Claim Missing Document
Check
Articles

An AI-Assisted Systematic Review of Biology Learning Strategies for Sustainability Husamah, H.; Rahardjanto, Abdulkadir; Permana, Tutut Indria; Shukri, Ahmad Adnan Mohd
Journal of Natural Sciences Vol 6, No 3 (2025): Journal of Natural Sciences November
Publisher : Mahesa Research Center

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.34007/jonas.v6i3.1019

Abstract

This study aims to uncover key strategies in biology learning that support sustainability through a Scopus AI–assisted literature review. Using a qualitative review approach combined with clustering and concept mapping techniques, 68 Scopus-indexed journal articles published between 2015 and 2025 were analyzed. Searches employed both natural language and Boolean keyword queries: (“biology” OR “life science”) AND (“education” OR “learning”) AND (“sustainability” OR “environmental”). Conceptual synthesis revealed three interrelated domains, Environmental Awareness, Student-centered Pedagogies, and Sustainability Education, each encompassing strategies such as experiential and problem-based learning, SDG-integrated modules, biomimicry-based innovation, and community engagement. These findings indicate that biology learning for sustainability extends beyond content mastery toward transformative pedagogy and ecological ethics, positioning biology as a platform for cultivating ecological citizenship. However, the study is limited by its reliance on Scopus AI metadata and abstracts, which may not fully capture methodological nuances and contextual depth of the original studies.
Dual Inhibition of PTP1B and DPP4 by Canavalia ensiformis Bioactive Compounds: A Synergy of Nutrition and Therapeutics Purwanti, Elly; Rachmawati, Farida; Hasan, Aso Hameed; Nuryady, Mohamad Mirza; Permana, Tutut Indria; Prihanta, Wahyu
JSMARTech: Journal of Smart Bioprospecting and Technology Vol. 6 No. 2 (2025): Vol. 6 No. 2 (2025): JSMARTech Volume 6, No 2, 2025
Publisher : JSMARTech

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jsmartech.2025.006.02.23

Abstract

Diabetes mellitus affects over 460 million adults worldwide and is projected to rise further, underscoring the urgency for safe, nutrition-based strategies to improve glycaemic control. Legumes have been known for dietary intervention for diabetic patients. However, studies evaluating the functional properties of Canavalia ensiformis for diabetes management are limited. This study investigated C. ensiformis beans for their nutritional profile and therapeutic potential in diabetes management. Nutritional values were analyzed by proximate and Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), while bioactive compounds were identified by untargeted metabolite profiling using Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS). Anti-diabetic potential of identified bioactives was evaluated through molecular docking by using AutoDock Vina against dipeptidyl peptidase-4 (DPP4) and protein tyrosine phosphatase 1B (PTP1B) as known diabetic-associated enzymes. Nutritional analysis revealed a composition rich in crude protein (26.34%) and carbohydrates (54.84%), complemented by substantial mineral content, including calcium, iron, and zinc, which collectively support metabolic and physiological functions. Phytochemical profiling identified 22 bioactive compounds, such as flavonoids (e.g., Kaempferol), phenolic derivatives (e.g., Curcumin), and amino acids (e.g., DL-Tryptophan), known for their roles in oxidative stress reduction and glucose metabolism modulation. Molecular docking studies demonstrated that Kaempferol exhibiting binding affinities of − 7.7 kcal mol⁻¹ (DPP4) and − 7.5 kcal mol⁻¹ (PTP1B), while DL-Tryptophan showed comparable interactions. These ligands occupied the catalytic pockets of both enzymes and engaged key residues, mirroring the binding patterns of native ligands, indicating competitive inhibition that may enhance insulin signalling and prolong incretin action. The dual-target inhibition of PTP1B and DPP4, coupled with the bean’s high nutritional value, positions C. ensiformis as a promising functional food for diabetes management, merging dietary benefits with therapeutic potential.   Keywords: Functional food, Diabetes Mellitus, Dietary Intervention, DPP4 inhibitor, PTP1B inhibitor.
Desain Primer PCR Spesifik Secara In Silico Untuk Amplifikasi Gen COX-1 (Cytochrome Oxidase Subunit I) DNA Mitokondria Pada Aedes aegypti Nuryady, Moh. Mirza; Purwanti, Elly; Aldina, Siti Nur; Wahyuni, Sri; Permana, Tutut Indria; Khoiriyah, Zakiyatul; Ariesaka, Kiky Martha
Al-Kauniyah: Jurnal Biologi Vol. 18 No. 1 (2025): AL-KAUNIYAH JURNAL BIOLOGI
Publisher : Department of Biology, Faculty of Science and Technology, Syarif Hidayatullah State Islami

