Claim Missing Document
Check
Articles

Found 27 Documents
Search

Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR Soni Muhsinin; Maria Martina Sulastri; Dadih Supriadi
Jurnal Sains Farmasi & Klinis Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1065.944 KB) | DOI: 10.25077/jsfk.5.3.191-200.2018

Abstract

Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.
Desa Mitra dalam Budidaya Tanaman Obat Keluarga Menuju Desa Cibiru Wetan sebagai Sentra Herbal Fauzan Zein Muttaqin; Widhya Aligita; Soni Muhsinin; Dadang Juanda; Aiyi Asnawi
Jurnal Pengabdian Pada Masyarakat Vol 3 No 2 (2018)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (650.779 KB) | DOI: 10.30653/002.201832.59

Abstract

PARTNER VILLAGE IN FAMILY MEDICINE PLANT CULTIVATION TOWARDS CIBIRU WETAN VILLAGE AS A HERBAL CENTER. The area of ​​Cibiru Wetan Village is a farming area because besides the limited water supply, the land is hilly. With the initiative and participation of women farmer groups which had so many achievements and skills, it was necessary to explore the potential that could provide a new icon for Cibiru Wetan Village. The purpose of the activity was to socialize and practice the cultivating of the medicinal plants carried out by a group of women farmers with simple and effective technology and finally able to become a center of dried herbs production. The method used in the cultivation program for medicinal plants was divided into three stages. The first stage was to provide material counseling on family medicinal plants including the understanding of the benefits of the plant, the second stage was to provide an explanation or training in planting family medicinal plants and the last stage or third stage was to practice directly in planting these medicinal plants. The results showed a positive understanding of both groups for both the socialization and counseling stages as well as for the practice of medicinal plants cultivation. It could be concluded, the partner village activities in medicinal plants cultivation could improve the understanding of the target group.
Peningkatan Potensi Ibu Rumah Tangga dalam Mengolah Sampah Organik Rumah Tangga Menggunakan Metode Takakura di Desa Cibiru Wetan, Kabupaten Bandung Soni Muhsinin; Deden Indra Dinata; Ivan Andriansyah; Aiyi Asnawi
Jurnal Pengabdian Pada Masyarakat Vol 4 No 2 (2019)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (692.456 KB) | DOI: 10.30653/002.201942.110

Abstract

INCREASING OF HOUSEWIVES POTENTIAL IN PROCESSING DOMESTIC ORGANIC WASTE BY USING TAKAKURA METHOD IN CIBIRU WETAN VILLAGE, BANDUNG REGENCY. Domestic waste (DW) is a major environmental challenge for many urban local bodies in Indonesia both in the village and in the city, where urbanization, industrialization and economic growth have resulted in increased waste generation per person. One way to solve this waste is to turn organic domestic into compost. Composting, the recycling of organic waste such as vegetation and food waste reduces the amount of waste going to landfill and is, therefore, a rapidly growing sector. Desa Cibiru Wetan, Kab. Bandung, West Java is one of the villages that has learned about how to process organic waste into compost and become a pilot project but because of the distance between raw materials and management with compost incubator so that compost production is disturbed. Therefore, the purpose of the project activity was to produce compost from domestic organic waste by the Takakura method. In this method, a small incubator was used and placed at the home of the community. Although on a small scale but with many multipliers, it able to produce an abundant compost and can be an alternative for the existing compost incubator method. The stage included counseling and socialization, training in making incubator Takakura, training in production compos,t and monitoring and evaluation. The results showed a good understanding of both groups for both the socialization and counseling stages as well as for the practice of production of compost. In conclusion, the activity on the production of compost by using Takakura method able was to solved for domestic organic waste and remind set the interest of the community in producing compost.
Peningkatan Potensi Anggota KWT dalam Pemanfaatan Pekarangan untuk Tanaman Obat dan Kosmetika Menggunakan Metode Tanam Vertikal di Desa Cibiru Wetan, Kabupaten Bandung Widhya Aligita; Fauzan Zein Muttaqin; Soni Muhsinin; Ellin Febrina; Aiyi Asnawi
Jurnal Pengabdian Pada Masyarakat Vol 4 No 4 (2019)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (627.131 KB) | DOI: 10.30653/002.201944.187

