biologi Indonesia Jurnal Inovasi Pendidikan IPA Journal of Tropical Biodiversity and Biotechnology Jurnal Pendidikan: Teori, Penelitian, dan Pengembangan Journal of Biology Education Jurnal Bioedukatika Biosfer: Jurnal Pendidikan Biologi Jurnal SOLMA International Journal of Community Service Learning Bioma : Jurnal Biologi dan Pembelajaran Biologi Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika JSMARTech : Journal of Smart Bioprospecting and Technology Jurnal Ilmiah Biologi UMA (JIBIOMA) Journal of Community Service and Empowerment Bioscientist : Jurnal Ilmiah Biologi Lumbung Inovasi: Jurnal Pengabdian Kepada Masyarakat Proceeding Biology Education Conference Journal of Natural Sciences Sepakbola Prisma Sains: Jurnal Pengkajian Ilmu dan Pembelajaran Matematika dan IPA IKIP Mataram Al Jahiz: Journal of Biology Education Research Biological Environment and Pollution Research and Development in Education (RaDEn) Biocaster : Jurnal Kajian Biologi Edubiotik : Jurnal Pendidikan, Biologi dan Terapan Jurnal Kesehatan Masyarakat Jurnal VARIDIKA
Tutut Indria Permana
Universitas Muhammadiyah Malang
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Energy Engineering Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Law, Crime, Criminology & Criminal Justice Library & Information Science Materials Science & Nanotechnology Mathematics Mechanical Engineering Medicine & Pharmacology Neuroscience Physics Public Health Social Sciences Veterinary Other

Published : 53 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 53 Documents
Search

 2   3   4   5   6 
Spirituality in ethical behavior towards the environment: A bibliometric analysis Husamah, H.; Sanjaya, Andika Wahyu Bagus; Ramadhan, Rizki Sabilul Alif; Permana, Tutut Indria; Rahardjanto, Abdulkadir; Lestari, Nurdiyah; Shukri, Ahmad Adnan Mohd
Biosfer: Jurnal Tadris Biologi Vol 16 No 1 (2025): Biosfer: Jurnal Tadris Biologi
Publisher : UNIVERSITAS ISLAM NEGERI RADEN INTAN LAMPUNG

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24042/biosfer.v16i1.25838

Abstract

This study aims to analyze research trends related to spirituality and ethical behavior towards the environment through a bibliometric approach. Using data from 97 documents published between 1992 and 2024, this study answers eight research questions, including temporal distribution, dominant subject areas, most cited documents, most relevant sources, country collaboration patterns, main supporting institutions, keyword trends, and thematic patterns. The results show fluctuating publication growth, peaking in 2022. Arts and Humanities and Social Sciences are the most dominant fields, while the journal Worldviews: Environment, Culture, Religion is the main source. These findings provide strategic insights for the development of multidisciplinary research, global collaboration, and spirituality-based policies in supporting environmental sustainability. Spiritualitas dalam perilaku etis terhadap lingkungan: Analisis bibliometrik ABSTRAK: Penelitian ini bertujuan untuk menganalisis tren penelitian terkait spiritualitas dan perilaku etis terhadap lingkungan melalui pendekatan bibliometrik. Dengan menggunakan data dari 97 dokumen yang diterbitkan antara tahun 1992 dan 2024, penelitian ini menjawab delapan pertanyaan penelitian, meliputi distribusi temporal, bidang subjek dominan, dokumen yang paling banyak dikutip, sumber yang paling relevan, pola kolaborasi negara, lembaga pendukung utama, tren kata kunci, dan pola tematik. Hasilnya menunjukkan pertumbuhan publikasi yang fluktuatif, mencapai puncaknya pada tahun 2022. Bidang yang paling dominan adalah Seni dan Humaniora serta Ilmu Sosial, sedangkan jurnal Worldviews: Environment, Culture, Religion menjadi sumber utama.. Temuan ini memberikan wawasan strategis untuk pengembangan penelitian multidisiplin, kolaborasi global, dan kebijakan berbasis spiritualitas dalam mendukung keberlanjutan lingkungan.
Pengaruh model pembelajaran Li-Pro-GP terhadap kemampuan berpikir kreatif dan kemampuan komunikasi tulisan pada pembelajaran IPA biologi SMP Savitri, Aulia; Pantiwati, Yuni; Fauzi, Ahmad; Wahyuni, Sri; Permana, Tutut Indria
Biosfer: Jurnal Pendidikan Biologi Vol. 18 No. 2 (2025): Biosfer: Jurnal Pendidikan Biologi
Publisher : Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21009/biosferjpb.55067