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15408/kauniyah.v1i1.33726

Abstract

AbstrakGen COX-1 (Cytochrome Oxidase Subunit I) merupakan salah satu marker molekuler untuk identifikasi spesies berdasarkan DNA mitokondria. Tujuan dilakukannya penelitian ini, yaitu untuk mendapatkan primer gen COX-1 yang spesifik terhadap nyamuk A. aegypti. Penelitian ini merupakan penelitian deskriptif observasional yaitu dengan melakukan desain primer secara in silico dan konfirmasi secara in vitro ditandai dengan pita DNA hasil PCR. Langkah pertama dari metode ini, yaitu dengan mengunduh urutan DNA COX-1 Aedes aegypti dari Gene Bank (NCBI) dengan nomor aksesi DQ397892.1. Hasil dari Primer3web diperoleh dua primer yang spesifik, yaitu primer pertama memiliki sekuen F¢AGCAACTTTACACGGAACTCA dan R¢TGTTCTGCAGGAGGAAGTGT dan pada primer kedua F¢ AGTCCAGCCCTTCTATGATCA dan R¢ TGTTCTGCAGGAGGAAGTGT. Optimasi primer pada tahap konfirmasi dilakukan dengan kisaran suhu annealing 46, 48, dan 52 °C didapatkan hasil visualisasi elektroforesis yang menunjukkan adanya pita DNA dengan ukuran +600 bp pada ketiga kondisi suhu. Kesimpulan pada penelitian ini adalah didapatkan dua primer yang spesifik terhadap gen COX-1 Aedes egypti. AbstractThe COX-1 gene (Cytochrome Oxidase Subunit I) is one of the molecular marker for species identification based on mitochondrial DNA. The purpose of this study was to obtain specific COX-1 gene primers for A. aegypti mosquitoes. This research was an observational descriptive study, namely by carrying out the primary design in silico and in vitro confirmation marked by DNA bands from PCR results. The first step of this method is to download the COX-1 Aedes aegypti DNA sequence from the Gene Bank (NCBI) with accession number DQ397892.1. The results from Primer3web obtained two specific primers, namely, the first primer had the sequences F¢AGCAACTTTACACGGAACTCA and R¢TGTTCTGCAGGAGGAAGTGT and the second primer had F¢AGTCCAGCCCTTCTATGATCA and R¢TGTTCTGCAGGAGGAAGTGT. Primer optimization at the confirmation stage was carried out with annealing temperature ranges of 46, 48, and 52 °C. The results of electrophoretic visualization showed the presence of DNA bands with a size of +600 bp at all three temperature conditions. The conclusion of this study was that there were two specific primers  for the COX-1 gene of A. aegypti.
Correlation between belief in science and belief in pseudoscience in high school students Maghfiroh, Adinda Zahwatun; Pantiwati, Yuni; Husamah, H.; Permana, Tutut Indria; Fauzi, Ahmad
Biosfer: Jurnal Pendidikan Biologi Vol. 17 No. 1 (2024): Biosfer: Jurnal Pendidikan Biologi
Publisher : Universitas Negeri Jakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21009/biosferjpb.37447