Abstract

POTENTIAL DEVELOPMENT OF WOMAN FARMING GROUP IN THE UTILIZATION OF THE YARD FOR DRUG AND COSMETICS PLANTS USING VERTICAL GARDEN METHOD IN CIBIRU WETAN VILLAGE, BANDUNG REGENCY. The village of Cibiru Wetan is largely a rice field and swidden area with hilly contours and insufficient water availability. One of the utilization of fields with a lack of water is by growing plants that require minimal water, including medicinal plants and cosmetics. The initiation of this activity has a high prospect of success due to the high initiative and participation of the population in the form of women's farmer groups and the family welfare team as evidenced by the many achievements, awards, and skills gained by the Cibiru Wetan Village through the participation of its citizens. Therefore, the purpose of the project activity was socialization and practice at women’s farmer group of Cibiru Wetan Village through the use of medicinal plants and cosmetics with simple appropriate technology through vertical gardening. The method of implementation used in the training program for planting medicinal plants was divided two stage, that was providing information about family medicinal plants ranging from understanding to the benefits of the plants, and the last step was explaining or training and direct practice of planting medicinal plants and cosmetics using vertical planting. The results showed a positive understanding of the two groups of women’s farmer group I and II and the family welfare team, both for the stage of socialization and counseling as well as for the practice phase of planting medicinal plants and cosmetics vertically. The conclusion was the use of medicinal plants and cosmetics could increase the understanding of the target group and the compost produced by residents could be utilized through this activity.
Upaya Peningkatan Pemahaman Kesehatan Lingkungan melalui Pemanfaatan Sampah Plastik dari Kaleng Cat di Desa Cibiru Wetan, Kabupaten Bandung, Jawa Barat Widhya Aligita; Soni Muhsinin; Fauzan Zein Muttaqin; Anne Yuliantini; Aiyi Asnawi
Jurnal Pengabdian Pada Masyarakat Vol 5 No 3 (2020)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30653/002.202053.370

Abstract

EFFORTS TO IMPROVE UNDERSTANDING OF ENVIRONMENTAL HEALTH THROUGH UTILIZATION OF PLASTIC WASTE IN CIBIRU WETAN VILLAGE, KABUPATEN BANDUNG, WEST JAWA. Plastic waste can contaminate soil, air, sea, and even air, because plastic is difficult to degrade. Cibiru Wetan Village, Kabupaten Bandung, is a growing area for new housing. As the area grows, the rest of the development becomes waste, such as cans. Cans can hold water and can be a breeding ground for mosquitoes that will interfere with health. One way to reduce this impact is by utilizing can trash into plant pots. Therefore, the purpose of this community service activity was the utilization of tin waste for pots in an effort to increase community awareness in environmental health. The stages of this activity began from providing an understanding of environmental health ranging from understanding, garbage, the environment, health to its use and training in making pots from can garbage material. The results of the activity showed that community participation in this activity was quite high, which meant that awareness to support environmental health began to take shape. In addition, this activity could also improve the ability of participants in the waste recycling process.
Kemitraan Asosiasi Profesi Kesehatan dalam Aplikasi Metode KESET untuk Menangani Stress di Masa Pandemi Covid-19 bagi Masyarakat Desa Cibiru Wetan dan Praktisi Apoteker Kabupaten Sumedang, Jawa Barat Aiyi Asnawi; Widhya Aligita; Soni Muhsinin; Nur Intan Hayati Husnul Khotimah; Eki Pratidina; Iceu Mulyati; Yulianti Anjayani; Ellin Febrina; Fauzan Z Muttaqin
Jurnal Pengabdian Pada Masyarakat Vol 6 No 1 (2021)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30653/002.202161.671