Abstract

Students' creativity and written communication are essential 21st-century skills, yet junior high school students often show low abilities in these areas due to passive, monotonous learning and limited writing practice. This study investigates the effect of the Li-Pro-GP learning model a project-based literacy approach integrated with the School Literacy Movement (SLM) and Strengthening Character Education (SCE) on improving students' creative thinking and written communication abilities. This study used a quantitative approach with a quasi-experimental non-equivalent control group design. The sampling technique used was purposive sampling based on equal number of students and gender balance. VIII F served as the experimental class and VIII G as the control class, each consisting of 34 students with 15 males and 19 females. The research instrument used to measure creative thinking ability and written communication ability is an essay question each designed with distinct indicatiors. Creative thinking instruments emphasize innovative ideas and solutions, while written communication instruments emphasize clarity, structure, and accuracy in expressing ideas. The data were analyzed using ANCOVA and Quade's Rank Analysis with the help of SPSS 27 and JASP applications. The results of the analysis showed that the Li-Pro-GP model had a significant effect on creative thinking ability with a value of F (1,65) = 32.644, p < 0.001 and written communication ability with a value of F (1,66) = 47.259, p < 0.001. In conclusion, the application of the Li-Pro-GP learning model has an effect in improving the creative thinking and written communication ability of junior high school students.
Pengaruh model pembelajaran Li-Pro-GP terhadap kesadaran metakogitif dan kemampuan pemecahan masalah IPA biologi SMP Zaskia, Alia; Pantiwati, Yuni; Fauzi, Ahmad; Wahyuni, Sri; Permana, Tutut Indria
Biosfer: Jurnal Pendidikan Biologi Vol. 18 No. 2 (2025): Biosfer: Jurnal Pendidikan Biologi
Publisher : Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21009/biosferjpb.55070

Abstract

21st century learning demands the development of metacognitive awareness and problem-solving skills, but science learning in schools is still predominantly teacher-centered. This study aims to determine the effect of the Li-Pro-GP learning model (project-based literacy integrated with school literacy movement and character education) on metacognitive awareness and problem solving skills in Biology science learning. The research used a quantitative approach with a non-equivalent control group quasi-experimental design. The sample consisted of VIII grade students in one of the private junior high schools in East Java, with VIII A as the control and VIII B as the experiment. The research instruments used included questionnaires to measure metacognitive awareness, essay questions to assess problem solving skills, and observation sheets to assess learning implementation. Data analysis was conducted using ANCOVA with the help of SPSS 26. The post-test results showed higher scores in the experimental class than the control for both variables. ANCOVA test showed a significant effect of Li-Pro-GP model on metacognitive awareness [F(1,57) = 129.926, p = 0.000, ηp² = 0.695] and problem solving skills [F(1,57) = 81.481, p = 0.000, ηp² = 0.588]. The results of the analysis showed a significant difference and a large effect size, so it can be concluded that the Li-Pro-GP model can improve students' metacognitive awareness and problem solving skills in learning Biological Science.
Menyelisik kontribusi sepakbola pada tujuan pembangunan berkelanjutan: Tinjauan literatur dari metadata Scopus Husamah, Husamah; Rahardjanto, Abdulkadir; Permana, Tutut Indria; Lestari, Nurdiyah; Azizah, Jalilah; Shukri, Ahmad Adnan Mohd
Sepakbola Vol. 5 No. 1 (2025)
Publisher : Research and Social Study Institute