Abstract

Dissemination of news through social media is one of the biggest causes of increasing student’s trust in pseudoscience. The purpose of this correlational study was to analyze the relationship between belief in science and pseudoscience beliefs related to biology in high school students. This research entails a correlational study conducted through a survey methodology. The results of the study show that the ability to believe in science has a significant effect on students' belief in pseudoscience related to biology for high school students. Based on the research, the initial hypothesis of the study was rejected, that there is a positive relationship between belief in science and belief in pseudoscience related to biology, thus indicating that increasing students' confidence in science will also increase students' confidence in pseudoscience related to biology. This is due to the continuous spread of unscientific issues through social media which will affect the increase in trust in pseudoscience. The increase in pseudoscience is due to the lack of student media literacy so that it can affect the way students respond to news that is on social media. The lack of education regarding students' media literacy is a factor in increasing students' confidence in pseudoscience related to biology for high school students.
Pengembangan Profesionalisme Guru di SMP Aisyiyah Muhammadiyah 3 Malang melalui Pelatihan Penulisan Publikasi Ilmiah Permana, Tutut Indria; Dian Ika Kusumaningtyas; Marina Nur Fitriyaningsih; Artha Ayu Mei Shinta; Khilma Vita Nurmayasari; Hajriani Hi.Padu; Dina Ria Pramesti; Munica Dwi Febriyanti
Jurnal SOLMA Vol. 11 No. 1 (2022)
Publisher : Universitas Muhammadiyah Prof. DR. Hamka (UHAMKA Press)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22236/solma.v11i1.8010

Abstract

Background: Guru selain berkewajiban menyampaikan ilmu pengetahuan kepada siswa, mereka juga berkewajiban mengembangkan ilmu pengetahuan melalui penelitian. Kegiatan penelitian ini juga penting dalam mengembangkan profesionalisme mereka. Kegiatan pengabdian ini bertujuan untuk memberikan pelatihan penulisan publikasi ilmiah guru di SMP Aisyiyah Muhammadiyah 3 Malang. Metode: Mitra kegiatan pengabdian adalah guru di SMP Aisyiyah Muhammadiyah 3 Malang yang berjumlah 14 orang. Metode pelaksanaan dilakukan dengan cara sosialisasi program, pemberian materi, dan pendampingan penulisan proposal. Pengambilan data dilakukan dengan survey dan observasi. Hasil: Kegiatan pengabdian menghasilkan lima topik penelitian tindakan kelas dan satu proposal yang sudah dilengkapi dengan instrumennya. Hanya 7,1% dari guru di sekolah mitra yang bisa menghasilkan proposal penelitian (PTK). Kesimpulan: Hasil kegiatan ini masih sangat rendah dari target program, sehingga kegiatan pengabdian akan terus berlanjut untuk mendukung para guru di SMP Aisyiyah Muhammadiyah 3 Malang agar bisa menghasilkan publikasi ilmiah.
Teaching Biology for Sustainability: Insight from Scopus AI Husamah, H.; Rahardjanto, Abdulkadir; Permana, Tutut Indria
Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Vol. 9 No. 3 (2025): November
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/2z9cbt64