Abstract

PARTNERSHIP OF THE HEALTH PROFESSIONAL ASSOCIATION IN THE APPLICATION OF THE KESET METHOD TO MANAGE STRESS DURING THE COVID-19 PANDEMIC FOR THE PEOPLE OF CIBIRU WETAN VILLAGE AND PHARMACIST PRACTITIONERS IN SUMEDANG REGENCY, WEST JAVA. EFT (Emotional Freedom Technique) is an alternative treatment method that offers healing from physical and emotional pain and disease. EFT works by tapping on acupressure meridians to release blockages. When these blockages are released, the problem feeling can be released and move through the body. Learning EFT also empowers the client to take charge of handling their emotional state/ controls stress. because they can tap on a feeling any time, they want to move out a painful feeling. Impact of quarantine or PSBB, the restriction of movement of people, is the mental health toll became even steeper including for community of Desa Cibiru Wetan and pharmacist of Kabupaten Sumedang, West Java. Therefore, the purpose of this community service activity was to transfer knowledge about the EFT method for stress management during the Covid-19 pandemic for the Desa Cibiru Wetan community and pharmacist in Kabupaten Sumedang, West Java. The stages of this activity began from education about stress and its prevention, and continues with the introduction of the KESET method in managing stress independently. The critical point in this activity is how to transfer knowledge and skills in preparing the participants who use this technique believe tapping the body can create a balance in their energy system and treat pain. The results of the activity showed that community participation could improve the knowledge and ability of participants in handling their emotional state/ controls stress by using KESET method. In conclusion, this activity could be an alternative healing from emotional pain for participants.
Peningkatan Potensi Ibu Rumah Tangga Peternak Sapi Perah dalam Membuat Yoghurt di Desa Cibiru Wetan, Kabupaten Bandung, Jawa Barat Aiyi Asnawi; Widhya Aligita; Soni Muhsinin; Eki Pratidina; Iceu Mulyati; Ika Kana Trisnawati; Ellin Febrina; Fauzan Zein Muttaqin
Jurnal Pengabdian Pada Masyarakat Vol 6 No 3 (2021)
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30653/002.202163.775

Abstract

INCREASING THE POTENTIAL OF DAIRY CATTLE HOUSEWIVES IN MAKING YOGHURT IN CIBIRU WETAN VILLAGE, BANDUNG REGENCY, WEST JAVA. Yogurt is the product of milk fermentation by Lactobacillus subspecies. The unique properties of yoghurt provided by its living bacteria and its nutrients have captured the interest of the community. The highest price of cow's milk in dairy farming centres of Cibiru Wetan Village, Kabupaten Bandung is purchased by the Milk Processing Industry (IPS) at around IDR 4,500 / litre. Therefore, the purpose of this community service activity was the utilization of fresh cow milk as yoghurt to increase the income of dairy cattle farmer. Yoghurt processing begins with the modification of the incoming milk composition. This process typically involves reducing the fat content and increasing the total solids in the milk by are Lactobacillus bulgaricus and Streptococcus thermophilus. The stages of this activity began from providing an understanding of milk and dairy products and training in making yoghurt from fresh cow milk. The critical point in this activity is how to transfer knowledge and skills in preparing the starter and sterile conditions of the cooking utensils. The results of the activity showed that community participation could improve the knowledge and ability of participants in the processing of fresh cow milk as yoghurt. In conclusion, this activity could be an alternative income for dairy cattle farmer.
Peningkatan Kesiapsiagaan Kader PKK Cibiru Wetan untuk Ketahanan Bencana di Masa Pandemi COVID-19 Nur Intan Hayati Husnul Khotimah; Fauzan Zein Mutaqin; Soni Muhsinin; Widhya Aligita; Eki Pratidina; Iceu Mulyati; Yulianti Anjayani; Untung Sudharmono; Etika Emaliyawati; Ellin Febrina; Aiyi Asnawi
Jurnal Pengabdian Pada Masyarakat Vol 7 No 2 (2022): Jurnal Pengabdian Pada Masyarakat
Publisher : Universitas Mathla'ul Anwar Banten

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (588.082 KB) | DOI: 10.30653/002.202272.87