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33292/sepakbola.v5i1.418

Abstract

Artikel ini bertujuan untuk menganalisis keterkaitan antara sepakbola dan tujuan pembangunan berkelanjutan (SDGs) melalui kajian literatur sistematis berbasis database Scopus. Kajian ini mencakup dua fokus utama: (1) analisis bibliometrik terhadap tren publikasi, distribusi negara, area subjek, serta co-ocurrence kata kunci; dan (2) analisis secara sistematis isi artikel terkait jenis penelitian, subjek, fokus analisis, serta temuan utama yang berhubungan dengan SDGs. Hasil menunjukkan adanya peningkatan tajam publikasi sejak tahun 2021, didorong oleh refleksi pasca-pandemi COVID-19 dan tekanan global terhadap keberlanjutan. Mayoritas artikel berasal dari ilmu sosial, namun kontribusi juga muncul dari bidang lingkungan, bisnis, teknologi, dan kesehatan. Konten artikel mencerminkan bahwa sepakbola berperan penting dalam inklusi sosial, pendidikan, kesetaraan gender, tata kota, serta pembangunan komunitas. Temuan menarik lainnya termasuk penggunaan stadion multifungsi, jejak karbon transportasi tim, serta kampanye digital yang mendukung SDGs. Kajian ini menyimpulkan bahwa sepakbola tidak hanya menjadi wahana hiburan, tetapi juga alat transformasional dalam pembangunan global. Kajian lebih lanjut perlu mengeksplorasi konteks negara berkembang dan keterkaitan sepakbola dengan SDG yang belum banyak dikaji secara mendalam.   Exploring the contribution of football to sustainable development goals: A Scopus database literature review   Abstract: This study aims to analyze the relationship between football and the Sustainable Development Goals (SDGs) through a systematic literature review based on the Scopus database. The review focuses on two main objectives: (1) a bibliometric analysis of publication trends, country distribution, subject areas, and keyword co-occurrence; and (2) a systematic analysis of the content of articles related to the type of research, subject, focus of analysis, and key findings related to SDGs. Results reveal a sharp increase in publications since 2021, driven by post-COVID-19 reflection and increasing global pressure on sustainability. Most articles originate from the social sciences, though contributions also emerge from environmental studies, business, technology, and health. Content analysis indicates football’s significant role in social inclusion, education, gender equality, urban development, and community building. Notable findings include multifunctional stadium use, team transport carbon footprint, and digital campaigns aligned with SDGs. This review concludes that football is not merely a source of entertainment but a transformational tool in global development. Future research should address underrepresented Global South contexts and further explore football’s linkage with lesser-studied SDGs such as climate action, clean water, and biodiversity, using longitudinal and interdisciplinary approaches to assess long-term impacts.
Breeding Site Preferences and Resistance Status of Aedes aegypti in Malang City Nuryady, Moh Mirza; Purwanti, Elly; Permana, Tutut Indria; Ariesaka, Kiky Martha
Jurnal Kesehatan Masyarakat Vol. 21 No. 2 (2025)
Publisher : Universitas Negeri Semarang in collaboration with Ikatan Ahli Kesehatan Masyarakat Indonesia (IAKMI Tingkat Pusat) and Jejaring Nasional Pendidikan Kesehatan (JNPK)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15294/kemas.v21i2.21666

Abstract

Dengue Hemorrhagic Fever (DHF) remains a significant health challenge in urban and semi-urban regions, including Malang City, Indonesia, where Aedes aegypti is the primary vector. This study aimed to identify the breeding site preferences of Ae. aegypti and assess its resistance to 0.8% malathion and 0.05% cypermethrin insecticides. Using a descriptive observational design, ovitraps were deployed in three districts to collect mosquito larvae and eggs, and interviews with residents provided additional data on breeding site preferences. Resistance tests followed WHO guidelines, with mortality rates analysed after insecticide exposure. Results indicated that Ae. aegypti larvae were predominantly found in bathroom water tanks (45%) and flower vases (35%). Resistance status revealed geographical variability: Ae. aegypti in District 1 were resistant to cypermethrin, while populations in Districts 2 and 3 were susceptible, with average status of Ae. Aegypti to cypermethrin is tolerant. For malathion, resistance was widespread, particularly in District 3, with average status of Ae. Aegypti to malathion is resistant. These findings suggest that the use of malathion for vector control in Malang is no longer effective, while cypermethrin remains viable under strict monitoring to prevent future resistance. This study underscores the need for targeted insecticide use and regular monitoring to optimize vector control strategies and minimize DHF transmission.
Integration of Digital Technologies in Environmental Education: A Systematic Review of Trends, Impacts, and Future Directions Husamah, H.; Rahardjanto, Abdulkadir; Permana, Tutut Indria; Shukri, Ahmad Adnan Mohd
Jurnal VARIDIKA Volume 37 No 1, June 2025
Publisher : Faculty of Teacher Training and Education, Universitas Muhammadiyah Surakarta, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23917/varidika.v37i1.9908