Abstract

In the face of escalating environmental crises, climate change, and global sustainability challenges, biology education holds a critical role in shaping ecological literacy and responsible citizenship. This study conducted an AI-assisted scoping review using Scopus AI to synthesize key insights, methods, and emerging themes in teaching biology for sustainability between 2020–2025. From N records retrieved, M studies met inclusion criteria for qualitative synthesis based on abstracts and Scopus AI summaries. Using both natural language and keyword-based searches, the study systematically identified peer-reviewed journal articles that explore sustainability integration in biology and life science education. A PRISMA-guided process was applied to ensure transparent identification, screening, and inclusion. The retrieved data were analyzed qualitatively to map pedagogical innovations, thematic clusters, and conceptual linkages among core sustainability elements. Findings indicate that approximately X of M studies emphasize project-based or problem-based learning, while Y address biomimicry or systems thinking approaches. Effective sustainability-oriented biology education is grounded in the integration of Education for Sustainable Development (ESD) and systems thinking, supported by student-centered pedagogies such as problem-based, project-based, and experiential learning. Additionally, biomimicry and digital learning technologies—including online multimedia tools and Electronic/Mobile/Ubiquitous (E/M/U) learning—emerge as transformative approaches that enhance student engagement, critical thinking, and ecological responsibility. Equity and feasibility issues remain critical, particularly concerning bandwidth limitations, access to devices, and inclusivity for students with disabilities. Therefore, low-cost, accessibility-aware strategies such as biomimicry mini-projects and E/M/U-enabled ecological audits are recommended. Despite these advances, challenges remain concerning educator readiness, risk of indoctrination, and institutional constraints. The concept map generated through Scopus AI highlights three interconnected clusters—Ecological Awareness, Student-centered Pedagogies, and Sustainability Education—reflecting a shift from content transmission to transformative learning. Overall, this review concludes that biology education must evolve beyond content mastery to integrate ethical, technological, and transdisciplinary dimensions—empowering learners not only to understand life but to sustain it—aligned with SDG 4 (Quality Education), SDG 13 (Climate Action), and SDG 15 (Life on Land).
The urgency of developing and validation of sustainability competence instruments for prospective teachers in Indonesia Abdulkadir Rahardjanto; H. Husamah; Tutut Indria Permana; Nurdiyah Lestari
JPBI (Jurnal Pendidikan Biologi Indonesia) Vol. 11 No. 2 (2025): JULY
Publisher : University of Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jpbi.v11i2.40825

Abstract

The urgency of developing and validating sustainability competence instruments for prospective teachers in Indonesia stems from the pivotal role teachers play in embedding sustainable development principles into education. This study aims to analyze this urgency, synthesize key themes, and visualize conceptual relationships using data collected via Scopus AI. Employing a systematic review methodology with advanced keyword searches and thematic qualitative analysis, the study identifies major themes such as assessment tools, teacher education, and education for sustainable development. Findings reveal significant gaps in culturally relevant, validated instruments tailored for Indonesian prospective teachers, alongside challenges including limited technological infrastructure and the need for ongoing professional development. The study concludes that developing robust competence instruments is vital to strengthen teacher training programs in alignment with Sustainable Development Goals (SDGs). The implications highlight the necessity of integrating digital skills, experiential learning, and community engagement to better prepare future educators for sustainability education. This review lays a foundation for future empirical research and policy initiatives aimed at enhancing sustainability competence assessment within Indonesia’s teacher education system.
The relationship between environmental literacy, ecological literacy, and science for sustainability: A systematic literature review H. Husamah; Abdulkadir Rahardjanto; Tutut Indria Permana; Nurdiyah Lestari
Research and Development in Education (RaDEn) Vol. 5 No. 1 (2025): July
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/raden.v5i1.39957

Abstract

Global environmental changes driven by human behavior challenge sustainability, requiring environmental literacy (EL), ecological literacy (EcL), and science for sustainability (SfS) to foster awareness and evidence-based decisions, though their interconnections remain poorly understood. This study aimed to identify global research trends on EL, EcL, and SfS and explore their relationships in terms of subject areas, keyword distribution, thematic evolution, research instruments, sample populations, and materials. A systematic literature review (SLR) approach was applied, analyzing 11 articles retrieved from Scopus. Data visualization and analysis were conducted using VOSviewer, Rstudio/Biblioshiny, and the Scopus system. The findings highlight the dominance of social sciences, emphasizing the importance of social dimensions in sustainability research, followed by environmental sciences, which focus on ecological aspects. Contributions from agriculture, humanities, business, and engineering reinforce the need for a multidisciplinary approach. EL and sustainability emerge as central nodes, with key terms such as environmental education, learning, and ecology strengthening their link to education. Ecology education, domestic waste, critical theory, and action research indicate broader applications beyond formal education. Research in this domain is evolving, integrating education, technology, and behavioral sciences to develop innovative sustainability solutions.
Teaching Biology for Sustainability: Insight from Scopus AI Husamah, H.; Rahardjanto, Abdulkadir; Permana, Tutut Indria
Jurnal Penelitian dan Pengkajian Ilmu Pendidikan: e-Saintika Vol. 9 No. 3 (2025): November
Publisher : Lembaga Penelitian dan Pemberdayaan Masyarakat (LITPAM)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36312/2z9cbt64