Abstract

IMPROVİNG THE PREPAREDNESS OF CİBİRU WETAN PKK CADRES FOR DİSASTER RESİLİENCE DURİNG THE COVİD-19 PANDEMİC. Cibiru is a high-risk area for natural and man-made disasters, so efforts must be made to reduce the risk of disaster impacts. One effort that can be made is to strengthen the Cibiru Wetan village's resilience by increasing preparedness to deal with emergency cases caused by disasters, such as cases of respiratory arrest, cardiac arrest, trauma, and respiratory emergencies caused by COVID-19. Community service is performed to improve the preparedness of Cibiru Wetan PKK cadres for disaster-resilient village resilience during the COVID-19 Pandemic. The method of implementing community service by simulating basic life support, trauma event handling, prevention and handling of COVID-19 emergencies, and the production of health drinks made from natural ingredients such as ginger, honey, lime, cardamom, and turmeric to boost immunity. As a result, the Cibiru Wetan PKK cadres were able to simulate basic life support, first aid in the event of trauma, and respiratory disorders caused by COVID-19, as well as process natural ingredients into healthy drinks to increase immunity, thereby increasing the Cibiru Wetan village's resilience.
Perencanaan Sumber Daya Manusia Kesehatan Rumah Sakit Melalui Pelatihan Aplikasi Software Workload Indicators of Staffing Need: Hospital Health Human Resource Planning Through Software Application Training Workload Indicators of Staffing Need Richa Noprianty; Winasari Dewi; Soni Muhsinin; Sri Soleha; Ina Sugiharti; Ivan Andriyansyah
PengabdianMu: Jurnal Ilmiah Pengabdian kepada Masyarakat Vol. 8 No. 5 (2023): PengabdianMu: Jurnal Ilmiah Pengabdian kepada Masyarakat
Publisher : Institute for Research and Community Services Universitas Muhammadiyah Palangkaraya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.33084/pengabdianmu.v8i5.4991

Abstract

Hospitals are one of the health services that are required to improve the quality of services that depend on the ability of human resources (HR). Therefore, planning HR needs must be calculated precisely based on needs. There are various approaches to calculating health workers, including the WISN method, where the calculation is based on workload. The purpose of this community service is to socialize the WISN software from WHO. This activity partnered with three hospitals, namely RSUD Subang with 16 people, RSUD Dr Slamet Garut with 18 participants, and RSUD Kota Bandung with 17 people. The activity is in progress from November to December 2023 and is carried out hybridly. The offline meeting was given a pre-test, then WISN socialization was carried out, and at the end, a post-test was given. Meanwhile, the online meeting invited speakers related to the WISN software application technicalities through the Zoom meeting application. Participants who attended were 51 people, consisting of hospital management. The pre-test results showed a mean value of 8.92 while the post-test value was 11.00, and the T-test results obtained a value of 0.02 (sig >0.05), meaning that there was an increase between the pre-test and post-test with an average increase of 2.29. The workshops and trainings went well. The hospital plans to calculate the workload using the WISN software as a comparison with the existing methods in the hospital.
PELATIHAN DAN WORKSHOP PEMBUATAN HAND SANITIZER OLEH IBU-IBU MAJELIS TA’LIM MASJID RAYA AL SYAHADAH KOMPLEK BUMI ORANGE Garnadi Jafar; Yuyun Yuyun; Soni Muhsinin
Jurnal Pengabdian Masyarakat (Jupemas) Vol 1, No 2 (2020)
Publisher : Universitas Bakti Tunas Husada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.36465/jupemas.v1i2.662

Abstract

Dimasa pandemik global Covid 19 yang sekarang sedang kita jalani dan sama sekali belum ada titik terang  waktu pandemik ini  berakhir. Menurut peraturan dari pemerintah bahwasannya untuk sarana umum atau tempat berkumpul banyak orang maka harus senantiasa menerapkan protokol kesehatan dalam rangka memutus penularan Covid 19, dari sekian banyak  protokol kesehatan adalah menggunakan hand sanitizer. Masjid adalah sarana ibadah umat muslim dalam melakasanakan sholat berjamaah sehari terdapat lima waktu sholat. Dalam melaksanakan sholat berjamaah sudah barang tentu terdapat berkumpulnya sekian banyak orang oleh karena itu diperlukan salah satu pencegahan dalam sanitasi pembersihan tangan  sebelum masuk masjid yaitu hand sanitizer.