Abstract

The integration of digital technologies in environmental education (EE) has emerged as an important research area. However, a comprehensive synthesis of international research remains scarce. This systematic literature review (SLR), adhering to the PRISMA guidelines, aims to fill this gap by synthesizing peer-reviewed articles published in the past decade, specifically from the Scopus database. While the Scopus database was prioritized due to its comprehensive collection of high-quality, peer-reviewed journals in the field, future research should consider incorporating studies from other databases to ensure broader coverage of the topic. The primary objectives of this review are to analyze: (1) the predominant research approaches and instruments used in digital technology research in EE; (2) key findings regarding the application of digital technologies in EE; (3) thematic categories that explain the role of digital tools in environmental learning; and (4) the impact of digital technologies on promoting pro-environmental behavior through pedagogical integration. This review synthesizes current research practices and outlines how technologies such as augmented reality (AR), virtual reality (VR), and mobile applications enhance student engagement, environmental knowledge, and pro-environmental behavior. Additionally, the review explores the potential risks associated with the adoption of digital technologies, including the phenomenon of "techno-solutionism." It emphasizes the importance of culturally and ethically responsive pedagogies to mitigate these risks. Methodologically, the review adopts a critical approach, evaluating how different studies have addressed these challenges and suggesting strategies for responsible and context-aware implementation of digital tools in EE. The findings of this review underscore the need for critical thinking in the use of digital technologies in EE. The future of digital EE research should focus on long-term impact assessments and the integration of indigenous knowledge into digital pedagogies, ensuring a more inclusive and effective approach to environmental education.
Perbedaan Keragaman Jenis dan Kelimpahan Mikroplastik pada Tiga Anak Sungai Brantas Muhammad Dheo Refaldo Wahyudi; Moh. Mirzha Nuryady; Rr. Eko Susetyarini; Siti Zaenab; Ahmad Fauzi; Tutut Indria Permana; Y. Oikawa; Kiky Martha Arieska
JST (Jurnal Sains dan Teknologi) Vol. 13 No. 3 (2024): Oktober
Publisher : Universitas Pendidikan Ganesha

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23887/jstundiksha.v13i3.82872

Abstract

Peningkatan terhadap plastik terus meningkat setiap tahunnya, hal ini disebabkan karena bertambahnya permintaan terhadap penggunaan plastik sehingga dapat mempengaruhi jumlah sampah plastik yang mencemari lingkungan salah satunya di perairan. Sampah plastik yang masuk ke sungai dan mengalami penguraian akan berubah menjadi mikroplastik. Tujuan penelitian ini untuk menganalisis keragaman jenis dan kelimpahan mikroplastik yang ada di tiga anak Sungai Brantas. Penelitian ini menggunakan jenis penelitian lapangan (field research) dengan pendekatan metode purposive sampling pada 3 anak Sungai Brantas dan dilakukan 3 kali pengulangan. Pengambilan sampel air menggunakan plankton net dengan ukuran 200 µm. Sampel yang sudah diambil dibawa ke laboratorium untuk preparasi sampel. Sampel yang sudah di preparasi dapat dilihat keragamannya menggunakan mikroskop digital, sedangkan untuk kelimpahannya dihitung menggunakan rumus excel. Hasil penelitian menunjukkan bahwa perairan Sungai Brantas Kota Surabaya ditemukan 4 jenis mikroplastik yaitu fragmen, filamen, fiber dan pellet. Jenis mikroplastik di Sungai Kalimas menunjukan dominasi tertinggi jenis fragmen, Sungai di dominasi jenis pellet, dan Sungai Jagir dominasi jenis fiber. Warna mikroplastik yang ditemukan meliputi hitam, transparan, dan coklat. Total kelimpahan rata-rata tertinggi mikroplastik ditemukan pada Sungai Kalimas dan terendah pada Sungai Jagir. Implikasi penelitian ini dapat memeberikan informasukKeberadaan mikroplastik dapat menjadi bahaya bagi hewan dan manusia karena akan menjadi bioakumulusi dalam tubuh.
An AI-Assisted Systematic Review of Biology Learning Strategies for Sustainability Husamah, H.; Rahardjanto, Abdulkadir; Permana, Tutut Indria; Shukri, Ahmad Adnan Mohd
Journal of Natural Sciences Vol 6, No 3 (2025): Journal of Natural Sciences November
Publisher : Mahesa Research Center