Abstract

In the face of escalating environmental crises, climate change, and global sustainability challenges, biology education holds a critical role in shaping ecological literacy and responsible citizenship. This study conducted an AI-assisted scoping review using Scopus AI to synthesize key insights, methods, and emerging themes in teaching biology for sustainability between 2020–2025. From N records retrieved, M studies met inclusion criteria for qualitative synthesis based on abstracts and Scopus AI summaries. Using both natural language and keyword-based searches, the study systematically identified peer-reviewed journal articles that explore sustainability integration in biology and life science education. A PRISMA-guided process was applied to ensure transparent identification, screening, and inclusion. The retrieved data were analyzed qualitatively to map pedagogical innovations, thematic clusters, and conceptual linkages among core sustainability elements. Findings indicate that approximately X of M studies emphasize project-based or problem-based learning, while Y address biomimicry or systems thinking approaches. Effective sustainability-oriented biology education is grounded in the integration of Education for Sustainable Development (ESD) and systems thinking, supported by student-centered pedagogies such as problem-based, project-based, and experiential learning. Additionally, biomimicry and digital learning technologies—including online multimedia tools and Electronic/Mobile/Ubiquitous (E/M/U) learning—emerge as transformative approaches that enhance student engagement, critical thinking, and ecological responsibility. Equity and feasibility issues remain critical, particularly concerning bandwidth limitations, access to devices, and inclusivity for students with disabilities. Therefore, low-cost, accessibility-aware strategies such as biomimicry mini-projects and E/M/U-enabled ecological audits are recommended. Despite these advances, challenges remain concerning educator readiness, risk of indoctrination, and institutional constraints. The concept map generated through Scopus AI highlights three interconnected clusters—Ecological Awareness, Student-centered Pedagogies, and Sustainability Education—reflecting a shift from content transmission to transformative learning. Overall, this review concludes that biology education must evolve beyond content mastery to integrate ethical, technological, and transdisciplinary dimensions—empowering learners not only to understand life but to sustain it—aligned with SDG 4 (Quality Education), SDG 13 (Climate Action), and SDG 15 (Life on Land).
Mitigating teacher professionalism problem in Indonesia: What Scopus AI tell us? H. Husamah; Jazilah Azizah; Tutut Indria Permana; Yanur Setyaningrum; Iin Hindun
Jurnal Pendidikan Profesi Guru Vol. 6 No. 2 (2025): Agustus
Publisher : Universitas Muhammadiyah Malang

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22219/jppg.v6i2.37934

Abstract

Teacher professionalism in Indonesia remains a central concern in educational reform, impacting the overall quality of education. Despite significant efforts through government initiatives, certification programs, and professional development schemes such as PPG and the Competence Test for Teachers, challenges persist. Limited access to training, inadequate workplace culture, and political resistance hinder effective reform. This study aims to analyze the current efforts, policy initiatives, contributing factors, and best practices addressing teacher professionalism in Indonesia. A comprehensive literature review, utilizing Scopus AI’s advanced search tools, was conducted to identify prevailing themes, challenges, and emerging trends. Key findings suggest that while initiatives like "kampus mengajar" and heutagogy-informed education models show promise, the success of these programs depends heavily on improved access to training, better school infrastructure, and overcoming bureaucratic barriers. The study concludes that a holistic approach integrating training, workplace culture reform, and technological tools is essential for enhancing teacher professionalism.
Co-Authors Abdulkadir Rahardjanto Abdulkadir Rahardjanto Abdulkadir Rahardjanto Abdulkadir Rahardjanto, Abdulkadir Agustin, Jihan Ully Ahmad Adnan Mohd Shukri Ahmad Adnan Mohd Shukri Ahmad Fauzi Ainur Rofieq Ainur Rofieq Aldina, Siti Nur Alia Zaskia Alimatul, Zada Amaliyah Dina Anggraeni Andini, Tri Eka Anka Mohammad Dinindra Ardiani Samti Nur Azizah Ardiani Samti Nur Azizah Artha Ayu Mei Shinta Artha Ayu Mei Shinta Asmah Hidayati Atok Miftachul Hudha Aulia Savitri Ayu, Putri Azizah, Jalilah Cahyono, Shafa Rimbi Riskia Citra Lesmana Dalifah, Umrohatul Dhiga Agung Sasongkojati Dian Ika Kusumaningtyas Diani Fatmawati Diani Fatmawati Diani Fatmawati Dina Ria Pramesti Dina Ria Pramesti Dinindra, Anka Muhammad Diva Aulia Salsabila Dwi Listyorini Dwi Setyawan Elly Purwanti Etty Nurmala Fadillah Fadli, Rahman Farida Rachmawati, Farida Fatchur Rohman Fauzi Ahmad Muda Ganes, Tegar Gunarta Gunarta Hadi Suwono Hajriani Hi.Padu Hajriani Hi.Padu Hanik Fitrotul Azizah Hasan, Aso Hameed Hasmiati Hasmiati Hermanto, Feri Eko Hidajah Rachmawati Hidayat, Nur Hadi Husamah Husamah I Gusti Ngurah Agung Wiwekananda I Ketut Suada Iin Hindun Iin Hindun Ikmal Reza Fahlevy Indrawan Prasetyo Ivan Ardiansyah Jalilah Azizah Janufian, Fairus Athar Jazilah Azizah Jihan Ully Agustin Juliana, Imelda Khilma Vita Nurmayasari Khilma Vita Nurmayasari Khoiriyah, Zakiyatul Kiky Martha Ariesaka Kiky Martha Arieska Kurnia Ayu Miranti Kurnia Ayu Miranti Lestari, Novi Puji Levina Levina, Levina Ludwick Satria Romadoni Lutfi, Muhammad Ahman Maghfiroh, Adinda Zahwatun Marina Nur Fitriyaningsih Marina Nur Fitriyaningsih Mimien Henie Irawati Miza Nina Adlini Moh Irfan Nurhamdani Moh Mirza Nuryady, Moh Mirza Moh. Mirza Nuryady Moh. Mirzha Nuryady Muhammad Ahman Luthfi Setiawan Muhammad Dheo Refaldo Wahyudi Muliana GH Munica Dwi Febriyanti Munica Dwi Febriyanti Nazila, Farah Ndzani Latifatur Rofi’ah Ndzani Latifatur Rofi’ah Nomleni, Fransina Thersiana Norizhati Nur Ilmi Dwi Sasmitasari Nurdiyah Lestari Nuryady, Mohamad Mirza Putri Ayu Irrodah Qibtiyah, Siti Mariyatul Rahmawati, Hanifa Rizky Ramadhan, Rizki Sabilul Alif Rochani, Aning Rofi'ah, Ndzani Latifatur Rohmah, Ladysyah Fitri Roimil Latifa Roimil Latifa Romadoni, Ludwick Satria Rr. Eko Susetyarini Rr. Eko Susetyarini Saleh Hidayat Saleh Hidayat Samsun Hadi Samsun hadi Sanjaya, Andika Wahyu Bagus Sasmitasari, Nur Ilmi Dwi Savitri, Aulia Shukri, Ahmad Adnan Mohd Siti Mariyatul Qibtiyah Siti Nur Aldina Siti Zaenab Sri Wahyuni Sri Wahyuni Sukarsono Sukarsono Tri Eka Andini Vivi Indriani Wahyu Prihanta Wahyu Prihanta Warkoyo, W. Y. Oikawa Yanur Setyaningrum Yasmine Salsabila Muninda Yeni Setyaningsih Yuni Pantiwati Yuni Pantiwati Zada Alimatul Mu’azah Zafira, Aulia Mahdiyatul Dwi Zakiyatul Khoiriyah Zaskia, Alia