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.34007/jonas.v6i3.1019

Abstract

This study aims to uncover key strategies in biology learning that support sustainability through a Scopus AI–assisted literature review. Using a qualitative review approach combined with clustering and concept mapping techniques, 68 Scopus-indexed journal articles published between 2015 and 2025 were analyzed. Searches employed both natural language and Boolean keyword queries: (“biology” OR “life science”) AND (“education” OR “learning”) AND (“sustainability” OR “environmental”). Conceptual synthesis revealed three interrelated domains, Environmental Awareness, Student-centered Pedagogies, and Sustainability Education, each encompassing strategies such as experiential and problem-based learning, SDG-integrated modules, biomimicry-based innovation, and community engagement. These findings indicate that biology learning for sustainability extends beyond content mastery toward transformative pedagogy and ecological ethics, positioning biology as a platform for cultivating ecological citizenship. However, the study is limited by its reliance on Scopus AI metadata and abstracts, which may not fully capture methodological nuances and contextual depth of the original studies.
Dual Inhibition of PTP1B and DPP4 by Canavalia ensiformis Bioactive Compounds: A Synergy of Nutrition and Therapeutics Purwanti, Elly; Rachmawati, Farida; Hasan, Aso Hameed; Nuryady, Mohamad Mirza; Permana, Tutut Indria; Prihanta, Wahyu
JSMARTech: Journal of Smart Bioprospecting and Technology Vol. 6 No. 2 (2025): Vol. 6 No. 2 (2025): JSMARTech Volume 6, No 2, 2025
Publisher : JSMARTech

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jsmartech.2025.006.02.23

Abstract

Diabetes mellitus affects over 460 million adults worldwide and is projected to rise further, underscoring the urgency for safe, nutrition-based strategies to improve glycaemic control. Legumes have been known for dietary intervention for diabetic patients. However, studies evaluating the functional properties of Canavalia ensiformis for diabetes management are limited. This study investigated C. ensiformis beans for their nutritional profile and therapeutic potential in diabetes management. Nutritional values were analyzed by proximate and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), while bioactive compounds were identified by untargeted metabolite profiling using Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS). Anti-diabetic potential of identified bioactives was evaluated through molecular docking by using AutoDock Vina against dipeptidyl peptidase-4 (DPP4) and protein tyrosine phosphatase 1B (PTP1B) as known diabetic-associated enzymes. Nutritional analysis revealed a composition rich in crude protein (26.34%) and carbohydrates (54.84%), complemented by substantial mineral content, including calcium, iron, and zinc, which collectively support metabolic and physiological functions. Phytochemical profiling identified 22 bioactive compounds, such as flavonoids (e.g., Kaempferol), phenolic derivatives (e.g., Curcumin), and amino acids (e.g., DL-Tryptophan), known for their roles in oxidative stress reduction and glucose metabolism modulation. Molecular docking studies demonstrated that Kaempferol exhibiting binding affinities of − 7.7 kcal mol⁻¹ (DPP4) and − 7.5 kcal mol⁻¹ (PTP1B), while DL-Tryptophan showed comparable interactions. These ligands occupied the catalytic pockets of both enzymes and engaged key residues, mirroring the binding patterns of native ligands, indicating competitive inhibition that may enhance insulin signalling and prolong incretin action. The dual-target inhibition of PTP1B and DPP4, coupled with the bean’s high nutritional value, positions C. ensiformis as a promising functional food for diabetes management, merging dietary benefits with therapeutic potential.   Keywords: Functional food, Diabetes Mellitus, Dietary Intervention, DPP4 inhibitor, PTP1B inhibitor.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Co-Authors Abdulkadir Rahardjanto, Abdulkadir Agustin, Jihan Ully Ahmad Fauzi Ainur Rofieq Ainur Rofieq Aldina, Siti Nur Alia Zaskia Alimatul, Zada Amaliyah Dina Anggraeni Andini, Tri Eka Anka Mohammad Dinindra Ardiani Samti Nur Azizah Ardiani Samti Nur Azizah Artha Ayu Mei Shinta Artha Ayu Mei Shinta Asmah Hidayati Aulia Savitri Ayu, Putri Azizah, Jalilah Cahyono, Shafa Rimbi Riskia Dalifah, Umrohatul Dhiga Agung Sasongkojati Dian Ika Kusumaningtyas Diani Fatmawati Diani Fatmawati Diani Fatmawati Dina Ria Pramesti Dina Ria Pramesti Dinindra, Anka Muhammad Diva Aulia Salsabila Dwi Listyorini Dwi Setyawan Elly Purwanti Etty Nurmala Fadillah Farida Rachmawati, Farida Fauzi Ahmad Muda Ganes, Tegar Gunarta Gunarta Hadi Suwono Hajriani Hi.Padu Hajriani Hi.Padu Hasan, Aso Hameed Hermanto, Feri Eko Hidajah Rachmawati Hidayat, Nur Hadi Husamah Husamah Husamah I Gusti Ngurah Agung Wiwekananda I Ketut Suada Iin Hindun Ikmal Reza Fahlevy Indrawan Prasetyo Ivan Ardiansyah Jihan Ully Agustin Khilma Vita Nurmayasari Khilma Vita Nurmayasari Khoiriyah, Zakiyatul Kiky Martha Ariesaka Kiky Martha Arieska Kurnia Ayu Miranti Kurnia Ayu Miranti Lestari, Novi Puji Lutfi, Muhammad Ahman Maghfiroh, Adinda Zahwatun Marina Nur Fitriyaningsih Marina Nur Fitriyaningsih Miza Nina Adlini Moh Irfan Nurhamdani Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Moh. Mirzha Nuryady Muhammad Ahman Luthfi Setiawan Muhammad Dheo Refaldo Wahyudi Munica Dwi Febriyanti Munica Dwi Febriyanti Nazila, Farah Ndzani Latifatur Rofi'ah Ndzani Latifatur Rofi’ah Ndzani Latifatur Rofi’ah Norizhati Nur Ilmi Dwi Sasmitasari Nurdiyah Lestari Nurrohman, Endrik Nuryady, Mohamad Mirza Putri Ayu Irrodah Qibtiyah, Siti Mariyatul Rahmawati, Hanifa Rizky Ramadhan, Rizki Sabilul Alif Rochani, Aning Rofi'ah, Ndzani Latifatur Rofi’ah, Ndzani Latifatur Rohmah, Ladysyah Fitri Roimil Latifa Rr. Eko Susetyarini Rr. Eko Susetyarini Saleh Hidayat Saleh Hidayat Samsun hadi Sanjaya, Andika Wahyu Bagus Sasmitasari, Nur Ilmi Dwi Savitri, Aulia Shukri, Ahmad Adnan Mohd Siti Mariyatul Qibtiyah Siti Nur Aldina Siti Zaenab Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Tri Eka Andini Wahyu Prihanta Wahyu Prihanta Warkoyo, W. Y. Oikawa Yasmine Salsabila Muninda Yeni Setyaningsih Yuni Pantiwati Yuni Pantiwati Zada Alimatul Mu’azah Zafira, Aulia Mahdiyatul Dwi Zahidah, Ashfa Zakiyatul Khoiriyah Zaskia, Alia